Team:Evry/Notebook/Sensing/PCBs/week8

From 2014.igem.org

Week 8

Sensing/PCBs

08.18.2014

Sensor construction hbpR/PhbpC

Table 1: Received primers with numbers and sequences for PCB sensing constructions

08.19.2014

Sensor construction hbpR/PhbpC
We want to amplify these two parts: BBa_E1010 and BBa_B0015. Corresponding wells were located on 2014 Distribution kit plates and resuspended with 10 µL steril water. That permits to obtain a DNA concentration around 0.2 ng/µl (according to the registry. Solutions were transferred into 1 ml eppendorf tubes and stored at -20°C.
A PCR was perform for amplification with the Q5 polymerase and dedicated primers for Golden Gate: 45 and 46 (BBa_E1010) ; 47 and 48 (BBa_B0015).

Table 2: PCR mix Preparation for Q5 amplification.

The used program was described on table 1. There was a difference for BBa_B0015, for the 72°C phase time= 15 seconds and no 30.

Table 3: IGEM Q5 PCR program thermocycling conditions

Preparation of a 1% agarose gel: 0.56 g of Top Vision agarose (Thermo Scientific) + 50 ml of TAE 1X.Microwave 30s by 30s until agarose total dissolution. Gel was cooling down until to be lukewarm, one BET drop was added. Gel was loaded with 10µl per sample previously added with 2 µl of loading dye 6X, and 5 µl for ladders. Gel running 45 minutes at 100 mV in TAE 1X buffer.

Figure 1: Agarose gel 1%. Lane 1: Purple 2-Log ladder NEB, Lane 2: BBa_E1010 purified PCR product and Lane 3: BBa_B0015 purified PCR product

We expected to obtain a band for each PCR product. We obtained one band at 700-750 bp for BBa_E1010 PCR product as expected and nothing for BBa_B0015 although we expected a band at 150-200 bp. So we decided to perform PCR clean up on BBa_E1010 PCR product with the the GeneJET purification kit (Thermo Scientific). DNA was quantified with the NanoDrop 2000, 37.4 ng/µl with A260/280 = 1.82.

08.20.2014

Sensor construction hbpR2/PhbpR1
We received sequencing reads: that match perfectly to the registry sequence.
26DJ54
AATAGGCGTTATCACGAGGCAGAANTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGATGTCCCTGG GTGACATGCGTGATTTGGCCGCCACGCGGATCGCGCTCGAGAGCGAAGCGTTACGCCAAAGCGTGCTGAATGGTGACGCTGAATGGGAGGCGCGGATCGTCAGTTC GTTTCACCGACTGTCATTGATTGAAGAGCCCACGATGCGGGATCCGGCTCGCTGGTTTAATGAGTGGGAGCCAGTCAACCGCGGTTTTCACGAAGCTCTTATCTCT GCCTGTTCGTCCGTCTGGATCCGGCGGTTCCTGTCCATCCTGTATGTGCATATGGAGCGCTACCGCCGATTGACTGCTTACTAGTAGCGGCCGCTGCAGTCCGGCA AAAAAGGGCAAGGTGTCACCACCCTGCCCTTTTTCTTTAAAACCGAAAAGATTACTTCGCGTTATGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTC GGCTGCGGCGAGCGGTATCA GCTCACTCAGGG

26DJ55
CGAGTCAGTGAGCGAGGAAGCCTGCATAACGCGAAGTAATCTTTTCGGTTTTAAAGAAAAAGGGCAGGGTGGTGACACCTTGCCCTTTTTTGCCGGACTGC AGCGGCCGCTACTAGTAAGCAGTCAATCGGCGGTAGCGCTCCATATGCACATACAGGATGGACAGGAACCGCCGGATCCAGACGGACGAACAGGCAGAGATAAGAG CTTCGTGAAAACCGCGGTTGACTGGCTCCCACTCATTAAACCAGCGAGCCGGATCCCGCATCGTGGGCTCTTCAATCAATGACAGTCGGTGAAACGAACTGACGAT CCGCGCCTCCCATTCAGCGTCACCATTCAGCACGCTTTGGCGTAACGCTTCGCTCTCGAGCGCGATCCGCGTGGCGGCCAAATCACGCATGTCACCCAGGGACATC TCTAGAAGCGGCCGCGAATTCCAGAAATCATCCTTAGCGAAAGCTAAGGATTTTTTTTATCTGAAATTCTGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCA TGATAATAATGGTTTCTTAGA

Sensor construction hbpR/PhbpC
The amplification by PCR was performed another time to amplify BBa_B0015 with overhangs. Protocol was the same as 08/19/2014. To verify PCR products, 10 µl was loaded on a 1% agarose gel with 2 µl of loading dye 6X. A really slight band was visible between 200 and 300 bp. It was to weak to obtain a picture with the camera. According to the ladder scale, the band correspond to 20-30 ng, so approximately 2-3 ng/µl of DNA for the PCR product.

08.21.2014

Sensor construction hbpR/PhbpC and hbpR2/PhbpR1
The part BBa_J23114 was located on 2014 Distribution kit plates and resuspended with 10 µL sterile water. That permits to obtain a DNA concentration around 0.2 ng/µl (according to the registry. Solution was transferred into 1 ml eppendorf tubes and stored at -20°C.
Transformations of registry parts (BBa_B0015, E1010 and J23114) and vector PSB1C3G3 were performed to obtain colonies with plasmid containing parts for future amplifications.
The transformation was performed on DH5 alpha ''E. coli'', as followed:

Remove E. coli competent tubes from -80°C and keep it on ice
Add 3 µl of template (here solubilized plasmids from the registry distribution kit) and mix gently
Incubate 10 minutes on ice
Perform an heat shock 30 seconds at 42°C
Incubate 2 minutes on ice
Add 2 ml of LB medium and incubate 60 minutes at 37°C with an agitation at 200 rpm
Plate 200 µl of PSB1C3G3, BBa_B0015 and E1010 on a chloramphenicol LB agar plate or ampiciline LB agar plate for BBa_J23114
Incubate plate overnight at 37°C

We received primers.

Table 4: Received primers with numbers and sequences for PCB sensing constructions

08.22.2014

Transformation plate observation:
- BBa_E1010: 50-60 colonies
- BBa_J23114: 150-200 colonies
- BBa_B0015: 40-50 colonies
- PSB1C3G3: > 1000 red colonies

A PCR was performed on 8 colonies for BBa_J23115 (K823012) following the protocol Table 3 and 4.
Samples are loaded on a 1% agarose gel, 10 µL of sample + 2 µl of loading dye 6X per well. Gel ran 45 minutes at 100 mV.