http://2014.igem.org/wiki/index.php?title=Team:Duke/Project&feed=atom&action=historyTeam:Duke/Project - Revision history2024-03-28T11:43:06ZRevision history for this page on the wikiMediaWiki 1.16.5http://2014.igem.org/wiki/index.php?title=Team:Duke/Project&diff=392388&oldid=prevDelta.ghoshal at 02:54, 18 October 20142014-10-18T02:54:37Z<p></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 02:54, 18 October 2014</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 34:</td>
<td colspan="2" class="diff-lineno">Line 34:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><li> We are designing a 2-reporter construct, where induction of one reporter triggers repression of the other. We built mathematical models of multiple repressors of a single gene and showed that it can result in ultrasensitivity. We have devised a construction scheme to implement this strategy, and realization of these constructs in underway.</li></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><li> We are designing a 2-reporter construct, where induction of one reporter triggers repression of the other. We built mathematical models of multiple repressors of a single gene and showed that it can result in ultrasensitivity. We have devised a construction scheme to implement this strategy, and realization of these constructs in underway.</li></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><li> Molecular titration: It has been shown by (Buchler and Louis 2008) and others that competitive binding can result in ultrasensitivity in a phenomenon known as molecular titration. We tested two approaches to take advantage of this phenomenon: to titrate tracrRNA with complementary RNA, or to titrate out the fully assembled pdCas9:tracrRNA:crRNA complex with decoy binding sites. We created mathematical models demonstrating the feasibility of both approaches and tested them in vivo. Our work shows that Anti-tracrRNA is does not derepress dCas9-mediated repression of transcription, but decoy binding sites are working as expected and shows promise for a means of modulating transcriptional control.</div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><li> Molecular titration: It has been shown by (Buchler and Louis 2008) and others that competitive binding can result in ultrasensitivity in a phenomenon known as molecular titration<ins class="diffchange diffchange-inline">. Recall that the dCas9 protein requires two pieces of RNA to work properly: the sequence-specific crRNA that leads the protein to the intended target, as well as the tracrRNA that helps stabilize the structure and crRNA. We propose that by adding in RNA that is complementary to the tracrRNA, which we dub "anti-tracrRNA", we can repress the repression carried out by dCas9. It is also possible to implement this using RNAs that titrate sequence specific crRNAs or the dCas9 protein. Titrating out any of the necessary components for repression would inactivate the system and cause the expression of previously-repressed GFP, causing a quantifiable increase in GFP expression</ins>. We tested two approaches to take advantage of this phenomenon: to titrate tracrRNA with complementary RNA, or to titrate out the fully assembled pdCas9:tracrRNA:crRNA complex with decoy binding sites. We created mathematical models demonstrating the feasibility of both approaches and tested them in vivo. Our work shows that Anti-tracrRNA is does not derepress dCas9-mediated repression of transcription, but decoy binding sites are working as expected and shows promise for a means of modulating transcriptional control.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </li></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </li></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div></ol></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div></ol></div></td></tr>
<tr><td colspan="2" class="diff-lineno">Line 44:</td>
<td colspan="2" class="diff-lineno">Line 44:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div>The second approach uses the concept of "molecular titration"<del class="diffchange diffchange-inline">. Recall that the dCas9 protein requires two pieces of RNA to work properly: the sequence-specific crRNA that leads the protein to the intended target, as well as the tracrRNA that helps stabilize the structure and crRNA. We propose that by adding in RNA that is complementary to the tracrRNA, which we dub "anti-tracrRNA", we can repress the repression carried out by dCas9</del>. This experiment involves having GFP repressed by dCas9 using complementary crRNAs, similar to Approach 1 above. Then, if the cell also has a plasmid containing the sequence for the anti-tracrRNA, this RNA will bind to the tracrRNA and "sequester" it, or make it unavailable to bind with dCas9. This would inactivate the system and cause the expression of previously-repressed GFP, causing a quantifiable increase in GFP expression. The ultrasensitivity aspect of this approach involves the concentration of anti-tracrRNA, especially in comparison to the concentration of tracrRNA. This is another reason why this approach is known as "molecular titration", because it's conceptually very similar to the technique used in chemistry.</div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div>The second approach uses the concept of "molecular titration". This experiment involves having GFP repressed by dCas9 using complementary crRNAs, similar to Approach 1 above. Then, if the cell also has a plasmid containing the sequence for the anti-tracrRNA, this RNA will bind to the tracrRNA and "sequester" it, or make it unavailable to bind with dCas9. This would inactivate the system and cause the expression of previously-repressed GFP, causing a quantifiable increase in GFP expression. The ultrasensitivity aspect of this approach involves the concentration of anti-tracrRNA, especially in comparison to the concentration of tracrRNA. This is another reason why this approach is known as "molecular titration", because it's conceptually very similar to the technique used in chemistry.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div></p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div></p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
</table>Delta.ghoshalhttp://2014.igem.org/wiki/index.php?title=Team:Duke/Project&diff=392152&oldid=prevDelta.ghoshal at 02:52, 18 October 20142014-10-18T02:52:48Z<p></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 02:52, 18 October 2014</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 40:</td>
<td colspan="2" class="diff-lineno">Line 40:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div></p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div></p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><p> The first approach is dependent on the number of crRNA repressor sequences there are; multiple sequences will have a multiplicative repressive effect, known as cooperative repression, which is ultrasensitive. The construct consists of a Lac promoter (Bba_R0011) driving the expression of GFP and a ribosome binding site (Bba_I13500). After this comes a scaffold that will hold crRNA repeats that repress mCherry. Following this Lac-driven part of the construct is a terminator sequence to separate the two halves of the construct. After this, the Tet promoter follows and drives the expression of mCherry, a red fluorescent protein, and a scaffold containing crRNA sequences that repress GFP. Hopefully, the fluorescence of this construct will depend on which inducer is added, IPTG or aTc, and the cells will have a multifold, ultrasensitive response that correlates to the number of crRNA sequences contained in the sample. Also, the cell will only be able to produce one of the fluorescent proteins at one time, which has implications for an inducible, bistable toggle switch within the genome.</div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline"><!--</ins><p> The first approach is dependent on the number of crRNA repressor sequences there are; multiple sequences will have a multiplicative repressive effect, known as cooperative repression, which is ultrasensitive. The construct consists of a Lac promoter (Bba_R0011) driving the expression of GFP and a ribosome binding site (Bba_I13500). After this comes a scaffold that will hold crRNA repeats that repress mCherry. Following this Lac-driven part of the construct is a terminator sequence to separate the two halves of the construct. After this, the Tet promoter follows and drives the expression of mCherry, a red fluorescent protein, and a scaffold containing crRNA sequences that repress GFP. Hopefully, the fluorescence of this construct will depend on which inducer is added, IPTG or aTc, and the cells will have a multifold, ultrasensitive response that correlates to the number of crRNA sequences contained in the sample. Also, the cell will only be able to produce one of the fluorescent proteins at one time, which has implications for an inducible, bistable toggle switch within the genome.</div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div></p></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div></p<ins class="diffchange diffchange-inline">>--</ins>></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p></div></td></tr>
</table>Delta.ghoshalhttp://2014.igem.org/wiki/index.php?title=Team:Duke/Project&diff=392029&oldid=prevDelta.ghoshal at 02:51, 18 October 20142014-10-18T02:51:54Z<p></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 02:51, 18 October 2014</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 32:</td>
<td colspan="2" class="diff-lineno">Line 32:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><ol></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><ol></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><li> We are designing a 2-reporter construct, where induction of one reporter triggers repression of the other. We <del class="diffchange diffchange-inline">hypothesize </del>that <del class="diffchange diffchange-inline">the number </del>of <del class="diffchange diffchange-inline">crRNA repeats </del>in <del class="diffchange diffchange-inline">the construct will trigger the ultrasensitive response</del>. </li></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><li> We are designing a 2-reporter construct, where induction of one reporter triggers repression of the other. We <ins class="diffchange diffchange-inline">built mathematical models of multiple repressors of a single gene and showed </ins>that <ins class="diffchange diffchange-inline">it can result in ultrasensitivity. We have devised a construction scheme to implement this strategy, and realization </ins>of <ins class="diffchange diffchange-inline">these constructs </ins>in <ins class="diffchange diffchange-inline">underway</ins>.</li></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><li> Molecular titration: <del class="diffchange diffchange-inline">By adding anti-tracrRNA, we would like </del>to <del class="diffchange diffchange-inline">see if the complementary strand </del>to <del class="diffchange diffchange-inline">the </del>tracrRNA <del class="diffchange diffchange-inline">sequence will sequester tracrRNA and inactivate the Cas9 repression system</del>, <del class="diffchange diffchange-inline">thereby causing a previously repressed reporter </del>to <del class="diffchange diffchange-inline">become active again</del>. <del class="diffchange diffchange-inline">Ultrasensitivity in this case would depend on </del>the <del class="diffchange diffchange-inline">concentration </del>of <del class="diffchange diffchange-inline">anti</del>-tracrRNA.</li></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><li> Molecular titration: <ins class="diffchange diffchange-inline">It has been shown by (Buchler and Louis 2008) and others that competitive binding can result in ultrasensitivity in a phenomenon known as molecular titration. We tested two approaches </ins>to <ins class="diffchange diffchange-inline">take advantage of this phenomenon: </ins>to <ins class="diffchange diffchange-inline">titrate </ins>tracrRNA <ins class="diffchange diffchange-inline">with complementary RNA</ins>, <ins class="diffchange diffchange-inline">or </ins>to <ins class="diffchange diffchange-inline">titrate out the fully assembled pdCas9:tracrRNA:crRNA complex with decoy binding sites</ins>. <ins class="diffchange diffchange-inline">We created mathematical models demonstrating </ins>the <ins class="diffchange diffchange-inline">feasibility </ins>of <ins class="diffchange diffchange-inline">both approaches and tested them in vivo. Our work shows that Anti</ins>-tracrRNA <ins class="diffchange diffchange-inline">is does not derepress dCas9-mediated repression of transcription, but decoy binding sites are working as expected and shows promise for a means of modulating transcriptional control</ins>.</div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline"> </ins></li></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div></ol></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div></ol></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
</table>Delta.ghoshalhttp://2014.igem.org/wiki/index.php?title=Team:Duke/Project&diff=391080&oldid=prevDelta.ghoshal at 02:44, 18 October 20142014-10-18T02:44:44Z<p></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 02:44, 18 October 2014</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 58:</td>
<td colspan="2" class="diff-lineno">Line 58:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><img src="https://static.igem.org/mediawiki/2014/3/3b/DukeResults1.png" /></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><img src="https://static.igem.org/mediawiki/2014/3/3b/DukeResults1.png" /></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>Contrary to expectations, it appears that cells with GFP-targeting crRNA have slightly lower fluorescence when antitracr is induced than when uninduced. We also performed a time course to observe how fluorescence changes over time in these strains.</p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>Contrary to expectations, it appears that cells with GFP-targeting crRNA have slightly lower fluorescence when antitracr is induced than when uninduced. We also performed a time course to observe how fluorescence changes over time in these strains.</p></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><!--https://2014.igem.org/File:<del class="diffchange diffchange-inline">Results2</del>.png--></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><!--https://2014.igem.org/File:<ins class="diffchange diffchange-inline">DukeResults2</ins>.png--></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><img src="https://static.igem.org/mediawiki/2014/<del class="diffchange diffchange-inline">9</del>/<del class="diffchange diffchange-inline">99</del>/<del class="diffchange diffchange-inline">Results2</del>.png" /></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><img src="https://static.igem.org/mediawiki/2014/<ins class="diffchange diffchange-inline">a</ins>/<ins class="diffchange diffchange-inline">a9</ins>/<ins class="diffchange diffchange-inline">DukeResults2</ins>.png" /></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>Again, we see lower fluorescence in aTc in the GFP-repressing strains. The increase in fluorescence over time is likely from the bacteria recovering from stationary phase from the overnight pre-growth before diluting in to +/- aTc. One possible explanation for this is that aTc is inhibiting protein production generally, as Tetracycline antibiotics work by blocking translation elongation, but this seems unlikely because that effect should also be apparent in the nonrepressive pdCas9 strains. Another possibility is that pTet is not expressing strongly when induced, or that aTc is changing expression of tracrRNA from pdCas9. The latter is a possibility because there is a Tet promoter on pdCas9 upstream and on the opposite strand as tracrRNA. </p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>Again, we see lower fluorescence in aTc in the GFP-repressing strains. The increase in fluorescence over time is likely from the bacteria recovering from stationary phase from the overnight pre-growth before diluting in to +/- aTc. One possible explanation for this is that aTc is inhibiting protein production generally, as Tetracycline antibiotics work by blocking translation elongation, but this seems unlikely because that effect should also be apparent in the nonrepressive pdCas9 strains. Another possibility is that pTet is not expressing strongly when induced, or that aTc is changing expression of tracrRNA from pdCas9. The latter is a possibility because there is a Tet promoter on pdCas9 upstream and on the opposite strand as tracrRNA. </p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><!--https://2014.igem.org/File:Pdcas9marrafinipic.png--></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><!--https://2014.igem.org/File:Pdcas9marrafinipic.png--></div></td></tr>
</table>Delta.ghoshalhttp://2014.igem.org/wiki/index.php?title=Team:Duke/Project&diff=384849&oldid=prevDelta.ghoshal at 01:50, 18 October 20142014-10-18T01:50:44Z<p></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 01:50, 18 October 2014</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 1:</td>
<td colspan="2" class="diff-lineno">Line 1:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>{{Template:Team:Duke/CSS}}</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>{{Template:Team:Duke/CSS}}</div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div>{{Template:Team:<del class="diffchange diffchange-inline">DukeTMenu</del>/CSS}}</div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div>{{Template:Team:<ins class="diffchange diffchange-inline">DukeMenu</ins>/CSS}}</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>{{Template:Team:DukeProject/CSS}}</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>{{Template:Team:DukeProject/CSS}}</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
</table>Delta.ghoshalhttp://2014.igem.org/wiki/index.php?title=Team:Duke/Project&diff=384689&oldid=prevDelta.ghoshal at 01:49, 18 October 20142014-10-18T01:49:20Z<p></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 01:49, 18 October 2014</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 1:</td>
<td colspan="2" class="diff-lineno">Line 1:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>{{Template:Team:Duke/CSS}}</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>{{Template:Team:Duke/CSS}}</div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div>{{Template:Team:<del class="diffchange diffchange-inline">DukeMenu</del>/CSS}}</div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div>{{Template:Team:<ins class="diffchange diffchange-inline">DukeTMenu</ins>/CSS}}</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>{{Template:Team:DukeProject/CSS}}</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>{{Template:Team:DukeProject/CSS}}</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
</table>Delta.ghoshalhttp://2014.igem.org/wiki/index.php?title=Team:Duke/Project&diff=382745&oldid=prevDelta.ghoshal at 01:32, 18 October 20142014-10-18T01:32:04Z<p></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 01:32, 18 October 2014</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 95:</td>
<td colspan="2" class="diff-lineno">Line 95:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><!--https://2014.igem.org/File:Results3.png--></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><!--https://2014.igem.org/File:Results3.png--></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><img src="https://static.igem.org/mediawiki/2014/8/8f/Results3.png" /></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><img src="https://static.igem.org/mediawiki/2014/8/8f/Results3.png" /></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div> </div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline"><p>The 1x, 6x, and 12x GFP1 decoy binding site arrays were submitted as parts BBa_K1545000, BBa_K1545001, and BBa_K1545002. </p></ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div></div></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div></div></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
</table>Delta.ghoshalhttp://2014.igem.org/wiki/index.php?title=Team:Duke/Project&diff=382706&oldid=prevDelta.ghoshal at 01:31, 18 October 20142014-10-18T01:31:38Z<p></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 01:31, 18 October 2014</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 91:</td>
<td colspan="2" class="diff-lineno">Line 91:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div></p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div></p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>From this we conclude that either antitracrRNA is not present at sufficient levels to titrate away tracrRNA, or that it is not interacting with tracrRNA at all.</p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>From this we conclude that either antitracrRNA is not present at sufficient levels to titrate away tracrRNA, or that it is not interacting with tracrRNA at all.</p></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"><h3>Molecular titration with decoy binding sites</h3></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"><p>We built arrays of decoy binding sites designed to bind to dCas9 proteins guided by GFP1 (targeting sequence CCATCTAATTCAACAAGAATTGG from BBa_K608012). Using a PCR-based approach we successfully assembled 1x and 6x tandem GFP1 decoys, and doubled the 6x construct by taking advantage of SpeI/XbaI compatibility. When placed on pSB1A2 and introduced in to bacteria with pSB4K5-K608012 and pdCas9-GFP1 or blank pdCas9 lacking the GFP1 crRNA targeting sequence, we see a decrease in fluorescence in proportion to the number of binding sites on the plasmid.</p></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"><!--https://2014.igem.org/File:Results3.png--></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"><img src="https://static.igem.org/mediawiki/2014/8/8f/Results3.png" /></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div></div></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div></div></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
</table>Delta.ghoshalhttp://2014.igem.org/wiki/index.php?title=Team:Duke/Project&diff=382519&oldid=prevDelta.ghoshal at 01:29, 18 October 20142014-10-18T01:29:53Z<p></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 01:29, 18 October 2014</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 85:</td>
<td colspan="2" class="diff-lineno">Line 85:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><!--https://2014.igem.org/File:Rtpcrresults.png--></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><!--https://2014.igem.org/File:Rtpcrresults.png--></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><img src="https://static.igem.org/mediawiki/2014/6/6a/Rtpcrresults.png" /></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><img src="https://static.igem.org/mediawiki/2014/6/6a/Rtpcrresults.png" /></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"><p>We can see that there is some DNA contamination in our preps from the weak band in the no-RT lanes, but the +RT bands with +/- aTc indicate that indeed pTet is producing antitracrRNA and that tracrRNA originating from pdCas9 is not changing with the addition of aTc. </p></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"><p></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;">We also tested whether we could achieve derepression by titrating tracrRNA by ordering DNA oligonucleotides perfectly complementary to tracr (antitracrDNA) or with the same base composition but randomized. A similar approach was used successfully to alter regulation by microRNAs in <a href="http://www.ncbi.nlm.nih.gov/pubmed/21857679">Mukherji et al</a>. When heat shocked with antitracrDNA oligos or scrambled controls, competent cells with pSB4K5-K608012 and pdCas9-GFP1 showed no difference in fluorescence between the strains [data not shown]. </ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></p></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"><p>From this we conclude that either antitracrRNA is not present at sufficient levels to titrate away tracrRNA, or that it is not interacting with tracrRNA at all.</p></ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div></div></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div></div></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
</table>Delta.ghoshalhttp://2014.igem.org/wiki/index.php?title=Team:Duke/Project&diff=382318&oldid=prevDelta.ghoshal at 01:28, 18 October 20142014-10-18T01:28:15Z<p></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 01:28, 18 October 2014</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 82:</td>
<td colspan="2" class="diff-lineno">Line 82:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><li>Z1+pdCas9 +aTc, Z1+pdCas9 -aTc - RT</li></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><li>Z1+pdCas9 +aTc, Z1+pdCas9 -aTc - RT</li></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div></ul></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div></ul></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"><p>Rough quantification by densitometry yields the following plot: </p></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"><!--https://2014.igem.org/File:Rtpcrresults.png--></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"><img src="https://static.igem.org/mediawiki/2014/6/6a/Rtpcrresults.png" /></ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div></div></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div></div></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
</table>Delta.ghoshal