"
Team:Paris Bettencourt/Project/Interlab Study
From 2014.igem.org
| Line 167: | Line 167: | ||
<h6><u>OD600 and fluorescence measure over 20h</u></h6> | <h6><u>OD600 and fluorescence measure over 20h</u></h6> | ||
| - | <p>Samples preparation: Single colonies were inoculated in 5mL LB broth with appropriate antibiotic and grown to saturation overnight (16h) at 37°C with shaking (220 rpm). | + | <p><u>Samples preparation:</u> Single colonies were inoculated in 5mL LB broth with appropriate antibiotic and grown to saturation overnight (16h) at 37°C with shaking (220 rpm). |
</br> | </br> | ||
Samples were diluted 100x (50um in 5 mL LB with appropriate antibiotic) and incubated for 2h at 37°C prior to measurement. | Samples were diluted 100x (50um in 5 mL LB with appropriate antibiotic) and incubated for 2h at 37°C prior to measurement. | ||
Revision as of 14:02, 3 September 2014
iGEM 2014 Measurement Interlab Study
iGEM Paris Bettencourt team participates in the Interlab study
"The goal of the interlab study is to obtain fluorescence data for three specific genetic devices expressing GFP from iGEM teams around the world. Can you measure fluorescence somewhere in your lab? Then this is the perfect study for you! Even if your lab or the organisms you work with mean that you can’t measure GFP from the specific devices, we want every team to be able to participate: email measurement at igem dot org and we will work out an alternative."
First device
Geneious version 7.0.6 created by Biomatters. Available from http://www.geneious.com/
BBa_I20260 (J23101-B0032-E0040-B0010-B0012) in the pSB3K3 vector.
Selection marker : Kanamycin
Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc
- 2012 BioBrick Kit location
- BBa_I20260: Plate 2, Well 17F
Second device
Geneious version 7.0.6 created by Biomatters. Available from http://www.geneious.com/
BBa_J23101 + BBa_E0240 (B0032-E0040-B0010-B0012), in the pSB1C3 vector.
Selection marker : Chloramphenicol
Promoter expected sequence : tttacagctagctcagtcctaggtattatgctagc
- 2014 Biobrick Kit locations
- BBa_K823005 (BBa_J23101 in pSB1C3): Plate 1, Well 20K
- BBa_E0240 (in pSB1C3): Plate 2, Well 24B
Third device*
Geneious version 7.0.6 created by Biomatters. Available from http://www.geneious.com/
*BBa_J23115 was cloned using BBa_K823012 and therefore should have 2 missmatched basepairs.
BBa_J23115 + BBa_E0240 (B0032-E0040-B0010-B0012), in the pSB1C3 vector.
Selection marker : Chloramphenicol
Promoter expected sequence : tttatagctagctcagtcctaggtacaatgctagc (missmatched basepairs compared to real BBa_J23115 are underlined)
- 2014 Biobrick Kit locations
- BBa_K823012 (BBa_J23115 in pSB1C3): Plate 1, Well 22I
- BBa_E0240 (in pSB1C3): Plate 2, Well 24B
Results
Sequencing
First device
Promoter sequence : tttacagctagctcagtcctaggtattatgctagc
Second device
Promoter sequence :
Third device
Promoter sequence :
OD600 and fluorescence measure over 20h
Samples preparation: Single colonies were inoculated in 5mL LB broth with appropriate antibiotic and grown to saturation overnight (16h) at 37°C with shaking (220 rpm). Samples were diluted 100x (50um in 5 mL LB with appropriate antibiotic) and incubated for 2h at 37°C prior to measurement.
- Control:
- LB broth with antibiotics (chloramphenicol/kanamycin)- no fluorescence
- NEB turbo without fluorescence - no fluorescence, no cells
