"
Team:SUSTC-Shenzhen/gRNA Design
From 2014.igem.org
(Difference between revisions)
| Line 8: | Line 8: | ||
{{SUSTC-Shenzhen/main-content-begin}} | {{SUSTC-Shenzhen/main-content-begin}} | ||
| - | |||
| - | |||
We used a method derived from the method described in the paper by Feng Zhang<sup>[http://www.nature.com/nbt/journal/v31/n9/abs/nbt.2647.html ZhangFgRNA]</sup>. | We used a method derived from the method described in the paper by Feng Zhang<sup>[http://www.nature.com/nbt/journal/v31/n9/abs/nbt.2647.html ZhangFgRNA]</sup>. | ||
| - | |||
| - | |||
==== Conserved Sequence Analysis ==== | ==== Conserved Sequence Analysis ==== | ||
| - | We first extracted all conserved regions from the NIH HIV-1 Reference Genome. In this step, we found around 10 alternatives for the next process. Here all screening processes are done in a per-strain basis because of the high mutability of the HIV-1 virus. | + | We first extracted all conserved regions from the NIH HIV-1 Reference Genome using BioEdit. |
| + | In this step, we found around 10 alternatives for the next process. Here all screening processes are done in a per-strain basis because of the high mutability of the HIV-1 virus. | ||
==== Strip out sequences without PAM ==== | ==== Strip out sequences without PAM ==== | ||
Revision as of 00:00, 18 October 2014
gRNA Design
Not Only a Part of Modelling
Contents |
We used a method derived from the method described in the paper by Feng Zhang[http://www.nature.com/nbt/journal/v31/n9/abs/nbt.2647.html ZhangFgRNA].
Conserved Sequence Analysis
We first extracted all conserved regions from the NIH HIV-1 Reference Genome using BioEdit. In this step, we found around 10 alternatives for the next process. Here all screening processes are done in a per-strain basis because of the high mutability of the HIV-1 virus.
Strip out sequences without PAM
| Supplementary Table 1 - Base Percentage of HIV-1 Aligned Genome 730bp-752bp | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| A % | G % | C % | T % | Empty % | Non Empty % | A(Corrected) | G(Corrected) | C(Corrected) | T(Corrected) | |
| 730 | 0 | 0 | 0 | 56.47 | 43.53 | 56.47 | 0.00% | 0.00% | 0.00% | 100.00% |
| 731 | 0 | 55.88 | 0 | 0.59 | 43.53 | 56.47 | 0.00% | 98.96% | 0.00% | 1.04% |
| 732 | 0 | 0 | 0 | 56.47 | 43.53 | 56.47 | 0.00% | 0.00% | 0.00% | 100.00% |
| 733 | 0 | 54.71 | 0 | 1.18 | 43.53 | 55.89 | 0.00% | 97.89% | 0.00% | 2.11% |
| 734 | 0 | 0 | 0 | 58.24 | 41.76 | 58.24 | 0.00% | 0.00% | 0.00% | 100.00% |
| 735 | 56.47 | 0.59 | 0.59 | 0.59 | 41.76 | 58.24 | 96.96% | 1.01% | 1.01% | 1.01% |
| 736 | 0 | 1.18 | 57.06 | 0 | 41.76 | 58.24 | 0.00% | 2.03% | 97.97% | 0.00% |
| 737 | 1.18 | 57.06 | 0 | 0.59 | 41.18 | 58.83 | 2.01% | 96.99% | 0.00% | 1.00% |
| 738 | 60 | 0 | 0 | 0 | 40 | 60 | 100.00% | 0.00% | 0.00% | 0.00% |
| 739 | 0.59 | 0 | 58.82 | 0 | 40 | 59.41 | 0.99% | 0.00% | 99.01% | 0.00% |
| 740 | 0 | 0 | 0 | 0 | 100 | 0 | ||||
| 741 | 0 | 0 | 0 | 0 | 100 | 0 | ||||
| 742 | 0.59 | 0 | 1.18 | 58.24 | 40 | 60.01 | 0.98% | 0.00% | 1.97% | 97.05% |
| 743 | 0 | 0 | 60 | 0 | 40 | 60 | 0.00% | 0.00% | 100.00% | 0.00% |
| 744 | 0 | 1.18 | 58.82 | 0 | 40 | 60 | 0.00% | 1.97% | 98.03% | 0.00% |
| 745 | 0 | 58.82 | 1.18 | 0 | 40 | 60 | 0.00% | 98.03% | 1.97% | 0.00% |
| 746 | 0.59 | 0 | 59.41 | 0 | 40 | 60 | 0.98% | 0.00% | 99.02% | 0.00% |
| 747 | 0.59 | 59.41 | 0 | 0 | 40 | 60 | 0.98% | 99.02% | 0.00% | 0.00% |
| 748 | 0.59 | 59.41 | 0 | 0 | 40 | 60 | 0.98% | 99.02% | 0.00% | 0.00% |
| 749 | 0 | 58.82 | 0.59 | 0.59 | 40 | 60 | 0.00% | 98.03% | 0.98% | 0.98% |
| 750 | 0.59 | 0.59 | 58.24 | 0.59 | 40 | 60.01 | 0.98% | 0.98% | 97.05% | 0.98% |
| 751 | 60 | 0 | 0 | 0 | 40 | 60 | 100.00% | 0.00% | 0.00% | 0.00% |
| 752 | 59.41 | 0.59 | 0 | 0 | 40 | 60 | 99.02% | 0.98% | 0.00% | 0.00% |
Select gRNA sequences with the best theoretical quality
| HIV-1 Quasi-Conservative gRNAs(Useful) | ||||
|---|---|---|---|---|
| Sequence | Rating(Zhang) | Rank(Church) | Free Energy(Approx.) | |
| GTGTGGAAAATCTCTAGCAGTGG | 71 | - | -1.4 | HIV1_REF_2010 |
| TCTAGCAGTGGCGCCCGAACAGG | 97 | - | -1.3 | |
Select gRNA sequences with the best theoretical quality
