|
|
(8 intermediate revisions not shown) |
Line 1: |
Line 1: |
- | <html> | + | {{Team:Hong_Kong_HKUST/shell| |
- | <head>
| + | <html><head> |
- |
| + | <style type="text/css"> |
- | <link rel="stylesheet" href="https://2014.igem.org/wiki/index.php?title=Template:Team:Hong_Kong_HKUST/anti-main.css&action=raw&ctype=text/css" type="text/css" > | + | td.content_cell{ |
- | <link rel="stylesheet" href="https://2014.igem.org/wiki/index.php?title=Template:Team:Hong_Kong_HKUST/indexpage.css&action=raw&ctype=text/css" type="text/css" > | + | text-indent:0; |
- | <script src="http://ajax.aspnetcdn.com/ajax/jQuery/jquery-1.11.1.min.js"></script>
| + | } |
- | <script src="https://2014.igem.org/wiki/index.php?title=Template:Team:Hong_Kong_HKUST/access-menu.js&action=raw&ctype=text/css"></script>
| + | </style> |
- | | + | </head></html> |
- | </head> | + | | |
- |
| + | <html><body> |
- | <body>
| + | |
- | <nav role="navigation">
| + | |
- | <ul class="access-menu">
| + | |
- | <li><a href="#">Home</a></li>
| + | |
- | <li>
| + | |
- | <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor">Pneumosensor</a>
| + | |
- | <ul class="access-submenu">
| + | |
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/module_one">Sensing</a></li>
| + | |
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/module_two">Expressing</a></li>
| + | |
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/parts">Parts</a></li>
| + | |
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/data">Data</a></li>
| + | |
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/characterization">Characterization</a></li>
| + | |
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/results">Results</a></li>
| + | |
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/future_work">Future Work</a></li>
| + | |
- | </ul>
| + | |
- | </li>
| + | |
- | <li>
| + | |
- | <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator">Riboregulator</a>
| + | |
- | <ul class="access-submenu">
| + | |
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/CR_TA_Feature_Page">Feature Page</a></li>
| + | |
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/RNA_devices_catalog">Catalog Page</a></li>
| + | |
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/parts">Parts</a></li>
| + | |
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/data">Data</a></li>
| + | |
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/characterization">Characterization</a></li>
| + | |
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/results">Results</a></li>
| + | |
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/future_work">Future Work</a></li>
| + | |
- | </ul>
| + | |
- | </li>
| + | |
- | <li>
| + | |
- | <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice">Human Practice</a>
| + | |
- | <ul class="access-submenu">
| + | |
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit">Start-up Kit</a></li>
| + | |
- | <li class= "indent_list"><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit/handbook" >--Handbook</a></li>
| + | |
- | <li class= "indent_list"><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit/report" >--Report</a></li>
| + | |
- | <li class= "indent_list"><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit/database" >--Database</a></li>
| + | |
- | <li class= "indent_list"><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit/interview" >--Interview</a></li>
| + | |
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/outreach">Outreach</a></li>
| + | |
- | <li class= "indent_list"><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/outreach/Workshop" >--Workshop</a></li>
| + | |
- | <li class= "indent_list"><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/outreach/talks" >--Talk</a></li>
| + | |
- | <li class= "indent_list"><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/outreach/isf_academy" >--ISF Academy</a></li>
| + | |
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/safety_and_ethics">Safety and Ethics</a></li>
| + | |
- | </ul>
| + | |
- | </li>
| + | |
- | <li>
| + | |
- | <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/team">Team</a>
| + | |
- | <ul class="access-submenu">
| + | |
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/team/members">Members</a></li>
| + | |
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/team/advisers">Advisers</a></li>
| + | |
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/team/instructors">Instructors</a></li>
| + | |
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/team/attribution">Attributions</a></li>
| + | |
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/team/acknowledgement">Acknowledgement</a></li>
| + | |
- | <li><a href="https://igem.org/Team.cgi?year=2014">Official Team Profile</a></li>
| + | |
- | </ul>
| + | |
- | </li>
| + | |
- | <li>
| + | |
- | <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/wetlab">Wetlab</a>
| + | |
- | <ul class="access-submenu">
| + | |
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/wetlab/notebook">Notebook</a></li>
| + | |
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/wetlab/protocols">Protocols</a></li>
| + | |
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/wetlab/safety">Safety</a></li>
| + | |
- | </ul>
| + | |
- | </li>
| + | |
- | <li>
| + | |
- | <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/Achievements">Achievements</a>
| + | |
- | <ul class="access-submenu">
| + | |
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/acheivement/medal_requirement">Medal Requirements</a></li>
| + | |
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/acheivement/deliverable">Deliverable</a></li>
| + | |
- | </ul>
| + | |
- | </li>
| + | |
- | <li class="access_logo">
| + | |
- | <a href="https://2014.igem.org/Main_Page"><img src= "https://static.igem.org/mediawiki/2014/5/55/Hkust_logo.gif"></a>
| + | |
- | </li>
| + | |
- | <li class="access_logo">
| + | |
- | <a href="http://www.ust.hk/"><img src= "https://static.igem.org/mediawiki/igem.org/6/60/Igemlogo_300px.png"></a>
| + | |
- | </li>
| + | |
- |
| + | |
- | | + | |
- | </ul>
| + | |
- | </nav>
| + | |
- | <!-- ================ do not touch any thing above this, dont even think about it =========================-->
| + | |
- |
| + | |
- |
| + | |
- |
| + | |
| <div id="content_container"> | | <div id="content_container"> |
| <div class= "banner_area"> | | <div class= "banner_area"> |
Line 100: |
Line 17: |
| <div id="description_area"> | | <div id="description_area"> |
| <h2>Pneumosensor Results</h2> | | <h2>Pneumosensor Results</h2> |
- | <p align="center" style= "font-size: 30px"> Detection Module </p> | + | <p style= "font-size: 30px; text-align:center">Detection Module</p> |
| | | |
| </div> | | </div> |
Line 112: |
Line 29: |
| </div> | | </div> |
| </td> | | </td> |
- | </tr>
| + | </tr> |
- | | + | </table> |
- | </table>
| + | |
| </div> | | </div> |
| <!-- end of one row of content , two column--> | | <!-- end of one row of content , two column--> |
Line 124: |
Line 40: |
| <td class= "content_cell"> | | <td class= "content_cell"> |
| <div class= "content_area_one_row"> | | <div class= "content_area_one_row"> |
- | <br>
| + | <p> |
| <b>Tag protein</b> | | <b>Tag protein</b> |
- | <br> | + | <br> |
- | We engineered in a FLAG protein tag in the 3’ end of ComD by including the sequence in <i>comD</i> extraction primer. | + | We engineered in a FLAG protein tag in the 3’ end of ComD by including the sequence in <i>comD</i> extraction primer. |
- | <br> | + | <br> |
- | Forward primer to extract <i>comD</i> to clone into pSB1C3: | + | <br><br> |
- | <br> | + | Forward primer to extract <i>comD</i> to clone into pSB1C3: |
- | TCTGGAGAATTCGCGGCCGCTTCTAGATGGATTTATTTGGATTTGGGACGG | + | <br><br> |
- | <br> | + | TCTGGAGAATTCGCGGCCGCTTCTAGATGGATTTATTTGGATTTGGGACGG |
- | <i>[6’cap][20’ RFC10 prefix][25’ Streptoccocus pneumoniae/NCTC7465/comD]</i> | + | <br> |
- | <br> | + | <i>[6’cap][20’ RFC10 prefix][25’ Streptoccocus pneumoniae/NCTC7465/comD]</i> |
- | <br> | + | <br> |
- | 3’ primer to extract <i>comD</i> with engineered FLAG tag gene sequence: | + | <br><br> |
- | <br> | + | 3’ primer to extract <i>comD</i> with engineered FLAG tag gene sequence: |
- | GCCGGACTGCAGCGGCCGCTACTAGTATTATTACTTGTCGTCATCGTCTTTGTAGTCTCATTCAAATTCCCTCTTAAATCTAATGAT | + | <br><br> |
- | <br> | + | GCCGGACTGCAGCGGCCGCTACTAGTATTATTACTTGTCGTCATCGTCTTTGTAGTCTCATTCAAATTCCCTCTTAAATCTAATGAT |
- | <i>[6’ cap][21’ RFC10 suffix][6’ reverse complement stop codon][25’ reverse complement FLAG protein ][30 reverse complement Streptoccocus pneumoniae/NCTC7465/comD]</i> | + | <br> |
- | <br> | + | <i>[6’ cap][21’ RFC10 suffix][6’ reverse complement stop codon][25’ reverse complement FLAG protein ][30 reverse complement Streptoccocus pneumoniae/NCTC7465/comD]</i> |
- | <br> | + | <br> |
- | <br> | + | <br> |
- | <i>comE</i> was extracted from pKHS-<i>come</i> kindly sent to us by ??. Extraction was done using the following primers: | + | <br><br> |
- | <br> | + | |
- | Forward primer to extract <i>comE</i> to clone into pSB1C3: | + | |
- | <br> | + | <i>comE</i> was extracted from pKHS-<i>come</i> kindly sent to us by Dr. Don Morrison (Université de Toulouse, UPS, Laboratoire de Microbiologie et Génétique Moléculaires). Extraction was done using the following primers: |
- | TCTGGAGAATTCGCGGCCGCTTCTAGATGAAAGTTTTAATTTTAGAAGATG | + | <br> |
- | <br> | + | <br><br> |
- | <i>[6’ cap][20’ RFC10 prefix][25’ Streptoccocus pneumoniae/NCTC7465/comE]</i> | + | Forward primer to extract <i>comE</i> to clone into pSB1C3: |
- | <br> | + | <br><br> |
- | <br> | + | TCTGGAGAATTCGCGGCCGCTTCTAGATGAAAGTTTTAATTTTAGAAGATG |
- | Reverse primer to extract comE to clone into pSB1C3: | + | <br> |
- | <br> | + | <i>[6’ cap][20’ RFC10 prefix][25’ Streptoccocus pneumoniae/NCTC7465/comE]</i> |
- | GCCGGACTGCAGCGGCCGCTACTAGTATCACTTTTGAGATTTTTTCTCTAA | + | <br> |
- | <br> | + | <br><br> |
- | <i>[6’ cap][21’ RFC10 suffix][24’reverse complement Streptoccocus pneumoniae/NCTC7465/comE]</i> | + | Reverse primer to extract <i>comE</i> to clone into pSB1C3: |
- | <br> | + | <br><br> |
- | <br> | + | GCCGGACTGCAGCGGCCGCTACTAGTATCACTTTTGAGATTTTTTCTCTAA |
- | <i>come</i> contained an illegal SpeI site, so we designed primers for site-directed mutagenesis: | + | <br> |
- | <br> | + | <i>[6’ cap][21’ RFC10 suffix][24’reverse complement Streptoccocus pneumoniae/NCTC7465/comE]</i> |
- | Mutagenesis forward primer: CGCTATTATCGTCTTTATCACTAGCCGATCAGAGTTTGCGACTCTAAC | + | <br> |
- | <br> | + | <br> |
- | <br> | + | <br><br> |
- | Mutagenesis reverse primer: GTTAGAGTCGCAAACTCTGATCGGCTAGTGATAAAGACGATAATAGCG | + | |
- | <br> | + | <i>comE</i> contained an illegal SpeI site, so we designed primers for site-directed mutagenesis: |
- | <br> | + | <br> |
- | However, site-directed mutagenesis attempts were unsuccessful, so the gene was extracted in two parts using (i) <i>come</i> forward primer & mutagenesis reverse primer; (ii) <i>come</i> reverse primer & mutagenesis forward primer. The two fragments were then combined through Gibson Assembly.</p> | + | <br><br> |
- | </div>
| + | Mutagenesis forward primer: CGCTATTATCGTCTTTATCACTAGCCGATCAGAGTTTGCGACTCTAAC |
| + | <br> |
| + | <br> |
| + | Mutagenesis reverse primer: GTTAGAGTCGCAAACTCTGATCGGCTAGTGATAAAGACGATAATAGCG |
| + | <br> |
| + | <br><br> |
| + | However, site-directed mutagenesis attempts were unsuccessful, so the gene was extracted in two parts using (i) <i>comE</i> forward primer & mutagenesis |
| + | reverse primer; (ii) <i>comE</i> reverse primer & mutagenesis forward primer. The two fragments were then combined through Gibson Assembly.</p> |
| + | </div> |
| </td> | | </td> |
| | | |
| </tr> | | </tr> |
- | </div>
| |
| </table> | | </table> |
| </div> | | </div> |
- | <!-- one row of content , two column one picture right--> | + | <!-- end of one row of content , two column--> |
| | | |
- |
| |
- |
| |
- | <hr>
| |
| </div> | | </div> |
- | <table class= "site_map_table" align= "center">
| |
- | <tr>
| |
- | <td class= 'site_map_column'><h4><a href="https://2014.igem.org/Team:Hong_Kong_HKUST">Home</a></h4>
| |
- | <ul class= 'site_list'>
| |
- | <li class='site_link'><a href="">Pneumosensor</a></li>
| |
- | <li class='site_link'><a href="">Riboregulator</a></li>
| |
- | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice">Human Practice</a></li>
| |
- | <li class='site_link'><a href="">Team</a></li>
| |
- | <li class='site_link'><a href="">WetLab</a></li>
| |
- | <li class='site_link'><a href="">Achievements</a></li>
| |
- | </ul>
| |
- |
| |
- | </td>
| |
- | <td class= 'site_map_column'><h4><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor">Pneumosensor</a></h4>
| |
- | <ul class= 'site_list'>
| |
- | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/module_one">Sensing</a></li>
| |
- | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/module_two">Expressing</a></li>
| |
- | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/parts">Parts</a></li>
| |
- | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/data">Data</a></li>
| |
- | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/characterization">Characterization</a></li>
| |
- | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/results">Results</a></li>
| |
- | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/future_work">Future Work</a></li>
| |
- | </ul>
| |
- | </td>
| |
- | <td class= 'site_map_column'><h4><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator">Riboregulator</a></h4>
| |
- | <ul class= 'site_list'>
| |
- | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/CR_TA_Feature_Page">Feature Page</a></li>
| |
- | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/RNA_devices_catalog">Catalog Page</a></li>
| |
- | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/parts">Parts</a></li>
| |
- | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/data">Data</a></li>
| |
- | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/characterization">Characterization</a></li>
| |
- | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/results">Results</a></li>
| |
- | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/future_work">Future Work</a></li>
| |
- | </ul>
| |
- | </td>
| |
- | <td class= 'site_map_column'><h4><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice">Human Practice</a></h4>
| |
- | <ul class= 'site_list'>
| |
- | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit">Start-up Kit</a>
| |
- | <ul>
| |
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit/handbook" >--Handbook</a></li>
| |
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit/report" >--Report</a></li>
| |
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit/database" >--Database</a></li>
| |
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit/interview" >--Interview</a></li>
| |
- | </ul>
| |
- | </li>
| |
- | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/outreach">Outreach</a>
| |
- | <ul>
| |
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/outreach/Workshop" >--Workshop</a></li>
| |
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/outreach/talks" >--Talk</a></li>
| |
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/outreach/isf_academy" >--ISF Academy</a></li>
| |
- | </ul>
| |
- | </li>
| |
- | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/safety_and_ethics">Safety and Ethics</a></li>
| |
- | </ul>
| |
- | </td>
| |
- | <td class= 'site_map_column'><h4><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/team">Team</a></h4>
| |
- | <ul class= 'site_list'>
| |
- | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/team/members">Members</a></li>
| |
- | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/team/advisers">Advisers</a></li>
| |
- | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/team/instructors">Instructors</a></li>
| |
- | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/team/attribution">Attributions</a></li>
| |
- | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/team/acknowledgement">Acknowledgement</a></li>
| |
- | <li class='site_link'><a href="https://igem.org/Team.cgi?year=2014">Official Team Profile</a></li>
| |
- | </ul>
| |
- | </td>
| |
- | <td class= 'site_map_column'><h4><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/wetlab">WetLab</a></h4>
| |
- | <ul class= 'site_list'>
| |
- | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/wetlab/notebook">Notebook</a></li>
| |
- | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/wetlab/protocols">Protocols</a></li>
| |
- | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/wetlab/safety">Safety</a></li>
| |
- | </ul>
| |
- | </td>
| |
- | <td class= 'site_map_column'><h4><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/Achievements">Achievement</a></h4>
| |
- | <ul class= 'site_list'>
| |
- | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/acheivement/medal_requirement">Medal Requirements</a></li>
| |
- | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/acheivement/deliverable">Deliverable</a></li>
| |
- | </ul>
| |
- | </td>
| |
- |
| |
- | </tr>
| |
- |
| |
- | </table>
| |
| </div> | | </div> |
- |
| |
- |
| |
| </body> | | </body> |
| </html> | | </html> |
| + | }} |