Team:Paris Bettencourt/Project/TMAU

From 2014.igem.org

(Difference between revisions)

Revision as of 10:28, 17 October 2014

@iGEM_Paris

Something Fishy

BACKGROUND

Trimethylamine (TMA) is produced by bacteria in the human gut and degraded in the liver by a flavin-containing monooxygenase 3 (FMO3). Trimethylaminuria, or Fish Odor Syndrome, is a rare genetic disease caused by inactivating mutations in the FMO3 gene. Consequently, TMA accumulates in sweat, saliva, and urine, causing a strong fish odor. Patients suffer no other serious symptoms, except a difficult social condition.

AIMS

TMA is also processed by the trimethylamine monooxygenase (Tmm) of Ruegeria pomeroyi, an enzyme similar to human FMO3. If we express this enzyme in human skin bacteria, it should remove TMM from sweat and reduce its unpleasant odor. TMM-expressing bacteria in a cream or spray might be used by trimethylaminuria patients as a stable, inexpensive treatment.

RESULTS

Cloned TMM gene into E.coli using pSB1C3 and pSEVA315 vectors, creating a new Biobrick: BBa_K1403015.
Characterized and quantified the activity of TMM by a colorimetric assay.
Confirmed the degradation of trimethylamine by gas chromatography - mass spectrometry (GC/MS).

Aims and Achievement

Ruegeria pomeroyi, a bacteria member of the Rhodobacteraceae genus, produces an enzyme called trimethylamine monooxygenase thanks to the tmm (trimethylamine mono-oxygenase) gene. As FMO3, this enzyme degrades trimethylamine into trimethylamine-N-oxide but is adapted to a bacterial expression. The project aims at cloning tmm into E.coli and then into Corynebacterium striatum, one of the most common bacteria of the skin. The new strain would be integrated to the skin microbiome and would suppress the fish odor.

Introduction

Trimethylamine (TMA) is produced in the intestine by Desulfovibrio desulfuricans by fermentation of choline. In healthy patients, the fmo gene allows the degradation of TMA in the liver into a non-volatile compound, TMA oxide. But a mutation in the fmo3 sequence is most of the time the cause of trimethylaminuria: TMA is not degraded and is then excreted in sweat, saliva and urine leading to a strong fish odor. The patients are otherwise healthy but the disease affect their social relationships and can lead to depression. There is currently no cure for this metabolic disorder. Some treatments, often focused on restricting diet, tend to lower the symptoms.

Results

After cloning tmm into a Biobrick vector (pSB1C3), the construct was successfully expressed in E. coli. TMM activity was found in tmm-expresing E. coli but not in empty vector-expressing E. coli. TMM does not only degrade trimethylamine into trimethylamine-N-oxide, but also converts indole into indigo. To measure the activity of TMM, the growth medium was supplemented with tryptophan, a precursor of indole, which is the substrate of TMM. After 14h of culture, cells were pelleted, washed twice with sterile water, resuspended in DMSO and sonicated. TMM activity was determined by measuring the absorbance spectrum of bacterial extractions. Peaks at 620 nm were found in tmm-expressing E.coli cultures supplemented with tryptophan, which was identified as indigo according to absorbance spectrum analysis. Gas chromatography-mass spectrometry (GC/MS) confirmed the activity of TMM by showing a decrease of the concentration of TMA by tmm-expressing E.coli.

Methods

tmm was cloned in a standard biobrick vector (pSB1C3) using XbaI and HindIII restriction sites. The set of primers used for PCR (Forward: CTTCTAGAGCTGACAGCTAGCTCAGTCC Reverse: TACTAGTATCAGTGGTGATGGTGATGATG) allowed us to use BLABLABLA as restriction enzymes. The vector and the PCR product were digested for 2h at 37°C and ligated 1h at 22°C, and overnight at 4°C using a 1:3 vector:insert ratio. Chemically competent NEB turbo strain of E.coli was transformed using Heat Shock transformation protocol. TMM does not only degrade trimethylamine into trimethylamine-N-oxide, but also converts indole into indigo. Thus, TMM-expressing E.coli are blue. Analytical digestion was performed using Thermo Scientific GeneJET Plasmid Miniprep Kit after overnight culture in LB/medium, digestion with BLA and BLABLA and electrophoresis using 0.5X TBE and 1% agarose gels. The presence of bands at 1.5kb (the length of tmm) confirmed the presence of tmm in the new strain. Another strain of E.coli was also created using pSEVA315 plasmid which is a shuttle vector that can be cloned in other genders of bacteria. Measurement of TMM activity was performed on TMM-expressing E.coli using the isolation of indigo protocol inspired of Choi H.S., Kim J.K et al. (2003).

References

- ref1
- ref2

Centre for Research and Interdisciplinarity (CRI)
Faculty of Medicine Cochin Port-Royal, South wing, 2nd floor
Paris Descartes University
24, rue du Faubourg Saint Jacques
75014 Paris, France

+33 1 44 41 25 22/25

paris-bettencourt-igem@googlegroups.com

@@ Line 211: / Line 211: @@
 </p>
 		<h6>Aims and Achievement</h6><br>
-		<p class=text1><i>Ruegeria pomeroyi</i>, a bacteria member of the Rhodobacteraceae genus, produces an enzyme called trimethylamine monooxygenase thanks to the <i>tmm</i>(trimethylamine mono-oxygenase) gene. As FMO3, this enzyme degrades trimethylamine into trimethylamine-N-oxide but is adapted to a bacterial expression. The project aims at cloning <i>tmm</i> into <i>E.coli</i> and then into <i>Corynebacterium striatum</i>, one of the most common bacteria of the skin. The new strain would be integrated to the skin microbiome and would suppress the fish odor.</p>
+		<p class=text1><i>Ruegeria pomeroyi</i>, a bacteria member of the Rhodobacteraceae genus, produces an enzyme called trimethylamine monooxygenase thanks to the <i>tmm</i> (trimethylamine mono-oxygenase) gene. As FMO3, this enzyme degrades trimethylamine into trimethylamine-N-oxide but is adapted to a bacterial expression. The project aims at cloning <i>tmm</i> into <i>E.coli</i> and then into <i>Corynebacterium striatum</i>, one of the most common bacteria of the skin. The new strain would be integrated to the skin microbiome and would suppress the fish odor.</p>
   <br> <br> <br> <br> <br> <br> <br> <br> <br> <br> <br> <br> <br> <br> <br> <br> <br> <br>
@@ Line 219: / Line 219: @@
 		<p class=text2><img src='https://static.igem.org/mediawiki/2014/b/b3/Sch%C3%A9ma_fish_odor_syndrom.jpg' ></p>
 		<h6>Introduction</h6><br>
-		<p class=text1><a href="#ref1">Trimethylamine (TMA)</a> is produced in the intestine by <i>Desulfovibrio desulfuricans</i> by fermentation of choline. In healthy patients, the <i>fmo</i> gene allows the degradation of TMA in the liver into a non-volatile compound, TMA oxide. But a mutation in the <i>fmo3</i> sequence is most of the time the cause of TMAU: TMA is not degraded and is then excreted in sweat, saliva and urine leading to a strong fish odor. The patients are otherwise healthy but the disease affect their social relationships and can lead to depression. There is currently no cure for this metabolic disorder.  Some treatments, often focused on restricting diet, tend to lower the symptoms. </p>
+		<p class=text1><a href="#ref1">Trimethylamine (TMA)</a> is produced in the intestine by <i>Desulfovibrio desulfuricans</i> by fermentation of choline. In healthy patients, the <i>fmo</i> gene allows the degradation of TMA in the liver into a non-volatile compound, TMA oxide. But a mutation in the <i>fmo3</i> sequence is most of the time the cause of trimethylaminuria: TMA is not degraded and is then excreted in sweat, saliva and urine leading to a strong fish odor. The patients are otherwise healthy but the disease affect their social relationships and can lead to depression. There is currently no cure for this metabolic disorder.  Some treatments, often focused on restricting diet, tend to lower the symptoms. </p>
 	</div>
 	<div id=part3 class=project>
@@ Line 225: / Line 225: @@
 		<p class=text2></p>
 		<h6>Results</h6><br>
-		<p class=text1>After cloning <i>tmm</i>  into a Biobrick vector (pSB1C3), the construct was successfully expressed in <i>E. coli</i>. TMM activity was found in <i>E. coli</i> pSB1C3-TMM (<i>tmm+</i>) but not in <i>E. coli</i> pSB1C3 (<i>tmm-</i>). TMM does not only degrade trimethylamine into trimethylamine-N-oxide, but also converts indole into indigo. To measure the activity of TMM, the growth medium was supplemented with tryptophan, a precursor of indole, which is the substrate of TMM. After 14h of culture, cells were pelleted, washed twice with sterile water, resuspended in DMSO and sonicated. TMM activity was determined by measuring the absorbance spectrum of bacterial extractions. Peaks at 620 nm were found in <i>tmm+</i> cultures supplemented with tryptophan, which was identified as indigo according to absorbance spectrum analysis.</p>
+		<p class=text1>After cloning <i>tmm</i>  into a Biobrick vector (pSB1C3), the construct was successfully expressed in <i>E. coli</i>. TMM activity was found in <i>tmm</i>-expresing <i>E. coli</i> but not in empty vector-expressing <i>E. coli</i>. TMM does not only degrade trimethylamine into trimethylamine-N-oxide, but also converts indole into indigo. To measure the activity of TMM, the growth medium was supplemented with tryptophan, a precursor of indole, which is the substrate of TMM. After 14h of culture, cells were pelleted, washed twice with sterile water, resuspended in DMSO and sonicated. TMM activity was determined by measuring the absorbance spectrum of bacterial extractions. Peaks at 620 nm were found in <i>tmm</i>-expressing <i>E.coli</i> cultures supplemented with tryptophan, which was identified as indigo according to absorbance spectrum analysis. Gas chromatography-mass spectrometry (GC/MS) confirmed the activity of TMM by showing a decrease of the concentration of TMA by <i>tmm</i>-expressing <i>E.coli</i>.</p>
 	</div>