Team:Heidelberg/Toolbox Guide/Purification

From 2014.igem.org

(Difference between revisions)
m (minor corrections and clarifications)
 
(2 intermediate revisions not shown)
Line 120: Line 120:
<li>Get BBa_K1362142 (RBS + SspDnaB N*-intein RFC [<span data-bind="text: RFCNumber"></span>] assembly construct) from the  registry of standard biological parts.</li>
<li>Get BBa_K1362142 (RBS + SspDnaB N*-intein RFC [<span data-bind="text: RFCNumber"></span>] assembly construct) from the  registry of standard biological parts.</li>
-
<li><p>Get the BBa_K1362061 (N-terminal chitin binding domain with triglycine linker and His-tag) sequence from the registry of standard biological parts and order it for synthesis.</p></li>
+
<li><p>Get the BBa_K1362061 (N-terminal chitin binding domain with triglycine linker and His-tag) sequence from the registry of standard biological parts and order it for synthesis <b>with the BioBrick RFC 10 prefix and suffix added</b>.</p></li>
<li><p>Get the DNA of your protein of interest.</p></li>
<li><p>Get the DNA of your protein of interest.</p></li>
-
 
-
<li><p>Backtranslate the amino acid sequence of your protein of interest into a nucleotide sequence.</p></li>
 
-
 
<li>
<li>
<p>Design and order primers for your protein of interest</p>
<p>Design and order primers for your protein of interest</p>
-
<p>In 5'-3' direction, the forward primer should have the following sequence:
+
<p>In 5'&ndash;3' direction, the forward primer should have the following sequence:
-
NNNNNNGGTCTCCCAACAGCATTCGCAGC + binding part</p>
+
GTTTCTGGTCTCCCAACAGCATTCGCAGC + binding part</p>
-
<p>In 5'-3' direction, the reverse primer should have the following sequence:
+
<p>In 5'&ndash;3' direction, the reverse primer should have the following sequence:
-
NNNNNNGGTCTCTATTA  + binding part</p>
+
GTTTCTGGTCTCTATTA + binding part</p>
</li>
</li>
<!-- MISSING: Verweis oder Hinweise zu Primerdesign allgemein. -->
<!-- MISSING: Verweis oder Hinweise zu Primerdesign allgemein. -->
Line 138: Line 135:
<!-- MISSING: Verweis oder Hinweise zu PCR bzw Twostep-PCR. -->
<!-- MISSING: Verweis oder Hinweise zu PCR bzw Twostep-PCR. -->
-
<li><p>Use Golden Gate assembly to insert your protein of interest into BBa_K1362141 (RBS + SspDnaB C-intein RFC [???] assembly construct). This is the affinity tag POI construct of the purification system.</p>
+
<li><p>Use Golden Gate assembly to insert your protein of interest into BBa_K1362141 (RBS + SspDnaB C-intein RFC [<span data-bind="text: RFCNumber"></span>] assembly construct). This is the affinity tag-POI construct of the purification system.</p>
<p data-bind="if: data.hasBSAI">Since there is a BsaI site in your protein, you have to religate after the Golden Gate reaction.</p></li>
<p data-bind="if: data.hasBSAI">Since there is a BsaI site in your protein, you have to religate after the Golden Gate reaction.</p></li>
<!--MISSING: golden gate assembly-->
<!--MISSING: golden gate assembly-->
-
<li><p>Use Golden Gate assembly to insert BBa_K1362061 (N-terminal chitin binding domain with triglycine linker and His-tag) into BBa_K1362142 (RBS + SspDnaB N*-intein RFC [<span data-bind="text: RFCNumber"></span>] assembly construct). This is the affinity ligand construct of the purification system.
+
<li><p>Use Golden Gate assembly to insert BBa_K1362061 (N-terminal chitin binding domain with triglycine linker and His-tag) into BBa_K1362142 (RBS + SspDnaB N*-intein RFC [<span data-bind="text: RFCNumber"></span>] assembly construct). This is the affinity ligand construct of the purification system.
</p></li>
</p></li>
<!--MISSING: golden gate assembly-->
<!--MISSING: golden gate assembly-->
Line 192: Line 189:
</div>
</div>
</div>
</div>
 +
<script type="text/javascript">
<script type="text/javascript">
$(document).ready(function(){
$(document).ready(function(){

Latest revision as of 02:12, 4 January 2015

use the intein
TOOLBOX to

First of all, check the DNA sequence of your proteins for EcoRI, XbaI, SpeI, PstI and BsaI sites. If there are E/X/S/P sites, you might have problems to change your backbone or add a promotor. If there is a BsaI site, the cloning will be more difficult.

Protocol

  • Get BBa_K1362141 (RBS + SspDnaB C-intein RFC [] assembly construct) from the registry of standard biological parts.
  • Get BBa_K1362142 (RBS + SspDnaB N*-intein RFC [] assembly construct) from the registry of standard biological parts.
  • Get the BBa_K1362061 (N-terminal chitin binding domain with triglycine linker and His-tag) sequence from the registry of standard biological parts and order it for synthesis with the BioBrick RFC 10 prefix and suffix added.

  • Get the DNA of your protein of interest.

  • Design and order primers for your protein of interest

    In 5'–3' direction, the forward primer should have the following sequence: GTTTCTGGTCTCCCAACAGCATTCGCAGC + binding part

    In 5'–3' direction, the reverse primer should have the following sequence: GTTTCTGGTCTCTATTA + binding part

  • Use PCR to create your insert and purify it.

  • Use Golden Gate assembly to insert your protein of interest into BBa_K1362141 (RBS + SspDnaB C-intein RFC [] assembly construct). This is the affinity tag-POI construct of the purification system.

    Since there is a BsaI site in your protein, you have to religate after the Golden Gate reaction.

  • Use Golden Gate assembly to insert BBa_K1362061 (N-terminal chitin binding domain with triglycine linker and His-tag) into BBa_K1362142 (RBS + SspDnaB N*-intein RFC [] assembly construct). This is the affinity ligand construct of the purification system.

  • Clone both constructs into expression vectors.

  • Express the two constructs in different bacterial strains.

  • Purify the proteins.

  • Prepare following buffers:

    • wash buffer: 20 mM Tris-HCl, 1 M NaCl, 5 mM EDTA, pH 8.0
    • cleavage buffer: 0.3 M l-arginine, 5 mM EDTA, 50 mM phosphate buffer, pH 6.5
    • elution buffer: 0.6 M NaCl, 50 mM Tris-HCl, pH 9.0
  • Purify the affinity ligand part using Ni-Sepharose and load it onto a chitin column.

  • Wash the column with wash buffer. After preparation you can store it in PBS with 0.02% NaN3.

  • Apply the supernatant including the affinity tag-POI part onto the affinity column.

  • Wash with binding buffer.

  • Apply cleavage buffer for 3 bed volumes.

  • Incubate the column at room temperature for 20 h.

  • Wash with cleavage buffer.

  • Recover the protein in the pass-through fraction.

  • The affinity tag is now released from the protein of interest and instead covalently bound to the affinity matrix.

    You can remove the affinity tag from the column by washing with elution buffer.

Reference for steps 13-22

  • Wei Lu et al.: Split intein facilitated tag affinity purification for recombinant proteins with controllable tag removal by inducible auto-cleavage. J. Chromatogr. A. 1218 (2011) 2553-2560. DOI: 10.1016/j.chroma.2011.02.053