"
Team:Paris Bettencourt/Project/Interlab Study
From 2014.igem.org
Marguerite (Talk | contribs) |
Marguerite (Talk | contribs) |
||
| Line 158: | Line 158: | ||
#fluo { | #fluo { | ||
width : 100%; | width : 100%; | ||
| - | height : | + | height : 500px; |
display : inline-block; | display : inline-block; | ||
} | } | ||
| Line 258: | Line 258: | ||
<div id=fluo> | <div id=fluo> | ||
<h6>OD600 and fluorescence measure over 20h</h6><br> | <h6>OD600 and fluorescence measure over 20h</h6><br> | ||
| - | <p></p> | + | <p><b>Samples preparation</b><br>Single colonies were inoculated in 5mL LB broth with appropriate antibiotic and grown to saturation overnight (16h) at 37°C with shaking (220 rpm). Samples were diluted 100x (50um in 5 mL LB with appropriate antibiotic) and incubated for 2h at 37°C prior to measurement.<br><br> |
| + | <b>Control</b><br>LB broth with antibiotics (chloramphenicol/kanamycin)- no fluorescence.<br> | ||
| + | NEB turbo without fluorescence - no fluorescence, no cells.<br><br> | ||
| + | <b>Measurment</b><br>Greiner 96 plates were loaded with 150um of cells in LB and 30um mineral oil Cells have been diluted prior to measurement as described above. Background absorbance and fluorescence was determined from LB control. | ||
| + | Data from the top row were excluded due to the likely evaporation and artefacts (edge effects).</p> | ||
<img src=""> | <img src=""> | ||
</div> | </div> | ||
Revision as of 14:36, 4 October 2014
The goal of the interlab study is to obtain fluorescence data for three specific genetic devices expressing GFP from iGEM teams around the world. Can you measure fluorescence somewhere in your lab? Then this is the perfect study for you! |
Even if your lab or the organisms you work with mean that you can’t measure GFP from the specific devices, we want every team to be able to participate: email measurement at igem dot org and we will work out an alternative. |
| Device 1 | Device 2 | Device 3 | Fluorescence Measure |
Device 1
BBa_I20260 (J23101-B0032-E0040-B0010-B0012) in the pSB3K3 vector.
Selection marker : Kanamycin
Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc
2012 BioBrick Kit location
BBa_I20260: Plate 2, Well 17F
We followed iGEM Distribution Kit instructions to extract DNA from the Biobrick Plate 2, Well 17F (2012) and then Heat Shock transformation of E.coli. For successful Kanymycin plates we prepared glycerol stock and labbeled it G.22.
Device 2
BBa_J23101 + BBa_E0240 (B0032-E0040-B0010-B0012), in the pSB1C3 vector.
Selection marker : Chloramphenicol
Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc
2014 Biobrick Kit locations
BBa_K823005 (BBa_J23101 in pSB1C3): Plate 1, Well 20K
BBa_E0240 (in pSB1C3): Plate 2, Well 24B
We followed iGEM Distribution Kit instructions to extract DNA from the Biobrick BBa_K823005 and BBa_E0240 and then Heat Shock transformation of E.coli. For successful Chloramphenicol plates, form single colonies we prepared liquid cultures overnight. We used 750uL of the liquid cultures for a glycerol stock . We used remaining 4,25 mL to make minipreps. We measured DNA content with the nanodrop.
Digestion analysis:
- 5 ug plasmid
- 5 ul FD Buffer
- 2.5 uL SpeI + 2.5 uL PstI (BBa_K823005) / 2.5 uL XbeI + 2.5 uL PstI (BBa_E0240)
- complete with H2O
(Final volume of 50 uL)
We made an eletrophoresis gel to check the fragments (the bands at around 876 bp for GFP and 2100 bp for the promoter + backbone) and then extract BBa_E0240 with Gel extraction kit. For the plasmid with the promoter we used a PCR purification kit. We introduced the GFP fragment to the Plasmid + backbone through ligation of the sticky ends SpeI and XbeI. Quantified DNA in two parts with nanodrop. The amount of vector: insert has been calculated with Promega calculator.
5X Ligase Reaction Buffer 4 μl
Insert: Vector Molar Ratio 1:1, 1:3, 1:5
Total DNA 0.01-0.1 μg
T4 DNA Ligase 1 uL
Autoclaved distilled water to 25uL
Incubate at 22°C for 1h
16°C overnight
We transformed the ligation product following Heat Shock transformation of E.coli. We have put a single colony into a liquid culture with the appropriate antibiotic and the next day We prepared a glycerol stock.
Device3
*BBa_J23115 was cloned using BBa_K823012 and therefore should have 2 missmatched basepairs.
BBa_J23115 + BBa_E0240 (B0032-E0040-B0010-B0012), in the pSB1C3 vector.
Selection marker : Chloramphenicol
Promoter expected sequence : tttatagctagctcagtcctaggtacaatgctagc (missmatched basepairs compared to real BBa_J23115 are underlined)
2014 Biobrick Kit locations
BBa_K823012 (BBa_J23115 in pSB1C3): Plate 1, Well 22I
BBa_E0240 (in pSB1C3): Plate 2, Well 24B
In order to prepare the third device we proceed exactly in the same way as for the Device 2, except we used BBa_K823012 instead of BBa_K823005
OD600 and fluorescence measure over 20h
Samples preparation
Single colonies were inoculated in 5mL LB broth with appropriate antibiotic and grown to saturation overnight (16h) at 37°C with shaking (220 rpm). Samples were diluted 100x (50um in 5 mL LB with appropriate antibiotic) and incubated for 2h at 37°C prior to measurement.
Control
LB broth with antibiotics (chloramphenicol/kanamycin)- no fluorescence.
NEB turbo without fluorescence - no fluorescence, no cells.
Measurment
Greiner 96 plates were loaded with 150um of cells in LB and 30um mineral oil Cells have been diluted prior to measurement as described above. Background absorbance and fluorescence was determined from LB control.
Data from the top row were excluded due to the likely evaporation and artefacts (edge effects).
