AC215 |
AGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATA |
57 |
1 |
1 |
PAGE |
AC216 |
CCATTCTTTTGTTTGTCTGCCATGATGTATACATTGTGTGAGTTATAGTTGTA |
53 |
1 |
1 |
PAGE |
AC217 |
TGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTG |
57 |
1 |
1 |
PAGE |
AC218 |
TCTGCTAGTTGAACGCTTCCATCTTCAATGTTGTGTCTAATTTTGAAGTTA |
51 |
1 |
1 |
PAGE |
AC219 |
GGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGG |
53 |
1 |
1 |
PAGE |
AC220 |
CAGGTAATGGTTGTCTGGTAAAAGGACAGGGCCATCGCCAATTGGAGTATTTT |
53 |
1 |
1 |
PAGE |
AC221 |
TTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCC |
51 |
1 |
1 |
PAGE |
AC222 |
AAGAAGGACCATGTGGTCTCTCTTTTCGTTGGGATCTTTCGAAAGGGCAGA |
51 |
1 |
1 |
PAGE |
AC223 |
GAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATG |
51 |
1 |
1 |
PAGE |
AC224 |
CGGAATTCTTATTTGTATAGTTCATCCATGCCATGTGTAATCCCAGCAGCT |
51 |
1 |
1 |
PAGE |
AC1 |
GCCCTAGGCTATAAAAATAAATGATG |
26 |
1 |
1 |
PAGE |
AC2 |
ATAGGCCCAGGATGGTCAA |
19 |
1 |
1 |
PAGE |
AC3 |
ATCCTGGGCCTATCTGAAATG |
21 |
1 |
1 |
PAGE |
AC4 |
CGGAATTCTTATTTGTATAGTTCATCC |
27 |
1 |
1 |
PAGE |
The experimental procedure and analysis
1、Dissolving of primers
Sterile deionized water whose volume is determined by primer’s molecular weight is used to dilute the solution of the primer to 10um/L. And it is prepared for the following experiment.
2、Mixing of primers
Oligonucleotides synthesized in powder form need to be centrifuged for 1 min at 10000rpm to assemble powders to the bottom of the EP tube.And be careful to open the cap.
Make sure that the synthesis report is consistent to the OD number on the primer label,and check the number of the dispensing tube before the dissolution of oligonucleotides.The volume of water added to make 10umol/L oligonucleotides’ solution is calculated according to the synthetic single report of each primer. Add sterile deionized water and keep it at room temperature for 2min.And reverse the tube to accelerate the progress of solubilization. Finally, collect substances at the bottom of the tube after centrifugation.
Every six primers are combined to one group.Add 4ulbeginning fiprimer, 1ulintermediate primer and 4ul end primerto a new EP tube, then add sterile deionized water to 20ul, mix them up as spare.
组别 |
引物编号 |
吸取量 |
灭菌去离子水添加量 |
总体积 |
每PCR（50ul体系）吸取量 |
终浓度 |
A1 |
AC101 |
4 |
8 |
20 |
5ul |
200nM |
AC102 |
1 |
50nM |
AC103 |
1 |
50nM |
AC104 |
1 |
50nM |
AC105 |
1 |
50nM |
AC106 |
4 |
200nM |
A2 |
AC107 |
4 |
8 |
20 |
5ul |
200nM |
AC108 |
1 |
50nM |
AC109 |
1 |
50nM |
AC110 |
1 |
50nM |
AC111 |
1 |
50nM |
AC112 |
4 |
200nM |
A3 |
AC113 |
4 |
8 |
20 |
5ul |
200nM |
AC114 |
1 |
50nM |
AC115 |
1 |
50nM |
AC116 |
1 |
50nM |
AC117 |
1 |
50nM |
AC118 |
4 |
200nM |
A4 |
AC119 |
4 |
8 |
20 |
5ul |
200nM |
AC120 |
1 |
50nM |
AC121 |
1 |
50nM |
AC122 |
1 |
50nM |
AC123 |
1 |
50nM |
AC124 |
4 |
200nM |
A5 |
AC201 |
4 |
8 |
20 |
5ul |
200nM |
AC202 |
1 |
50nM |
AC203 |
1 |
50nM |
AC204 |
1 |
50nM |
AC205 |
1 |
50nM |
AC206 |
4 |
200nM |
A6 |
AC207 |
4 |
8 |
20 |
5ul |
200nM |
AC208 |
1 |
50nM |
AC209 |
1 |
50nM |
AC210 |
1 |
50nM |
AC211 |
1 |
50nM |
AC212 |
4 |
200nM |
A7 |
AC213 |
4 |
8 |
20 |
5ul |
200nM |
AC214 |
1 |
50nM |
AC215 |
1 |
50nM |
AC216 |
1 |
50nM |
AC217 |
1 |
50nM |
AC218 |
4 |
200nM |
A8 |
AC219 |
4 |
8 |
20 |
5ul |
200nM |
AC220 |
1 |
50nM |
AC221 |
1 |
50nM |
AC222 |
1 |
50nM |
AC223 |
1 |
50nM |
AC224 |
4 |
200nM |
DA-PCR
Every six primers which are single-stranded oligonucleotidesare chemically synthesized were combined to one group. Then they were going to be made as longer double-stranded fragments of intermediate (Block) by DA-PCR.
Procedure of DA-PCR：
Mixed primer solutions 5μl
Pfu DNA Polymerase 2.5U 0.5μl
dNTP 4μl
10×Pfu buffer（Mg2+） 5μl
ddH20add to 50μl
Procedure of DA-PCR：
94℃ 2min
94℃ 30S
50℃ 30S 25 cycles
72℃ 1min
72℃ 10min
4℃preservation
End
DA-PCR splicing reaction product was detected in 2% agarose gel electrophoresis,
DA-PCR product 5μl
10×Loading Buffer 0.6μl spotting after mixed
100bp Marker 5μl spotting directly
75V electrophoress for 1h。
4、OE-PCR
Take the 5 double strand intermediate fragment (Block) spliced by DA-PCR as templates, blocks were further connected by OR-PCR, OE-PCR in a reaction system consisting of:
Block1 1μl
Block2 1μl
Block3 1μl
Block4 1μl
Block5 1μl
Block6 1μl
Block7 1μl
Block8 1μl
AC1 1μl
AC4 1μl
Pfu DNA Polymerase 2.5U 0.5μl
dNTP 4μl
10×Pfu buffer（Mg2+） 5μl
Sterilized ultrapure water to 50ul
Procedure of OE-PCR：
94℃ 2min
94℃ 30S
50℃ 30S 20 cycles
72℃ 2min
72℃ 10min
4℃preservation
End
The full-length gene spliced by OE-PCR was detected by a 1% agarose gel electrophoresis, specific programs are as follows
OE-PCR product 5μl
10×Loading Buffer 0.6μl spotted after mixing well
100bp Marker 5μl spotted directly
80V electrophoresis for 1h。
5、Constructing and sequencing of subcloning vector
We design a primer AC-B with Blp I site and a primer AC-S with SgrA I site. Then we use RFP-promoter-GFP as template in PCR. Then we use Blp I and SgrA I enzyme to digest the target fragment and pET32a vector(37℃,3h) and link it overnight(16℃). After this step, transform the linked vector to competent cell(E.coli BL21) and select the desirable colony by using “Blue-White Selection” method.
Constitute of BlpⅠand SgrAⅠdouble enzyme digestion reaction system:
Gene or plasmid 10μl
BlpⅠ 0.3μl
SgrAⅠ0.3μl
10×NEBuffer 2.12μl
Sterilizing ultrapure watertop up to20μl
Constitute of linking reaction system：
RFP-promoter-GFP 10μl
pET32a 3μl
T4 ligase 0.5μl
10×T4 ligase Buffer 2μl
Sterilizing ultrapure water top up to 20μl
Preparation process of competent cell E.coliBL21：
(1) Culturing strain E.coliBL21(37℃)overnight to recovery culture, Adding overnight bacteria culture fluid 600uLto 30 mL LB culture medium, and 37℃，200 r/min shake culturing 1-2 h, until OD600 is around 0.3-0.4.
(2) In the aseptic condition, transfer 30mLbacteria fluid to the centrifugal tube in the ice 10 min to cooling the culture to 0℃.
(3) Centrifuging 10 min in precooling centrifugal machine over 4000r/min, throw supernate, and then add30mLprecooling 0.1mol/L CaCl2 solution to resuspension precipitation in the ice 10 min.
(4) Centrifuging 4000r/min in 4℃10min, throw supernate, each 30mL initial culture resuspension cell precipitation with 1.0mL precooling 0.1mol/LCaCl2 solution, and then 200μL each one.
Heal shock transformation process：
(1) Thawing freshly prepared or -80℃ competentcellBL21suspension.
(2) Add constructed recombinant cloning vector plasmidspSB1C3-A(no more than 50ng, 10μl), shake gently, and then in the ice 30min.
(3) Put EP tube in 42℃ water bath90s，and then transfer it to ice water bath to cool cells1-2 min.
(4) add 800μL LB medium to EP tube，transfer it to 37℃ table，150r/min，to recovery strain 45 min.
Spread plate and Culture
(1)After culture in 37℃, centrifuge the cell solution(5000rpm,5min) and concentrate it to 200μl. Then coat it to LB culture with chloramphenicol and set a positive control.
(2) Wait until the solution in culture is full absorbed by cell, then invert the plate and culture it in 37℃ overnight.
Sequence test
On the pET32a vector(as shown in Fig 1), use the RFP-promoter-GFP gene (1535bp) to replace the fragment between BlpⅠ site and SgrA I site (753bp) and then we get the reconstructed plasmid, pET-mlr promoter.
图3 Map of pET-mlr promoter
Select the white colony on culture and culture it. Then we extract the plasmid and use it as template in PCR to identify the colony. In theory, the reconstructed vector with RFP-promoter-GFP fragment is 1728bp and the empty vector without mlrA fragment is 946bp. So, the result shows that the white colony we select has reconstructed vector with mlrA fragment in it.
Figure 3 PCR identification of recombinant vector pET-mlr promoter
Illustration of the outcome：
1、L1, L2 could be amplified to 1700bp products, the recombinant vector contained a foreign gene RFP-promoter-GFP according to the result of the identification.
2、M was 1000bp Ladder Marker
The positive clones which were proved to contain the recombinant vectors pET-mlr promoter by PCR identification. were sent to 吉林库美生物科技限公司to be sequenced. The results showed (Figure 4), RFP-promoter-GFP sequence is consistent with the design sequence.
Figure 4 Sequencing results with the design sequence alignment
The relationship detection between MLR promoter and microcystin LR
Single colony containingthe recombinant vector pET-mlr promoterwas picked ,vigorously shaken culture for 4-5h in LB liquid medium at 37 ℃，the culturing stopped until OD600 reached 0.3 - 0.4, 10-fold dilution to 10-5-10-7with sterilized water, taking 100ul to coat on the LB plate containing 10ug / L microcystin LR, 37 ℃ for overnight.
Single cultured colony was placed in the UV lamp darkroom, we observed colony color and found that it luminesced green light, indicating that when there is microcystin LR, mlr promoter can promote the expression of GFP, which makes the single colony of E.coli BL21 luminescing green fluorescence in the UV lamp.
"
