http://2014.igem.org/wiki/index.php?title=Special:Contributions/VeraA&feed=atom&limit=50&target=VeraA&year=&month=2014.igem.org - User contributions [en]2024-03-29T00:40:19ZFrom 2014.igem.orgMediaWiki 1.16.5http://2014.igem.org/Team:Aachen/Notebook/Wetlab/SeptemberTeam:Aachen/Notebook/Wetlab/September2014-10-17T23:35:15Z<p>VeraA: /* References */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= September =<br />
== 1st ==<br />
* 5&nbsp;ml cultures of K1319003 and K1319004<br />
* plasmid prep<br />
<center><br />
{| class="wikitable"<br />
|-<br />
! Plasmid !! DNA [ng/µl] <br />
|-<br />
| J23101.K516032 pSB1K3|| 23.5<br />
|-<br />
| J23115.K516032 pSB1K3|| 20.5<br />
|-<br />
| J04450 pSB1A3|| 57.5<br />
|-<br />
| J04450 pSB1K1|| 63.5<br />
|} </center><br />
* over night cultures of K131026 in DH5α and NEB<br />
<br />
== 2nd ==<br />
* made chips with K131026 in DH5α and NEB. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_02_09_2014_K131026_dh5a_serie.png|title=Sensor Chips with K131026 in DH5α in LB taken with the second version of our own device|subtitle=Sensor chips with K131026 in DH5α in LB medium with 1,5% agarose, right chip induced. A) befor induction with 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 0.5&nbsp;h after induction C) 1&nbsp;h after induction D) 1.5&nbsp;h after induction E) 2.5&nbsp;h after induction F) 3&nbsp;h after induction|width=900px}}<br />
</center><br />
* gel purification of vector backbones <br />
* sent to sequencing:<br />
** K1318003<br />
** K1319004<br />
** J23101.K516032 <br />
** J23115.K516032<br />
<br />
== 3rd ==<br />
* prepared 50&nbsp;mL LB+antibiotic overnight-cultures of pSBX-vectors that were sent in by team Heidelberg.<br />
<br />
== 4th ==<br />
* In the morning, at 10:15, we inoculated the precultures for the interlab study experiment.<br />
* prepared cryo stocks of the pSBX-carrying ''E.&nbsp;coli'' from the overnight cultures. He also purified each pSBX-vector, eluting with 15+30&nbsp;µL water, and resulting in the following DNA concentrations:<br />
<br />
<center><br />
{| class="wikitable"<br />
! vector !! concentration [ng/µL]<br />
|-<br />
| pSBX1A3 || 111<br />
|-<br />
| pSBX4A5 || 14.1<br />
|-<br />
| pSBX1C3 || 31<br />
|-<br />
| pSB4C5 || 98.5<br />
|-<br />
| pSBX1K3 || 18<br />
|-<br />
| pSBX4K5 || 30<br />
|-<br />
| pSBX1T3 || 39<br />
|-<br />
| constitutive expression plasmid || 73<br />
|}<br />
</center><br />
<br />
* PCRs for Gibson assembly of K1319003 into pET17. Duplicates of 25&nbsp;µL reaction volume (12.5&nbsp;µL Q5 2x Master Mix, 1.25&nbsp;µL per primer, 2&nbsp;µL template)<br />
<center><br />
{| class="wikitable"<br />
! PCR tube # !! components<br />
|-<br />
| 1 and 2 || pET17 + pET17_Gal3_Gib_F + pET17_Gal3_Gib_R<br />
|-<br />
| 3 and 4 || K1319003 + K1319003_Gib_F + K1319003_Gib_R<br />
|-<br />
|}<br />
</center><br />
<br />
The PCR conditions:<br />
<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
|-<br />
| denature || 98 || 30", 98°C for 10", 55°C for 30", 72°C for 2'15"<br />
|-<br />
| denature || 98 || 10"<br />
|-<br />
| anneal || 50 (insert) 55 (backbone) || 30"<br />
|-<br />
| elongate || 72 || 0'30" (insert) 2'15" (backbone)<br />
|-<br />
| elongate || 72 || 2"<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
<br />
* Finally, we did the Gibson assembly and a heat shock transformation into NEB10β cells.<br />
<br />
* At 10:15, we inoculated the primary cultures of the interlab study experiment and began with regular fluorescence measurements.<br />
<br />
== 5th ==<br />
* made master plates of yesterday's transformed cells.<br />
* As described in the article by Elling [1], Gal3 binds on the LPS of ''Pseudomonas aeruginosa''. To demonstrate this behavior several experiments were conducted. The experiments included the binding of Gal3 to ''Saccharomyces cerevisiae'', ''E.coli'', ''Pseudomonas putida'' and ''Pseudomonas aeruginosa''. The precultures were washed two times in PBS, resuspended in 10 and 50 ng/ml of YFP-Gal3 and then incubated for 1 h at room temperature. Afterwards, all samples were examined in the fluorescence microscope. As a positive control NEB10ß cells with E0030 were used. Unfortunatly, a fluorescence was not visually detectable, with exception of the positive control.<br />
<br />
== 6th ==<br />
* made precultures of 3 clones from each prepared master palte and inoculated precultures for OD/F measurements as well as chip production on the 7th.<br />
<br />
== 7th ==<br />
* made cryos stocks of the precultures<br />
* made chips with K131026 in DH5α and NEB and B0015 in NEB. Images were taken every 30 min with our own device <br />
<center><br />
{{Team:Aachen/Figure|Aachen_07_09_2014_B0015_neb_serie.png|title=Sensor Chips with B0015 in NEB (negativ control) in TB taken with the second version of our own device|subtitle=Sensor chips with B0015 in NEB in TB medium with 1,5% agar, right chip induced. A) befor induction with 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 0&nbsp;h after induction C) 0.5&nbsp;h after induction D) 1&nbsp;h after induction E) 2&nbsp;h after induction F) 2.5&nbsp;h after induction|width=900px}}<br />
</center><br />
* purification of the following plasmids:<br />
<br />
<center><br />
{| class="wikitable"<br />
! plasmid !! strain !! resistance !! vector !! # of clone picked !! concentration [ng/µl]<br />
|-<br />
|K1319000 in I20260 || NEB10ß || K || pSB3K3 || 1 ||<br />
|-<br />
|K1319000 in I20260 || NEB10ß || K || pSB3K3 || 3 ||<br />
|-<br />
|K1319000 in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319001 in I20260 || NEB10ß || K || pSB3K3 || 1 ||<br />
|-<br />
|K1319001 in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319001 in I20260 || NEB10ß || K || pSB3K3 || 6 ||<br />
|-<br />
|K1319002 in I20260 || NEB10ß || K || pSB3K3 || 1 ||<br />
|-<br />
|K1319002 in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319002 in I20260 || NEB10ß || K || pSB3K3 || 6 ||<br />
|-<br />
|K1319001_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 4 ||<br />
|-<br />
|K1319001_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319001_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 6 ||<br />
|-<br />
|K1319002_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 3 ||<br />
|-<br />
|K1319002_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 4 ||<br />
|-<br />
|K1319002_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|His-SNAP-YFP-K1319003 || NEB10ß || A || pET17 || 3 ||<br />
|-<br />
|His-SNAP-YFP-K1319003 || NEB10ß || A || pET17 || 4 ||<br />
|-<br />
|His-SNAP-YFP-K1319003 || NEB10ß || A || pET17 || 6 ||<br />
|}<br />
</center><br />
<br />
Elution was performed twice with 15&nbsp;µL of nuclease free water each time.<br />
<br />
== 9th ==<br />
* made chips with K131026 in DH5α and NEB and without cells. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_09_09_2014_K131026_neb_agarose_serie.png|title=Sensor Chips with K131026 in DH5α in LB|subtitle=Sensor chips with K131026 in DH5α in LB medium with 1,5% agarose, right chip induced. A) befor induction with 1&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 1&nbsp;h after induction C) 1.5&nbsp;h after induction D) 2&nbsp;h after induction E) 2.5&nbsp;h after induction F) 3&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
== 10th ==<br />
* SDS page of REACh constructs after Gibson <br />
* plasmid prep of Gal3 YFP<br />
** #3: 20&nbsp;ng/µl<br />
** #4: 21.5&nbsp;ng/µl<br />
** #6: 15.9&nbsp;ng/µl<br />
<br />
== 15th ==<br />
analyze the sequencing data from the clones of GFP_Reach 1, GFP_Reach 2 and K1319008. <br />
<br />
GFP_Reach 2 clone #3 and #5 were fine, including the Leu to Ile mutation.<br />
GFP_Reach 1 clone #4 and #5 were fine and did not contain the Leu to Ile mutation. Clone #6 was fine but contained the Leu to Ile mutation from the Reach 1 quick change mutations. <br />
<br />
For future experiments, we will use the GFP_Reach 1 clone #4 and the GFP_Reach 2 clone #4.<br />
<br />
Transformation of GFP_Reach 1 clone #3 and GFP_Reach 2 clones #3 and #5 were performed together with the TEV protease to create two plasmid construct. <br />
<br />
The GFP_Reach 1 and GFP_Reach 2 constructs were also restricted and ligated into the pSB1C3 vector from the pSB3K3 vector.<br />
* over night cultures of K131026 in DH5α and NEB<br />
<br />
== 16th ==<br />
<br />
* made master plates of the transformation from the day before. <br />
* Also PCRs were made from pSBXA3, I20260 and K131900 for a Gibson assembly. The PCRs were checked with a gel electrophoresis.<br />
* made chips with K131026 in DH5α and NEB. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_16_09_2014_K131026_neb_serie.png|title=Sensor Chips with K131026 in NEB in LB|subtitle=Sensor chips with K131026 in NEB in LB medium with 1,5% agarose, right chip induced. A) 0.5&nbsp;h after induction with 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 1&nbsp;h after induction C) 1.5&nbsp;h after induction D) 2&nbsp;h after induction E) 2.5&nbsp;h after induction F) 3&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
== 17th ==<br />
<br />
* prepped and autoclaved 33 500&nbsp;mL shake flasks.<br />
<br />
== 18th ==<br />
* SDS page of REACh constructs with TEV and IPTG<br />
* over night cultures of K131026, B0015, K1319013, K1319014, K1319013 + K1319008 and K1319014 + K1319008 all in BL21<br />
* tested ''Pseudomonas fluoresence'' if they are suitable for a growth experiment that is planned for our collaboration with the NEAnderLab next week. Therefore, she filled 2 500&nbsp;mL flasks with 30&nbsp;mL LB Pseudomonas-F medium, and inoculated each one with 1&nbsp;mL culture medium of the overnight preculture. Flasks were inoculated at 30°C at 250&nbsp;rpm. However, after 5 hours no exponential growth could be shown (s. plot below). Thus, it was decided to use a ''E. coli'' K12 derivate strain in TB medium instead, and 30&nbsp;mL of TB medium in a 500&nbsp;mL flask were inoculated with ''E. coli'' DH5α cells and incubated at 37°C at 300 rpm over night. According to the [https://www.dsmz.de/catalogues/catalogue-microorganisms/groups-of-organisms-and-their-applications/strains-for-schools-and-universities.html DSMZ] ''E . coli'' K12 strain derivates, such as DH5α, are adequate for the kind of school experiment we are planning with the NEAnderLab.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-09-19_NEAnderLab_Test_Growth_Curves_of_Pf_in_LB_iNB.png|title=Growth Curves|subtitle=Unfortunately, ''P. fluorescens'' did not show a nice exponential growth curve over the observed 5 hours.|width=1000px}}<br />
</center><br />
<br />
== 19th ==<br />
* made flask cultures of K1319013, K1319013 + K1319008, K1319013 + K1319008 + iPTG, K1319014, K1319014 + K1319008, K1319014 + K1319008 + iPTG, B0015 (negative control) and I20260 (positive control). iPTG was added at an OD of ~0.5. Inoculation was done via precultures in 500 ml shake flasks (50 ml filling volume). Media was always LB. Cultivation was done at 37°C and 300&nbsp;rpm. The starting OD was aimed to be 0.1. Inoculation occured directly from the precultures. Samples were taken every hour and checked for OD and fluorescence using a spectrophotometer and plate reader, respectively.<br />
<br />
* did plasmid preparation from the cultures of the day before (K1319013, K1319013 + K1319008, K1319013 + K1319008 + iPTG, K1319014, K1319014 + K1319008, K1319014 + K1319008 + iPTG, B0015 and I20260). The plasmid were then be cut with EcoRI and PstI, and the results were be put on an agarose gel in order to perform a restriction test. Also plasmids of K1319013 and K1319014 will be cut with EcoRi and SpeI. K1319008 will be cut with XbaI and PstI. These will then be ligated together and then ligated into a pSB1A3 vector via the 3A assembly (vector cut with EcoRI and PstI). These constructs will be transformed into BL21 (and NEB as a backup). The created construts will be known as K1319018 (K1319013.K1319008) and K1319019 (K1319014.K1319008).<br />
<br />
* made precultures of the master plates from the day before (K1319008, K1319013, K1319015 and pSBX1A3 with Gal3).<br />
<br />
* also inoculated 4 cultures for the further testing of the OD/F Device (the F part). The cultures are 2 shake flasks of I20260 and 2 shake flasks of B0015. <br />
<br />
* Furthermore, did a growth experiment with DH5α for the NEAnderLab school experiment. 3 500&nbsp;mL shake flasks were filled with 50&nbsp;mL TB medium, and inoculated to an OD of 1.5 with the overnight preculture. Samples were taken every 30 minutes and tested for OD using our own device as well as the spectrophotometer. The resulting growth curve is shown below. we concluded that the growth was fast enough for these growth conditions to be used for the school experiment on the 24th. <br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-09-19_NEAnderLab_Test_Growth_Curves_in_TB_iNB.png|title=Growth Curves|subtitle=Growth under these conditions was sufficient for the school experiment to be carried in 5 hours. And our device did a good job measuring, too!|width=1000px}}<br />
</center><br />
<br />
* made chips with K1319013 + K1319008, K1319014 + K1319008, K1319013, K1319014, B0015 and K131026. Images were taken every 30 minutes with our own device.<br />
<br />
* tested our OD/F Device with a dilution test. Samples were checked with the spectrophotometer (OD), our OD/F Device (fluorescence) and platereader (fluorescence).<br />
<br />
* made two SDS gels. <br />
<br />
* inoculated a culture of K1319008, B0015 as well as I20260 to check whether the results from our construct are from a wrongly done Gibson assembly with a still functioning superfolded GFP (the TEV protease was inserted in a backbone that formely contained superfolded GFP.)<br />
<br />
== 20th ==<br />
* SDS page of REACh constructs with TEV protease and induced by IPTG<br />
<br />
== 22nd ==<br />
<br />
* we poured several Pseudomonas-F agar plates with 0, 150 and 300&nbsp;µg/L for the NEAnderLab school experiment. She also autoclaved 12 500&nbsp;mL shake flasks, partly to be used for the school collaboration on Wednesday.<br />
<br />
== 26th ==<br />
* We did a check PCR on several cryo cultures. All samples with G00100_Alternative+K1319004_check_R combinations resulted in a strong band at ~2300&nbsp;bp that we cannot explain. All G00100_Alternative+K1319004_check_R combinations resulted in a strong band at 900&nbsp;bp that we cannot explain either. We concluded that the annealing temperatures were wrong and favored unspecific products. Therefore, we decided to do a gradient PCR to find out the optimal annealing temperatures for our new primers.<br />
<br />
* Gradient PCR to test new primer:<br />
did gradient PCR with these new primers:<br />
<br />
<center><br />
{| class="wikitable"<br />
! name !! sequence<br />
|-<br />
| G00100_Alternative || GTGCCACCTGACGTCTAAGAAACCATTATTATC<br />
|-<br />
| G00101_Alternative || ATTACCGCCTTTGAGTGAGCTGATACCGCTCG<br />
|-<br />
| K1319004_check_R || ACGGAATTTCAGTTTCTGCGGGAACGGCGG<br />
|-<br />
| I746909_check_R || ATCTTTAGACAGAACGCTTTGCGTGCTCAG<br />
|}<br />
</center><br />
<br />
Three PCRs with different primer combinations were run. In all of them the templates were K1319004&nbsp;in pSB1C3, K1319008&nbsp;in&nbsp;pSB1C3 and I746909&nbsp;in&nbsp;pSB1C3.<br />
<br />
The first gradient PCR tested the G00100_Alternative + G00101_Alternative combination:<br />
<br />
<center><br />
{| class="wikitable"<br />
! primer_F !! primer_R !! template !! expected length !! best annealing temperature<br />
|-<br />
| G00100_Alternative || G00101_Alternative || K1319004&nbsp;in pSB1C3 || 1057 || ???<br />
|-<br />
| G00100_Alternative || G00101_Alternative || K1319008&nbsp;in&nbsp;pSB1C3 || 1245 || ???<br />
|-<br />
| G00100_Alternative || G00101_Alternative || I746909&nbsp;in&nbsp;pSB1C3 || 1221 || ???<br />
|-<br />
| G00100_Alternative || G00101_Alternative || water || --- || ???<br />
|}<br />
{{Team:Aachen/Figure|Aachen_14-09-26_gradientPCR_1.png|title=Gradient PCR 1|subtitle=the primers were G00100_Alternative and G00101_Alternative and they worked well at all temperatures from 55-65°C.|width=800px}}<br />
</center><br />
<br />
The second gradient PCR tested the G00100_Alternative + I746916_check_R combination:<br />
<center><br />
{| class="wikitable"<br />
! primer_F !! primer_R !! template !! expected length !! best annealing temperature<br />
|-<br />
| G00100_Alternative || I746916_check_R || K1319004&nbsp;in pSB1C3 || none || ???<br />
|-<br />
| G00100_Alternative || I746916_check_R || K1319008&nbsp;in&nbsp;pSB1C3 || none || ???<br />
|-<br />
| G00100_Alternative || I746916_check_R || I746909&nbsp;in&nbsp;pSB1C3 || 820 || ???<br />
|-<br />
| G00100_Alternative || I746916_check_R || water || --- || ???<br />
|}<br />
{{Team:Aachen/Figure|Aachen_14-09-26_gradientPCR_2.png|title=Gradient PCR 2|subtitle=the primers were G00100_Alternative and I746916_check_R and they worked well at all temperatures from 55-65°C. Apparently the K1319008 template contained I746916.|width=800px}}<br />
</center><br />
<br />
The third gradient PCR tested the G00100_Alternative + K1319004_check_R combination:<br />
<center><br />
{| class="wikitable"<br />
! primer_F !! primer_R !! template !! expected length !! best annealing temperature<br />
|-<br />
| G00100_Alternative || K1319004_check_R || K1319004&nbsp;in pSB1C3 || 541 || ???<br />
|-<br />
| G00100_Alternative || K1319004_check_R || K1319008&nbsp;in&nbsp;pSB1C3 || 502 || ???<br />
|-<br />
| G00100_Alternative || K1319004_check_R || I746909&nbsp;in&nbsp;pSB1C3 || none || ???<br />
|-<br />
| G00100_Alternative || K1319004_check_R || water || --- || ???<br />
|}<br />
{{Team:Aachen/Figure|Aachen_14-09-26_gradientPCR_3.png|title=Gradient PCR 3|subtitle=The primers were G00100_Alternative and K1319004_check_R and they worked well at all temperatures from 60-68°C. To our disappointment, the K1319008 template did not contain K1319004. It is unclear why the 5 bands of K1319008 and I746916 look different.|width=800px}}<br />
</center><br />
<br />
The results of these three PCRs are:<br />
# KAPA2G Fast ReadyMix worked well<br />
# all three primers work well at >65°C annealing temperature<br />
# K1319008 template contained I746916 instead of the intended K1319004 ORF<br />
<br />
It was concluded that a similar check PCR with 65°C annealing temperature will be done on all plasmids and cryos of K1319008.<br />
<br />
== 27th ==<br />
* First we transformed K1319001, K1319002, K1319003 and K1319004 (all in pSB1C3) into NEB10β cells. He tested the PCR machine for semi-automated heat-shocking by splitting the 50&nbsp;µL cells with the plasmid into 2x 25&nbsp;µL. All 100&nbsp;µL were plated for all construct/machine combinations.<br />
<br />
* transformed several constructs into chemically competent BL21(DE3) cells.<br />
<br />
* we did colony-PCR on all plasmids, cryos and colonies that should contain the K1319004 sequence.<br />
<br />
* we also made check a PCR on galectin-constructs:<br />
<center><br />
{| class="wikitable"<br />
! label !! primer_F !! primer_R !! expected length !! result<br />
|-<br />
| Gal3 in pSBX1A3 #1 || G00100_Alternative || K1319003_R || 1684 || ???<br />
|-<br />
| Gal3 in pSBX1A3 #2 || G00100_Alternative || K1319003_R || 1684 || ???<br />
|-<br />
| Gal3 in pSBX1A3 #3 || G00100_Alternative || K1319003_R || 1684 || ???<br />
|-<br />
| Gal3 YFP #3 || pETGal3_seq_F || K1319003_R || 867 || ???<br />
|-<br />
| Gal3 YFP #3 || pETGal3_seq_F || K1319003_R || 867 || ???<br />
|-<br />
| Gal3 YFP pet17 AmpR || pETGal3_seq_F || K1319003_R || 867 or none || ???<br />
|-<br />
| pET17 Gal3 #1 || pETGal3_seq_F || K1319003_R || none || ???<br />
|-<br />
| K1319003 in pSB1C3 || G00100_Alternative || K1319003_R || 930 || ???<br />
|}<br />
</center><br />
<br />
== 28th ==<br />
* made a restriction of BioBrick K1319020 and vector pSB1C3 with restriction enzymes EcoRI and PstI. Then we ligated the restricted parts and made a transformation using ''E. coli'' NEB 10ß cells.<br />
<br />
== 29th ==<br />
<br />
* made cryo cultures and plasmid preparation of K1319010, K1319011, K1319012, K1319021 and K1319042. We determined the contentration of plasmids and made did a restriction digest of K1319010, K1319011, K1319012, pSB1C3, K1319021, K1319013 and K1319014, followed by a ligation in K1319010.pSB1C3, K1319011.pSB1C3, K1319012.pSB1C3, K1319021.K1319013.pSB1A3 and K1319021.K1319013.pSB1A3. All constructs were transformed into ''E. coli'' NEB 10ß.<br />
<br />
* prepared 3 500&nbsp;mL flasks with 30&nbsp;mL LB medium which were inoculated with a ''Pseudomonas putida'' strain. The cells were cultured over night at 28°C and ~300&nbsp;rpm. The cultures are supposed to be used to test our OD device.<br />
<br />
== 30th ==<br />
<br />
* Sequencing samples were sent in for K1319020 clone #2, 3 & 5 (in pSB1C3), K1319017 clone #1 (in pSB1C3), K1319010 clone #2 (in pSB3K3), K1319011 clone #1 (in pSB3K3), K1319012 clone #2 (in pSB3K3), K1319013 clone #1 (in pSB1C3), K1319014 clone #1 (in pSB1C3), K1319001 (in pSB1C3) and K1319002 (in pSB1C3). <br />
<br />
* A plasmid prep of K1319013 and K1319014 was run.<br />
<br />
* A Gibson assembly with the K1319015 from the I20260 backbone and the K1319000 insert, forming K3139015, was conducted. The product was subsequently transformed into NEB10β cells. <br />
<br />
* The pSB1C3 plasmid backbones were amplified via PCR and purified.<br />
<br />
* Colony-PCRs of K1319008 and K1319012 master plates were made to confirm the colony's identity. Subsequently, pre-cultures were inoculated. <br />
<br />
* A transformation of K1319010 and K1319010 in pSB1C3 was conducted.<br />
<br />
* Another plasmid prep of K1319010 clone #2, K1319011 clone #1, K1319012 clone #2 (all in pSB3K3), K1319013 clone #4, K1319014 #3, K139020 #2, 3, 5 (all in pSB1C3) was run.<br />
<br />
* The OD device was tested with a dilution series of a ''Pseudomonas putida'' culture.<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
== References ==<br />
Kupper C.E, Böcker S, Liu H, et al. Fluorescent SNAP-tag galectin fusion proteins as novel tools in glycobiology. Curr Pharm Des. 2013;19(30):5457-67. Available at: http://www.ncbi.nlm.nih.gov/pubmed/23431989.<br />
<br />
<br />
<br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/SeptemberTeam:Aachen/Notebook/Wetlab/September2014-10-17T23:33:07Z<p>VeraA: /* References */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= September =<br />
== 1st ==<br />
* 5&nbsp;ml cultures of K1319003 and K1319004<br />
* plasmid prep<br />
<center><br />
{| class="wikitable"<br />
|-<br />
! Plasmid !! DNA [ng/µl] <br />
|-<br />
| J23101.K516032 pSB1K3|| 23.5<br />
|-<br />
| J23115.K516032 pSB1K3|| 20.5<br />
|-<br />
| J04450 pSB1A3|| 57.5<br />
|-<br />
| J04450 pSB1K1|| 63.5<br />
|} </center><br />
* over night cultures of K131026 in DH5α and NEB<br />
<br />
== 2nd ==<br />
* made chips with K131026 in DH5α and NEB. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_02_09_2014_K131026_dh5a_serie.png|title=Sensor Chips with K131026 in DH5α in LB taken with the second version of our own device|subtitle=Sensor chips with K131026 in DH5α in LB medium with 1,5% agarose, right chip induced. A) befor induction with 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 0.5&nbsp;h after induction C) 1&nbsp;h after induction D) 1.5&nbsp;h after induction E) 2.5&nbsp;h after induction F) 3&nbsp;h after induction|width=900px}}<br />
</center><br />
* gel purification of vector backbones <br />
* sent to sequencing:<br />
** K1318003<br />
** K1319004<br />
** J23101.K516032 <br />
** J23115.K516032<br />
<br />
== 3rd ==<br />
* prepared 50&nbsp;mL LB+antibiotic overnight-cultures of pSBX-vectors that were sent in by team Heidelberg.<br />
<br />
== 4th ==<br />
* In the morning, at 10:15, we inoculated the precultures for the interlab study experiment.<br />
* prepared cryo stocks of the pSBX-carrying ''E.&nbsp;coli'' from the overnight cultures. He also purified each pSBX-vector, eluting with 15+30&nbsp;µL water, and resulting in the following DNA concentrations:<br />
<br />
<center><br />
{| class="wikitable"<br />
! vector !! concentration [ng/µL]<br />
|-<br />
| pSBX1A3 || 111<br />
|-<br />
| pSBX4A5 || 14.1<br />
|-<br />
| pSBX1C3 || 31<br />
|-<br />
| pSB4C5 || 98.5<br />
|-<br />
| pSBX1K3 || 18<br />
|-<br />
| pSBX4K5 || 30<br />
|-<br />
| pSBX1T3 || 39<br />
|-<br />
| constitutive expression plasmid || 73<br />
|}<br />
</center><br />
<br />
* PCRs for Gibson assembly of K1319003 into pET17. Duplicates of 25&nbsp;µL reaction volume (12.5&nbsp;µL Q5 2x Master Mix, 1.25&nbsp;µL per primer, 2&nbsp;µL template)<br />
<center><br />
{| class="wikitable"<br />
! PCR tube # !! components<br />
|-<br />
| 1 and 2 || pET17 + pET17_Gal3_Gib_F + pET17_Gal3_Gib_R<br />
|-<br />
| 3 and 4 || K1319003 + K1319003_Gib_F + K1319003_Gib_R<br />
|-<br />
|}<br />
</center><br />
<br />
The PCR conditions:<br />
<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
|-<br />
| denature || 98 || 30", 98°C for 10", 55°C for 30", 72°C for 2'15"<br />
|-<br />
| denature || 98 || 10"<br />
|-<br />
| anneal || 50 (insert) 55 (backbone) || 30"<br />
|-<br />
| elongate || 72 || 0'30" (insert) 2'15" (backbone)<br />
|-<br />
| elongate || 72 || 2"<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
<br />
* Finally, we did the Gibson assembly and a heat shock transformation into NEB10β cells.<br />
<br />
* At 10:15, we inoculated the primary cultures of the interlab study experiment and began with regular fluorescence measurements.<br />
<br />
== 5th ==<br />
* made master plates of yesterday's transformed cells.<br />
* As described in the article by Elling [1], Gal3 binds on the LPS of ''Pseudomonas aeruginosa''. To demonstrate this behavior several experiments were conducted. The experiments included the binding of Gal3 to ''Saccharomyces cerevisiae'', ''E.coli'', ''Pseudomonas putida'' and ''Pseudomonas aeruginosa''. The precultures were washed two times in PBS, resuspended in 10 and 50 ng/ml of YFP-Gal3 and then incubated for 1 h at room temperature. Afterwards, all samples were examined in the fluorescence microscope. As a positive control NEB10ß cells with E0030 were used. Unfortunatly, a fluorescence was not visually detectable, with exception of the positive control.<br />
<br />
== 6th ==<br />
* made precultures of 3 clones from each prepared master palte and inoculated precultures for OD/F measurements as well as chip production on the 7th.<br />
<br />
== 7th ==<br />
* made cryos stocks of the precultures<br />
* made chips with K131026 in DH5α and NEB and B0015 in NEB. Images were taken every 30 min with our own device <br />
<center><br />
{{Team:Aachen/Figure|Aachen_07_09_2014_B0015_neb_serie.png|title=Sensor Chips with B0015 in NEB (negativ control) in TB taken with the second version of our own device|subtitle=Sensor chips with B0015 in NEB in TB medium with 1,5% agar, right chip induced. A) befor induction with 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 0&nbsp;h after induction C) 0.5&nbsp;h after induction D) 1&nbsp;h after induction E) 2&nbsp;h after induction F) 2.5&nbsp;h after induction|width=900px}}<br />
</center><br />
* purification of the following plasmids:<br />
<br />
<center><br />
{| class="wikitable"<br />
! plasmid !! strain !! resistance !! vector !! # of clone picked !! concentration [ng/µl]<br />
|-<br />
|K1319000 in I20260 || NEB10ß || K || pSB3K3 || 1 ||<br />
|-<br />
|K1319000 in I20260 || NEB10ß || K || pSB3K3 || 3 ||<br />
|-<br />
|K1319000 in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319001 in I20260 || NEB10ß || K || pSB3K3 || 1 ||<br />
|-<br />
|K1319001 in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319001 in I20260 || NEB10ß || K || pSB3K3 || 6 ||<br />
|-<br />
|K1319002 in I20260 || NEB10ß || K || pSB3K3 || 1 ||<br />
|-<br />
|K1319002 in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319002 in I20260 || NEB10ß || K || pSB3K3 || 6 ||<br />
|-<br />
|K1319001_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 4 ||<br />
|-<br />
|K1319001_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319001_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 6 ||<br />
|-<br />
|K1319002_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 3 ||<br />
|-<br />
|K1319002_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 4 ||<br />
|-<br />
|K1319002_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|His-SNAP-YFP-K1319003 || NEB10ß || A || pET17 || 3 ||<br />
|-<br />
|His-SNAP-YFP-K1319003 || NEB10ß || A || pET17 || 4 ||<br />
|-<br />
|His-SNAP-YFP-K1319003 || NEB10ß || A || pET17 || 6 ||<br />
|}<br />
</center><br />
<br />
Elution was performed twice with 15&nbsp;µL of nuclease free water each time.<br />
<br />
== 9th ==<br />
* made chips with K131026 in DH5α and NEB and without cells. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_09_09_2014_K131026_neb_agarose_serie.png|title=Sensor Chips with K131026 in DH5α in LB|subtitle=Sensor chips with K131026 in DH5α in LB medium with 1,5% agarose, right chip induced. A) befor induction with 1&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 1&nbsp;h after induction C) 1.5&nbsp;h after induction D) 2&nbsp;h after induction E) 2.5&nbsp;h after induction F) 3&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
== 10th ==<br />
* SDS page of REACh constructs after Gibson <br />
* plasmid prep of Gal3 YFP<br />
** #3: 20&nbsp;ng/µl<br />
** #4: 21.5&nbsp;ng/µl<br />
** #6: 15.9&nbsp;ng/µl<br />
<br />
== 15th ==<br />
analyze the sequencing data from the clones of GFP_Reach 1, GFP_Reach 2 and K1319008. <br />
<br />
GFP_Reach 2 clone #3 and #5 were fine, including the Leu to Ile mutation.<br />
GFP_Reach 1 clone #4 and #5 were fine and did not contain the Leu to Ile mutation. Clone #6 was fine but contained the Leu to Ile mutation from the Reach 1 quick change mutations. <br />
<br />
For future experiments, we will use the GFP_Reach 1 clone #4 and the GFP_Reach 2 clone #4.<br />
<br />
Transformation of GFP_Reach 1 clone #3 and GFP_Reach 2 clones #3 and #5 were performed together with the TEV protease to create two plasmid construct. <br />
<br />
The GFP_Reach 1 and GFP_Reach 2 constructs were also restricted and ligated into the pSB1C3 vector from the pSB3K3 vector.<br />
* over night cultures of K131026 in DH5α and NEB<br />
<br />
== 16th ==<br />
<br />
* made master plates of the transformation from the day before. <br />
* Also PCRs were made from pSBXA3, I20260 and K131900 for a Gibson assembly. The PCRs were checked with a gel electrophoresis.<br />
* made chips with K131026 in DH5α and NEB. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_16_09_2014_K131026_neb_serie.png|title=Sensor Chips with K131026 in NEB in LB|subtitle=Sensor chips with K131026 in NEB in LB medium with 1,5% agarose, right chip induced. A) 0.5&nbsp;h after induction with 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 1&nbsp;h after induction C) 1.5&nbsp;h after induction D) 2&nbsp;h after induction E) 2.5&nbsp;h after induction F) 3&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
== 17th ==<br />
<br />
* prepped and autoclaved 33 500&nbsp;mL shake flasks.<br />
<br />
== 18th ==<br />
* SDS page of REACh constructs with TEV and IPTG<br />
* over night cultures of K131026, B0015, K1319013, K1319014, K1319013 + K1319008 and K1319014 + K1319008 all in BL21<br />
* tested ''Pseudomonas fluoresence'' if they are suitable for a growth experiment that is planned for our collaboration with the NEAnderLab next week. Therefore, she filled 2 500&nbsp;mL flasks with 30&nbsp;mL LB Pseudomonas-F medium, and inoculated each one with 1&nbsp;mL culture medium of the overnight preculture. Flasks were inoculated at 30°C at 250&nbsp;rpm. However, after 5 hours no exponential growth could be shown (s. plot below). Thus, it was decided to use a ''E. coli'' K12 derivate strain in TB medium instead, and 30&nbsp;mL of TB medium in a 500&nbsp;mL flask were inoculated with ''E. coli'' DH5α cells and incubated at 37°C at 300 rpm over night. According to the [https://www.dsmz.de/catalogues/catalogue-microorganisms/groups-of-organisms-and-their-applications/strains-for-schools-and-universities.html DSMZ] ''E . coli'' K12 strain derivates, such as DH5α, are adequate for the kind of school experiment we are planning with the NEAnderLab.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-09-19_NEAnderLab_Test_Growth_Curves_of_Pf_in_LB_iNB.png|title=Growth Curves|subtitle=Unfortunately, ''P. fluorescens'' did not show a nice exponential growth curve over the observed 5 hours.|width=1000px}}<br />
</center><br />
<br />
== 19th ==<br />
* made flask cultures of K1319013, K1319013 + K1319008, K1319013 + K1319008 + iPTG, K1319014, K1319014 + K1319008, K1319014 + K1319008 + iPTG, B0015 (negative control) and I20260 (positive control). iPTG was added at an OD of ~0.5. Inoculation was done via precultures in 500 ml shake flasks (50 ml filling volume). Media was always LB. Cultivation was done at 37°C and 300&nbsp;rpm. The starting OD was aimed to be 0.1. Inoculation occured directly from the precultures. Samples were taken every hour and checked for OD and fluorescence using a spectrophotometer and plate reader, respectively.<br />
<br />
* did plasmid preparation from the cultures of the day before (K1319013, K1319013 + K1319008, K1319013 + K1319008 + iPTG, K1319014, K1319014 + K1319008, K1319014 + K1319008 + iPTG, B0015 and I20260). The plasmid were then be cut with EcoRI and PstI, and the results were be put on an agarose gel in order to perform a restriction test. Also plasmids of K1319013 and K1319014 will be cut with EcoRi and SpeI. K1319008 will be cut with XbaI and PstI. These will then be ligated together and then ligated into a pSB1A3 vector via the 3A assembly (vector cut with EcoRI and PstI). These constructs will be transformed into BL21 (and NEB as a backup). The created construts will be known as K1319018 (K1319013.K1319008) and K1319019 (K1319014.K1319008).<br />
<br />
* made precultures of the master plates from the day before (K1319008, K1319013, K1319015 and pSBX1A3 with Gal3).<br />
<br />
* also inoculated 4 cultures for the further testing of the OD/F Device (the F part). The cultures are 2 shake flasks of I20260 and 2 shake flasks of B0015. <br />
<br />
* Furthermore, did a growth experiment with DH5α for the NEAnderLab school experiment. 3 500&nbsp;mL shake flasks were filled with 50&nbsp;mL TB medium, and inoculated to an OD of 1.5 with the overnight preculture. Samples were taken every 30 minutes and tested for OD using our own device as well as the spectrophotometer. The resulting growth curve is shown below. we concluded that the growth was fast enough for these growth conditions to be used for the school experiment on the 24th. <br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-09-19_NEAnderLab_Test_Growth_Curves_in_TB_iNB.png|title=Growth Curves|subtitle=Growth under these conditions was sufficient for the school experiment to be carried in 5 hours. And our device did a good job measuring, too!|width=1000px}}<br />
</center><br />
<br />
* made chips with K1319013 + K1319008, K1319014 + K1319008, K1319013, K1319014, B0015 and K131026. Images were taken every 30 minutes with our own device.<br />
<br />
* tested our OD/F Device with a dilution test. Samples were checked with the spectrophotometer (OD), our OD/F Device (fluorescence) and platereader (fluorescence).<br />
<br />
* made two SDS gels. <br />
<br />
* inoculated a culture of K1319008, B0015 as well as I20260 to check whether the results from our construct are from a wrongly done Gibson assembly with a still functioning superfolded GFP (the TEV protease was inserted in a backbone that formely contained superfolded GFP.)<br />
<br />
== 20th ==<br />
* SDS page of REACh constructs with TEV protease and induced by IPTG<br />
<br />
== 22nd ==<br />
<br />
* we poured several Pseudomonas-F agar plates with 0, 150 and 300&nbsp;µg/L for the NEAnderLab school experiment. She also autoclaved 12 500&nbsp;mL shake flasks, partly to be used for the school collaboration on Wednesday.<br />
<br />
== 26th ==<br />
* We did a check PCR on several cryo cultures. All samples with G00100_Alternative+K1319004_check_R combinations resulted in a strong band at ~2300&nbsp;bp that we cannot explain. All G00100_Alternative+K1319004_check_R combinations resulted in a strong band at 900&nbsp;bp that we cannot explain either. We concluded that the annealing temperatures were wrong and favored unspecific products. Therefore, we decided to do a gradient PCR to find out the optimal annealing temperatures for our new primers.<br />
<br />
* Gradient PCR to test new primer:<br />
did gradient PCR with these new primers:<br />
<br />
<center><br />
{| class="wikitable"<br />
! name !! sequence<br />
|-<br />
| G00100_Alternative || GTGCCACCTGACGTCTAAGAAACCATTATTATC<br />
|-<br />
| G00101_Alternative || ATTACCGCCTTTGAGTGAGCTGATACCGCTCG<br />
|-<br />
| K1319004_check_R || ACGGAATTTCAGTTTCTGCGGGAACGGCGG<br />
|-<br />
| I746909_check_R || ATCTTTAGACAGAACGCTTTGCGTGCTCAG<br />
|}<br />
</center><br />
<br />
Three PCRs with different primer combinations were run. In all of them the templates were K1319004&nbsp;in pSB1C3, K1319008&nbsp;in&nbsp;pSB1C3 and I746909&nbsp;in&nbsp;pSB1C3.<br />
<br />
The first gradient PCR tested the G00100_Alternative + G00101_Alternative combination:<br />
<br />
<center><br />
{| class="wikitable"<br />
! primer_F !! primer_R !! template !! expected length !! best annealing temperature<br />
|-<br />
| G00100_Alternative || G00101_Alternative || K1319004&nbsp;in pSB1C3 || 1057 || ???<br />
|-<br />
| G00100_Alternative || G00101_Alternative || K1319008&nbsp;in&nbsp;pSB1C3 || 1245 || ???<br />
|-<br />
| G00100_Alternative || G00101_Alternative || I746909&nbsp;in&nbsp;pSB1C3 || 1221 || ???<br />
|-<br />
| G00100_Alternative || G00101_Alternative || water || --- || ???<br />
|}<br />
{{Team:Aachen/Figure|Aachen_14-09-26_gradientPCR_1.png|title=Gradient PCR 1|subtitle=the primers were G00100_Alternative and G00101_Alternative and they worked well at all temperatures from 55-65°C.|width=800px}}<br />
</center><br />
<br />
The second gradient PCR tested the G00100_Alternative + I746916_check_R combination:<br />
<center><br />
{| class="wikitable"<br />
! primer_F !! primer_R !! template !! expected length !! best annealing temperature<br />
|-<br />
| G00100_Alternative || I746916_check_R || K1319004&nbsp;in pSB1C3 || none || ???<br />
|-<br />
| G00100_Alternative || I746916_check_R || K1319008&nbsp;in&nbsp;pSB1C3 || none || ???<br />
|-<br />
| G00100_Alternative || I746916_check_R || I746909&nbsp;in&nbsp;pSB1C3 || 820 || ???<br />
|-<br />
| G00100_Alternative || I746916_check_R || water || --- || ???<br />
|}<br />
{{Team:Aachen/Figure|Aachen_14-09-26_gradientPCR_2.png|title=Gradient PCR 2|subtitle=the primers were G00100_Alternative and I746916_check_R and they worked well at all temperatures from 55-65°C. Apparently the K1319008 template contained I746916.|width=800px}}<br />
</center><br />
<br />
The third gradient PCR tested the G00100_Alternative + K1319004_check_R combination:<br />
<center><br />
{| class="wikitable"<br />
! primer_F !! primer_R !! template !! expected length !! best annealing temperature<br />
|-<br />
| G00100_Alternative || K1319004_check_R || K1319004&nbsp;in pSB1C3 || 541 || ???<br />
|-<br />
| G00100_Alternative || K1319004_check_R || K1319008&nbsp;in&nbsp;pSB1C3 || 502 || ???<br />
|-<br />
| G00100_Alternative || K1319004_check_R || I746909&nbsp;in&nbsp;pSB1C3 || none || ???<br />
|-<br />
| G00100_Alternative || K1319004_check_R || water || --- || ???<br />
|}<br />
{{Team:Aachen/Figure|Aachen_14-09-26_gradientPCR_3.png|title=Gradient PCR 3|subtitle=The primers were G00100_Alternative and K1319004_check_R and they worked well at all temperatures from 60-68°C. To our disappointment, the K1319008 template did not contain K1319004. It is unclear why the 5 bands of K1319008 and I746916 look different.|width=800px}}<br />
</center><br />
<br />
The results of these three PCRs are:<br />
# KAPA2G Fast ReadyMix worked well<br />
# all three primers work well at >65°C annealing temperature<br />
# K1319008 template contained I746916 instead of the intended K1319004 ORF<br />
<br />
It was concluded that a similar check PCR with 65°C annealing temperature will be done on all plasmids and cryos of K1319008.<br />
<br />
== 27th ==<br />
* First we transformed K1319001, K1319002, K1319003 and K1319004 (all in pSB1C3) into NEB10β cells. He tested the PCR machine for semi-automated heat-shocking by splitting the 50&nbsp;µL cells with the plasmid into 2x 25&nbsp;µL. All 100&nbsp;µL were plated for all construct/machine combinations.<br />
<br />
* transformed several constructs into chemically competent BL21(DE3) cells.<br />
<br />
* we did colony-PCR on all plasmids, cryos and colonies that should contain the K1319004 sequence.<br />
<br />
* we also made check a PCR on galectin-constructs:<br />
<center><br />
{| class="wikitable"<br />
! label !! primer_F !! primer_R !! expected length !! result<br />
|-<br />
| Gal3 in pSBX1A3 #1 || G00100_Alternative || K1319003_R || 1684 || ???<br />
|-<br />
| Gal3 in pSBX1A3 #2 || G00100_Alternative || K1319003_R || 1684 || ???<br />
|-<br />
| Gal3 in pSBX1A3 #3 || G00100_Alternative || K1319003_R || 1684 || ???<br />
|-<br />
| Gal3 YFP #3 || pETGal3_seq_F || K1319003_R || 867 || ???<br />
|-<br />
| Gal3 YFP #3 || pETGal3_seq_F || K1319003_R || 867 || ???<br />
|-<br />
| Gal3 YFP pet17 AmpR || pETGal3_seq_F || K1319003_R || 867 or none || ???<br />
|-<br />
| pET17 Gal3 #1 || pETGal3_seq_F || K1319003_R || none || ???<br />
|-<br />
| K1319003 in pSB1C3 || G00100_Alternative || K1319003_R || 930 || ???<br />
|}<br />
</center><br />
<br />
== 28th ==<br />
* made a restriction of BioBrick K1319020 and vector pSB1C3 with restriction enzymes EcoRI and PstI. Then we ligated the restricted parts and made a transformation using ''E. coli'' NEB 10ß cells.<br />
<br />
== 29th ==<br />
<br />
* made cryo cultures and plasmid preparation of K1319010, K1319011, K1319012, K1319021 and K1319042. We determined the contentration of plasmids and made did a restriction digest of K1319010, K1319011, K1319012, pSB1C3, K1319021, K1319013 and K1319014, followed by a ligation in K1319010.pSB1C3, K1319011.pSB1C3, K1319012.pSB1C3, K1319021.K1319013.pSB1A3 and K1319021.K1319013.pSB1A3. All constructs were transformed into ''E. coli'' NEB 10ß.<br />
<br />
* prepared 3 500&nbsp;mL flasks with 30&nbsp;mL LB medium which were inoculated with a ''Pseudomonas putida'' strain. The cells were cultured over night at 28°C and ~300&nbsp;rpm. The cultures are supposed to be used to test our OD device.<br />
<br />
== 30th ==<br />
<br />
* Sequencing samples were sent in for K1319020 clone #2, 3 & 5 (in pSB1C3), K1319017 clone #1 (in pSB1C3), K1319010 clone #2 (in pSB3K3), K1319011 clone #1 (in pSB3K3), K1319012 clone #2 (in pSB3K3), K1319013 clone #1 (in pSB1C3), K1319014 clone #1 (in pSB1C3), K1319001 (in pSB1C3) and K1319002 (in pSB1C3). <br />
<br />
* A plasmid prep of K1319013 and K1319014 was run.<br />
<br />
* A Gibson assembly with the K1319015 from the I20260 backbone and the K1319000 insert, forming K3139015, was conducted. The product was subsequently transformed into NEB10β cells. <br />
<br />
* The pSB1C3 plasmid backbones were amplified via PCR and purified.<br />
<br />
* Colony-PCRs of K1319008 and K1319012 master plates were made to confirm the colony's identity. Subsequently, pre-cultures were inoculated. <br />
<br />
* A transformation of K1319010 and K1319010 in pSB1C3 was conducted.<br />
<br />
* Another plasmid prep of K1319010 clone #2, K1319011 clone #1, K1319012 clone #2 (all in pSB3K3), K1319013 clone #4, K1319014 #3, K139020 #2, 3, 5 (all in pSB1C3) was run.<br />
<br />
* The OD device was tested with a dilution series of a ''Pseudomonas putida'' culture.<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
== References ==<br />
Kupper CE, Böcker S, Liu H, et al. Fluorescent SNAP-tag galectin fusion proteins as novel tools in glycobiology. Curr Pharm Des. 2013;19(30):5457-67. Available at: http://www.ncbi.nlm.nih.gov/pubmed/23431989.<br />
<br />
<br />
<br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/SeptemberTeam:Aachen/Notebook/Wetlab/September2014-10-17T23:32:30Z<p>VeraA: /* 5th */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= September =<br />
== 1st ==<br />
* 5&nbsp;ml cultures of K1319003 and K1319004<br />
* plasmid prep<br />
<center><br />
{| class="wikitable"<br />
|-<br />
! Plasmid !! DNA [ng/µl] <br />
|-<br />
| J23101.K516032 pSB1K3|| 23.5<br />
|-<br />
| J23115.K516032 pSB1K3|| 20.5<br />
|-<br />
| J04450 pSB1A3|| 57.5<br />
|-<br />
| J04450 pSB1K1|| 63.5<br />
|} </center><br />
* over night cultures of K131026 in DH5α and NEB<br />
<br />
== 2nd ==<br />
* made chips with K131026 in DH5α and NEB. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_02_09_2014_K131026_dh5a_serie.png|title=Sensor Chips with K131026 in DH5α in LB taken with the second version of our own device|subtitle=Sensor chips with K131026 in DH5α in LB medium with 1,5% agarose, right chip induced. A) befor induction with 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 0.5&nbsp;h after induction C) 1&nbsp;h after induction D) 1.5&nbsp;h after induction E) 2.5&nbsp;h after induction F) 3&nbsp;h after induction|width=900px}}<br />
</center><br />
* gel purification of vector backbones <br />
* sent to sequencing:<br />
** K1318003<br />
** K1319004<br />
** J23101.K516032 <br />
** J23115.K516032<br />
<br />
== 3rd ==<br />
* prepared 50&nbsp;mL LB+antibiotic overnight-cultures of pSBX-vectors that were sent in by team Heidelberg.<br />
<br />
== 4th ==<br />
* In the morning, at 10:15, we inoculated the precultures for the interlab study experiment.<br />
* prepared cryo stocks of the pSBX-carrying ''E.&nbsp;coli'' from the overnight cultures. He also purified each pSBX-vector, eluting with 15+30&nbsp;µL water, and resulting in the following DNA concentrations:<br />
<br />
<center><br />
{| class="wikitable"<br />
! vector !! concentration [ng/µL]<br />
|-<br />
| pSBX1A3 || 111<br />
|-<br />
| pSBX4A5 || 14.1<br />
|-<br />
| pSBX1C3 || 31<br />
|-<br />
| pSB4C5 || 98.5<br />
|-<br />
| pSBX1K3 || 18<br />
|-<br />
| pSBX4K5 || 30<br />
|-<br />
| pSBX1T3 || 39<br />
|-<br />
| constitutive expression plasmid || 73<br />
|}<br />
</center><br />
<br />
* PCRs for Gibson assembly of K1319003 into pET17. Duplicates of 25&nbsp;µL reaction volume (12.5&nbsp;µL Q5 2x Master Mix, 1.25&nbsp;µL per primer, 2&nbsp;µL template)<br />
<center><br />
{| class="wikitable"<br />
! PCR tube # !! components<br />
|-<br />
| 1 and 2 || pET17 + pET17_Gal3_Gib_F + pET17_Gal3_Gib_R<br />
|-<br />
| 3 and 4 || K1319003 + K1319003_Gib_F + K1319003_Gib_R<br />
|-<br />
|}<br />
</center><br />
<br />
The PCR conditions:<br />
<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
|-<br />
| denature || 98 || 30", 98°C for 10", 55°C for 30", 72°C for 2'15"<br />
|-<br />
| denature || 98 || 10"<br />
|-<br />
| anneal || 50 (insert) 55 (backbone) || 30"<br />
|-<br />
| elongate || 72 || 0'30" (insert) 2'15" (backbone)<br />
|-<br />
| elongate || 72 || 2"<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
<br />
* Finally, we did the Gibson assembly and a heat shock transformation into NEB10β cells.<br />
<br />
* At 10:15, we inoculated the primary cultures of the interlab study experiment and began with regular fluorescence measurements.<br />
<br />
== 5th ==<br />
* made master plates of yesterday's transformed cells.<br />
* As described in the article by Elling [1], Gal3 binds on the LPS of ''Pseudomonas aeruginosa''. To demonstrate this behavior several experiments were conducted. The experiments included the binding of Gal3 to ''Saccharomyces cerevisiae'', ''E.coli'', ''Pseudomonas putida'' and ''Pseudomonas aeruginosa''. The precultures were washed two times in PBS, resuspended in 10 and 50 ng/ml of YFP-Gal3 and then incubated for 1 h at room temperature. Afterwards, all samples were examined in the fluorescence microscope. As a positive control NEB10ß cells with E0030 were used. Unfortunatly, a fluorescence was not visually detectable, with exception of the positive control.<br />
<br />
== 6th ==<br />
* made precultures of 3 clones from each prepared master palte and inoculated precultures for OD/F measurements as well as chip production on the 7th.<br />
<br />
== 7th ==<br />
* made cryos stocks of the precultures<br />
* made chips with K131026 in DH5α and NEB and B0015 in NEB. Images were taken every 30 min with our own device <br />
<center><br />
{{Team:Aachen/Figure|Aachen_07_09_2014_B0015_neb_serie.png|title=Sensor Chips with B0015 in NEB (negativ control) in TB taken with the second version of our own device|subtitle=Sensor chips with B0015 in NEB in TB medium with 1,5% agar, right chip induced. A) befor induction with 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 0&nbsp;h after induction C) 0.5&nbsp;h after induction D) 1&nbsp;h after induction E) 2&nbsp;h after induction F) 2.5&nbsp;h after induction|width=900px}}<br />
</center><br />
* purification of the following plasmids:<br />
<br />
<center><br />
{| class="wikitable"<br />
! plasmid !! strain !! resistance !! vector !! # of clone picked !! concentration [ng/µl]<br />
|-<br />
|K1319000 in I20260 || NEB10ß || K || pSB3K3 || 1 ||<br />
|-<br />
|K1319000 in I20260 || NEB10ß || K || pSB3K3 || 3 ||<br />
|-<br />
|K1319000 in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319001 in I20260 || NEB10ß || K || pSB3K3 || 1 ||<br />
|-<br />
|K1319001 in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319001 in I20260 || NEB10ß || K || pSB3K3 || 6 ||<br />
|-<br />
|K1319002 in I20260 || NEB10ß || K || pSB3K3 || 1 ||<br />
|-<br />
|K1319002 in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319002 in I20260 || NEB10ß || K || pSB3K3 || 6 ||<br />
|-<br />
|K1319001_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 4 ||<br />
|-<br />
|K1319001_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319001_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 6 ||<br />
|-<br />
|K1319002_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 3 ||<br />
|-<br />
|K1319002_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 4 ||<br />
|-<br />
|K1319002_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|His-SNAP-YFP-K1319003 || NEB10ß || A || pET17 || 3 ||<br />
|-<br />
|His-SNAP-YFP-K1319003 || NEB10ß || A || pET17 || 4 ||<br />
|-<br />
|His-SNAP-YFP-K1319003 || NEB10ß || A || pET17 || 6 ||<br />
|}<br />
</center><br />
<br />
Elution was performed twice with 15&nbsp;µL of nuclease free water each time.<br />
<br />
== 9th ==<br />
* made chips with K131026 in DH5α and NEB and without cells. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_09_09_2014_K131026_neb_agarose_serie.png|title=Sensor Chips with K131026 in DH5α in LB|subtitle=Sensor chips with K131026 in DH5α in LB medium with 1,5% agarose, right chip induced. A) befor induction with 1&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 1&nbsp;h after induction C) 1.5&nbsp;h after induction D) 2&nbsp;h after induction E) 2.5&nbsp;h after induction F) 3&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
== 10th ==<br />
* SDS page of REACh constructs after Gibson <br />
* plasmid prep of Gal3 YFP<br />
** #3: 20&nbsp;ng/µl<br />
** #4: 21.5&nbsp;ng/µl<br />
** #6: 15.9&nbsp;ng/µl<br />
<br />
== 15th ==<br />
analyze the sequencing data from the clones of GFP_Reach 1, GFP_Reach 2 and K1319008. <br />
<br />
GFP_Reach 2 clone #3 and #5 were fine, including the Leu to Ile mutation.<br />
GFP_Reach 1 clone #4 and #5 were fine and did not contain the Leu to Ile mutation. Clone #6 was fine but contained the Leu to Ile mutation from the Reach 1 quick change mutations. <br />
<br />
For future experiments, we will use the GFP_Reach 1 clone #4 and the GFP_Reach 2 clone #4.<br />
<br />
Transformation of GFP_Reach 1 clone #3 and GFP_Reach 2 clones #3 and #5 were performed together with the TEV protease to create two plasmid construct. <br />
<br />
The GFP_Reach 1 and GFP_Reach 2 constructs were also restricted and ligated into the pSB1C3 vector from the pSB3K3 vector.<br />
* over night cultures of K131026 in DH5α and NEB<br />
<br />
== 16th ==<br />
<br />
* made master plates of the transformation from the day before. <br />
* Also PCRs were made from pSBXA3, I20260 and K131900 for a Gibson assembly. The PCRs were checked with a gel electrophoresis.<br />
* made chips with K131026 in DH5α and NEB. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_16_09_2014_K131026_neb_serie.png|title=Sensor Chips with K131026 in NEB in LB|subtitle=Sensor chips with K131026 in NEB in LB medium with 1,5% agarose, right chip induced. A) 0.5&nbsp;h after induction with 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 1&nbsp;h after induction C) 1.5&nbsp;h after induction D) 2&nbsp;h after induction E) 2.5&nbsp;h after induction F) 3&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
== 17th ==<br />
<br />
* prepped and autoclaved 33 500&nbsp;mL shake flasks.<br />
<br />
== 18th ==<br />
* SDS page of REACh constructs with TEV and IPTG<br />
* over night cultures of K131026, B0015, K1319013, K1319014, K1319013 + K1319008 and K1319014 + K1319008 all in BL21<br />
* tested ''Pseudomonas fluoresence'' if they are suitable for a growth experiment that is planned for our collaboration with the NEAnderLab next week. Therefore, she filled 2 500&nbsp;mL flasks with 30&nbsp;mL LB Pseudomonas-F medium, and inoculated each one with 1&nbsp;mL culture medium of the overnight preculture. Flasks were inoculated at 30°C at 250&nbsp;rpm. However, after 5 hours no exponential growth could be shown (s. plot below). Thus, it was decided to use a ''E. coli'' K12 derivate strain in TB medium instead, and 30&nbsp;mL of TB medium in a 500&nbsp;mL flask were inoculated with ''E. coli'' DH5α cells and incubated at 37°C at 300 rpm over night. According to the [https://www.dsmz.de/catalogues/catalogue-microorganisms/groups-of-organisms-and-their-applications/strains-for-schools-and-universities.html DSMZ] ''E . coli'' K12 strain derivates, such as DH5α, are adequate for the kind of school experiment we are planning with the NEAnderLab.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-09-19_NEAnderLab_Test_Growth_Curves_of_Pf_in_LB_iNB.png|title=Growth Curves|subtitle=Unfortunately, ''P. fluorescens'' did not show a nice exponential growth curve over the observed 5 hours.|width=1000px}}<br />
</center><br />
<br />
== 19th ==<br />
* made flask cultures of K1319013, K1319013 + K1319008, K1319013 + K1319008 + iPTG, K1319014, K1319014 + K1319008, K1319014 + K1319008 + iPTG, B0015 (negative control) and I20260 (positive control). iPTG was added at an OD of ~0.5. Inoculation was done via precultures in 500 ml shake flasks (50 ml filling volume). Media was always LB. Cultivation was done at 37°C and 300&nbsp;rpm. The starting OD was aimed to be 0.1. Inoculation occured directly from the precultures. Samples were taken every hour and checked for OD and fluorescence using a spectrophotometer and plate reader, respectively.<br />
<br />
* did plasmid preparation from the cultures of the day before (K1319013, K1319013 + K1319008, K1319013 + K1319008 + iPTG, K1319014, K1319014 + K1319008, K1319014 + K1319008 + iPTG, B0015 and I20260). The plasmid were then be cut with EcoRI and PstI, and the results were be put on an agarose gel in order to perform a restriction test. Also plasmids of K1319013 and K1319014 will be cut with EcoRi and SpeI. K1319008 will be cut with XbaI and PstI. These will then be ligated together and then ligated into a pSB1A3 vector via the 3A assembly (vector cut with EcoRI and PstI). These constructs will be transformed into BL21 (and NEB as a backup). The created construts will be known as K1319018 (K1319013.K1319008) and K1319019 (K1319014.K1319008).<br />
<br />
* made precultures of the master plates from the day before (K1319008, K1319013, K1319015 and pSBX1A3 with Gal3).<br />
<br />
* also inoculated 4 cultures for the further testing of the OD/F Device (the F part). The cultures are 2 shake flasks of I20260 and 2 shake flasks of B0015. <br />
<br />
* Furthermore, did a growth experiment with DH5α for the NEAnderLab school experiment. 3 500&nbsp;mL shake flasks were filled with 50&nbsp;mL TB medium, and inoculated to an OD of 1.5 with the overnight preculture. Samples were taken every 30 minutes and tested for OD using our own device as well as the spectrophotometer. The resulting growth curve is shown below. we concluded that the growth was fast enough for these growth conditions to be used for the school experiment on the 24th. <br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-09-19_NEAnderLab_Test_Growth_Curves_in_TB_iNB.png|title=Growth Curves|subtitle=Growth under these conditions was sufficient for the school experiment to be carried in 5 hours. And our device did a good job measuring, too!|width=1000px}}<br />
</center><br />
<br />
* made chips with K1319013 + K1319008, K1319014 + K1319008, K1319013, K1319014, B0015 and K131026. Images were taken every 30 minutes with our own device.<br />
<br />
* tested our OD/F Device with a dilution test. Samples were checked with the spectrophotometer (OD), our OD/F Device (fluorescence) and platereader (fluorescence).<br />
<br />
* made two SDS gels. <br />
<br />
* inoculated a culture of K1319008, B0015 as well as I20260 to check whether the results from our construct are from a wrongly done Gibson assembly with a still functioning superfolded GFP (the TEV protease was inserted in a backbone that formely contained superfolded GFP.)<br />
<br />
== 20th ==<br />
* SDS page of REACh constructs with TEV protease and induced by IPTG<br />
<br />
== 22nd ==<br />
<br />
* we poured several Pseudomonas-F agar plates with 0, 150 and 300&nbsp;µg/L for the NEAnderLab school experiment. She also autoclaved 12 500&nbsp;mL shake flasks, partly to be used for the school collaboration on Wednesday.<br />
<br />
== 26th ==<br />
* We did a check PCR on several cryo cultures. All samples with G00100_Alternative+K1319004_check_R combinations resulted in a strong band at ~2300&nbsp;bp that we cannot explain. All G00100_Alternative+K1319004_check_R combinations resulted in a strong band at 900&nbsp;bp that we cannot explain either. We concluded that the annealing temperatures were wrong and favored unspecific products. Therefore, we decided to do a gradient PCR to find out the optimal annealing temperatures for our new primers.<br />
<br />
* Gradient PCR to test new primer:<br />
did gradient PCR with these new primers:<br />
<br />
<center><br />
{| class="wikitable"<br />
! name !! sequence<br />
|-<br />
| G00100_Alternative || GTGCCACCTGACGTCTAAGAAACCATTATTATC<br />
|-<br />
| G00101_Alternative || ATTACCGCCTTTGAGTGAGCTGATACCGCTCG<br />
|-<br />
| K1319004_check_R || ACGGAATTTCAGTTTCTGCGGGAACGGCGG<br />
|-<br />
| I746909_check_R || ATCTTTAGACAGAACGCTTTGCGTGCTCAG<br />
|}<br />
</center><br />
<br />
Three PCRs with different primer combinations were run. In all of them the templates were K1319004&nbsp;in pSB1C3, K1319008&nbsp;in&nbsp;pSB1C3 and I746909&nbsp;in&nbsp;pSB1C3.<br />
<br />
The first gradient PCR tested the G00100_Alternative + G00101_Alternative combination:<br />
<br />
<center><br />
{| class="wikitable"<br />
! primer_F !! primer_R !! template !! expected length !! best annealing temperature<br />
|-<br />
| G00100_Alternative || G00101_Alternative || K1319004&nbsp;in pSB1C3 || 1057 || ???<br />
|-<br />
| G00100_Alternative || G00101_Alternative || K1319008&nbsp;in&nbsp;pSB1C3 || 1245 || ???<br />
|-<br />
| G00100_Alternative || G00101_Alternative || I746909&nbsp;in&nbsp;pSB1C3 || 1221 || ???<br />
|-<br />
| G00100_Alternative || G00101_Alternative || water || --- || ???<br />
|}<br />
{{Team:Aachen/Figure|Aachen_14-09-26_gradientPCR_1.png|title=Gradient PCR 1|subtitle=the primers were G00100_Alternative and G00101_Alternative and they worked well at all temperatures from 55-65°C.|width=800px}}<br />
</center><br />
<br />
The second gradient PCR tested the G00100_Alternative + I746916_check_R combination:<br />
<center><br />
{| class="wikitable"<br />
! primer_F !! primer_R !! template !! expected length !! best annealing temperature<br />
|-<br />
| G00100_Alternative || I746916_check_R || K1319004&nbsp;in pSB1C3 || none || ???<br />
|-<br />
| G00100_Alternative || I746916_check_R || K1319008&nbsp;in&nbsp;pSB1C3 || none || ???<br />
|-<br />
| G00100_Alternative || I746916_check_R || I746909&nbsp;in&nbsp;pSB1C3 || 820 || ???<br />
|-<br />
| G00100_Alternative || I746916_check_R || water || --- || ???<br />
|}<br />
{{Team:Aachen/Figure|Aachen_14-09-26_gradientPCR_2.png|title=Gradient PCR 2|subtitle=the primers were G00100_Alternative and I746916_check_R and they worked well at all temperatures from 55-65°C. Apparently the K1319008 template contained I746916.|width=800px}}<br />
</center><br />
<br />
The third gradient PCR tested the G00100_Alternative + K1319004_check_R combination:<br />
<center><br />
{| class="wikitable"<br />
! primer_F !! primer_R !! template !! expected length !! best annealing temperature<br />
|-<br />
| G00100_Alternative || K1319004_check_R || K1319004&nbsp;in pSB1C3 || 541 || ???<br />
|-<br />
| G00100_Alternative || K1319004_check_R || K1319008&nbsp;in&nbsp;pSB1C3 || 502 || ???<br />
|-<br />
| G00100_Alternative || K1319004_check_R || I746909&nbsp;in&nbsp;pSB1C3 || none || ???<br />
|-<br />
| G00100_Alternative || K1319004_check_R || water || --- || ???<br />
|}<br />
{{Team:Aachen/Figure|Aachen_14-09-26_gradientPCR_3.png|title=Gradient PCR 3|subtitle=The primers were G00100_Alternative and K1319004_check_R and they worked well at all temperatures from 60-68°C. To our disappointment, the K1319008 template did not contain K1319004. It is unclear why the 5 bands of K1319008 and I746916 look different.|width=800px}}<br />
</center><br />
<br />
The results of these three PCRs are:<br />
# KAPA2G Fast ReadyMix worked well<br />
# all three primers work well at >65°C annealing temperature<br />
# K1319008 template contained I746916 instead of the intended K1319004 ORF<br />
<br />
It was concluded that a similar check PCR with 65°C annealing temperature will be done on all plasmids and cryos of K1319008.<br />
<br />
== 27th ==<br />
* First we transformed K1319001, K1319002, K1319003 and K1319004 (all in pSB1C3) into NEB10β cells. He tested the PCR machine for semi-automated heat-shocking by splitting the 50&nbsp;µL cells with the plasmid into 2x 25&nbsp;µL. All 100&nbsp;µL were plated for all construct/machine combinations.<br />
<br />
* transformed several constructs into chemically competent BL21(DE3) cells.<br />
<br />
* we did colony-PCR on all plasmids, cryos and colonies that should contain the K1319004 sequence.<br />
<br />
* we also made check a PCR on galectin-constructs:<br />
<center><br />
{| class="wikitable"<br />
! label !! primer_F !! primer_R !! expected length !! result<br />
|-<br />
| Gal3 in pSBX1A3 #1 || G00100_Alternative || K1319003_R || 1684 || ???<br />
|-<br />
| Gal3 in pSBX1A3 #2 || G00100_Alternative || K1319003_R || 1684 || ???<br />
|-<br />
| Gal3 in pSBX1A3 #3 || G00100_Alternative || K1319003_R || 1684 || ???<br />
|-<br />
| Gal3 YFP #3 || pETGal3_seq_F || K1319003_R || 867 || ???<br />
|-<br />
| Gal3 YFP #3 || pETGal3_seq_F || K1319003_R || 867 || ???<br />
|-<br />
| Gal3 YFP pet17 AmpR || pETGal3_seq_F || K1319003_R || 867 or none || ???<br />
|-<br />
| pET17 Gal3 #1 || pETGal3_seq_F || K1319003_R || none || ???<br />
|-<br />
| K1319003 in pSB1C3 || G00100_Alternative || K1319003_R || 930 || ???<br />
|}<br />
</center><br />
<br />
== 28th ==<br />
* made a restriction of BioBrick K1319020 and vector pSB1C3 with restriction enzymes EcoRI and PstI. Then we ligated the restricted parts and made a transformation using ''E. coli'' NEB 10ß cells.<br />
<br />
== 29th ==<br />
<br />
* made cryo cultures and plasmid preparation of K1319010, K1319011, K1319012, K1319021 and K1319042. We determined the contentration of plasmids and made did a restriction digest of K1319010, K1319011, K1319012, pSB1C3, K1319021, K1319013 and K1319014, followed by a ligation in K1319010.pSB1C3, K1319011.pSB1C3, K1319012.pSB1C3, K1319021.K1319013.pSB1A3 and K1319021.K1319013.pSB1A3. All constructs were transformed into ''E. coli'' NEB 10ß.<br />
<br />
* prepared 3 500&nbsp;mL flasks with 30&nbsp;mL LB medium which were inoculated with a ''Pseudomonas putida'' strain. The cells were cultured over night at 28°C and ~300&nbsp;rpm. The cultures are supposed to be used to test our OD device.<br />
<br />
== 30th ==<br />
<br />
* Sequencing samples were sent in for K1319020 clone #2, 3 & 5 (in pSB1C3), K1319017 clone #1 (in pSB1C3), K1319010 clone #2 (in pSB3K3), K1319011 clone #1 (in pSB3K3), K1319012 clone #2 (in pSB3K3), K1319013 clone #1 (in pSB1C3), K1319014 clone #1 (in pSB1C3), K1319001 (in pSB1C3) and K1319002 (in pSB1C3). <br />
<br />
* A plasmid prep of K1319013 and K1319014 was run.<br />
<br />
* A Gibson assembly with the K1319015 from the I20260 backbone and the K1319000 insert, forming K3139015, was conducted. The product was subsequently transformed into NEB10β cells. <br />
<br />
* The pSB1C3 plasmid backbones were amplified via PCR and purified.<br />
<br />
* Colony-PCRs of K1319008 and K1319012 master plates were made to confirm the colony's identity. Subsequently, pre-cultures were inoculated. <br />
<br />
* A transformation of K1319010 and K1319010 in pSB1C3 was conducted.<br />
<br />
* Another plasmid prep of K1319010 clone #2, K1319011 clone #1, K1319012 clone #2 (all in pSB3K3), K1319013 clone #4, K1319014 #3, K139020 #2, 3, 5 (all in pSB1C3) was run.<br />
<br />
* The OD device was tested with a dilution series of a ''Pseudomonas putida'' culture.<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
== References ==<br />
[1] Kupper CE, Böcker S, Liu H, et al. Fluorescent SNAP-tag galectin fusion proteins as novel tools in glycobiology. Curr Pharm Des. 2013;19(30):5457-67. Available at: http://www.ncbi.nlm.nih.gov/pubmed/23431989.<br />
<br />
<br />
<br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/SeptemberTeam:Aachen/Notebook/Wetlab/September2014-10-17T23:00:27Z<p>VeraA: /* 5th */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= September =<br />
== 1st ==<br />
* 5&nbsp;ml cultures of K1319003 and K1319004<br />
* plasmid prep<br />
<center><br />
{| class="wikitable"<br />
|-<br />
! Plasmid !! DNA [ng/µl] <br />
|-<br />
| J23101.K516032 pSB1K3|| 23.5<br />
|-<br />
| J23115.K516032 pSB1K3|| 20.5<br />
|-<br />
| J04450 pSB1A3|| 57.5<br />
|-<br />
| J04450 pSB1K1|| 63.5<br />
|} </center><br />
* over night cultures of K131026 in DH5α and NEB<br />
<br />
== 2nd ==<br />
* made chips with K131026 in DH5α and NEB. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_02_09_2014_K131026_dh5a_serie.png|title=Sensor Chips with K131026 in DH5α in LB taken with the second version of our own device|subtitle=Sensor chips with K131026 in DH5α in LB medium with 1,5% agarose, right chip induced. A) befor induction with 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 0.5&nbsp;h after induction C) 1&nbsp;h after induction D) 1.5&nbsp;h after induction E) 2.5&nbsp;h after induction F) 3&nbsp;h after induction|width=900px}}<br />
</center><br />
* gel purification of vector backbones <br />
* sent to sequencing:<br />
** K1318003<br />
** K1319004<br />
** J23101.K516032 <br />
** J23115.K516032<br />
<br />
== 3rd ==<br />
* prepared 50&nbsp;mL LB+antibiotic overnight-cultures of pSBX-vectors that were sent in by team Heidelberg.<br />
<br />
== 4th ==<br />
* In the morning, at 10:15, we inoculated the precultures for the interlab study experiment.<br />
* prepared cryo stocks of the pSBX-carrying ''E.&nbsp;coli'' from the overnight cultures. He also purified each pSBX-vector, eluting with 15+30&nbsp;µL water, and resulting in the following DNA concentrations:<br />
<br />
<center><br />
{| class="wikitable"<br />
! vector !! concentration [ng/µL]<br />
|-<br />
| pSBX1A3 || 111<br />
|-<br />
| pSBX4A5 || 14.1<br />
|-<br />
| pSBX1C3 || 31<br />
|-<br />
| pSB4C5 || 98.5<br />
|-<br />
| pSBX1K3 || 18<br />
|-<br />
| pSBX4K5 || 30<br />
|-<br />
| pSBX1T3 || 39<br />
|-<br />
| constitutive expression plasmid || 73<br />
|}<br />
</center><br />
<br />
* PCRs for Gibson assembly of K1319003 into pET17. Duplicates of 25&nbsp;µL reaction volume (12.5&nbsp;µL Q5 2x Master Mix, 1.25&nbsp;µL per primer, 2&nbsp;µL template)<br />
<center><br />
{| class="wikitable"<br />
! PCR tube # !! components<br />
|-<br />
| 1 and 2 || pET17 + pET17_Gal3_Gib_F + pET17_Gal3_Gib_R<br />
|-<br />
| 3 and 4 || K1319003 + K1319003_Gib_F + K1319003_Gib_R<br />
|-<br />
|}<br />
</center><br />
<br />
The PCR conditions:<br />
<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
|-<br />
| denature || 98 || 30", 98°C for 10", 55°C for 30", 72°C for 2'15"<br />
|-<br />
| denature || 98 || 10"<br />
|-<br />
| anneal || 50 (insert) 55 (backbone) || 30"<br />
|-<br />
| elongate || 72 || 0'30" (insert) 2'15" (backbone)<br />
|-<br />
| elongate || 72 || 2"<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
<br />
* Finally, we did the Gibson assembly and a heat shock transformation into NEB10β cells.<br />
<br />
* At 10:15, we inoculated the primary cultures of the interlab study experiment and began with regular fluorescence measurements.<br />
<br />
== 5th ==<br />
* made master plates of yesterday's transformed cells.<br />
* As described in the article by Elling [1], Gal3 binds on the LPS of ''Pseudomonas aeruginosa''.<br />
To demonstrate this behavior several experiments were conducted. The experiments included the binding of Gal3 to ''Saccharomyces cerevisiae'', ''E.coli'', ''Pseudomonas putida'' and ''Pseudomonas aeruginosa''. The precultures were washed two times in PBS, resuspended in 10 and 50 ng/ml of YFP-Gal3 and then incubated for 1 h at room temperature. Afterwards, all samples were examined in the fluorescence microscope. As a positive control NEB10ß cells with E0030 were used. Unfortunatly, a fluorescence was not visually detectable, with exception of the positive control.<br />
<br />
== 6th ==<br />
* made precultures of 3 clones from each prepared master palte and inoculated precultures for OD/F measurements as well as chip production on the 7th.<br />
<br />
== 7th ==<br />
* made cryos stocks of the precultures<br />
* made chips with K131026 in DH5α and NEB and B0015 in NEB. Images were taken every 30 min with our own device <br />
<center><br />
{{Team:Aachen/Figure|Aachen_07_09_2014_B0015_neb_serie.png|title=Sensor Chips with B0015 in NEB (negativ control) in TB taken with the second version of our own device|subtitle=Sensor chips with B0015 in NEB in TB medium with 1,5% agar, right chip induced. A) befor induction with 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 0&nbsp;h after induction C) 0.5&nbsp;h after induction D) 1&nbsp;h after induction E) 2&nbsp;h after induction F) 2.5&nbsp;h after induction|width=900px}}<br />
</center><br />
* purification of the following plasmids:<br />
<br />
<center><br />
{| class="wikitable"<br />
! plasmid !! strain !! resistance !! vector !! # of clone picked !! concentration [ng/µl]<br />
|-<br />
|K1319000 in I20260 || NEB10ß || K || pSB3K3 || 1 ||<br />
|-<br />
|K1319000 in I20260 || NEB10ß || K || pSB3K3 || 3 ||<br />
|-<br />
|K1319000 in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319001 in I20260 || NEB10ß || K || pSB3K3 || 1 ||<br />
|-<br />
|K1319001 in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319001 in I20260 || NEB10ß || K || pSB3K3 || 6 ||<br />
|-<br />
|K1319002 in I20260 || NEB10ß || K || pSB3K3 || 1 ||<br />
|-<br />
|K1319002 in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319002 in I20260 || NEB10ß || K || pSB3K3 || 6 ||<br />
|-<br />
|K1319001_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 4 ||<br />
|-<br />
|K1319001_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319001_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 6 ||<br />
|-<br />
|K1319002_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 3 ||<br />
|-<br />
|K1319002_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 4 ||<br />
|-<br />
|K1319002_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|His-SNAP-YFP-K1319003 || NEB10ß || A || pET17 || 3 ||<br />
|-<br />
|His-SNAP-YFP-K1319003 || NEB10ß || A || pET17 || 4 ||<br />
|-<br />
|His-SNAP-YFP-K1319003 || NEB10ß || A || pET17 || 6 ||<br />
|}<br />
</center><br />
<br />
Elution was performed twice with 15&nbsp;µL of nuclease free water each time.<br />
<br />
== 9th ==<br />
* made chips with K131026 in DH5α and NEB and without cells. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_09_09_2014_K131026_neb_agarose_serie.png|title=Sensor Chips with K131026 in DH5α in LB|subtitle=Sensor chips with K131026 in DH5α in LB medium with 1,5% agarose, right chip induced. A) befor induction with 1&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 1&nbsp;h after induction C) 1.5&nbsp;h after induction D) 2&nbsp;h after induction E) 2.5&nbsp;h after induction F) 3&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
== 10th ==<br />
* SDS page of REACh constructs after Gibson <br />
* plasmid prep of Gal3 YFP<br />
** #3: 20&nbsp;ng/µl<br />
** #4: 21.5&nbsp;ng/µl<br />
** #6: 15.9&nbsp;ng/µl<br />
<br />
== 15th ==<br />
analyze the sequencing data from the clones of GFP_Reach 1, GFP_Reach 2 and K1319008. <br />
<br />
GFP_Reach 2 clone #3 and #5 were fine, including the Leu to Ile mutation.<br />
GFP_Reach 1 clone #4 and #5 were fine and did not contain the Leu to Ile mutation. Clone #6 was fine but contained the Leu to Ile mutation from the Reach 1 quick change mutations. <br />
<br />
For future experiments, we will use the GFP_Reach 1 clone #4 and the GFP_Reach 2 clone #4.<br />
<br />
Transformation of GFP_Reach 1 clone #3 and GFP_Reach 2 clones #3 and #5 were performed together with the TEV protease to create two plasmid construct. <br />
<br />
The GFP_Reach 1 and GFP_Reach 2 constructs were also restricted and ligated into the pSB1C3 vector from the pSB3K3 vector.<br />
* over night cultures of K131026 in DH5α and NEB<br />
<br />
== 16th ==<br />
<br />
* made master plates of the transformation from the day before. <br />
* Also PCRs were made from pSBXA3, I20260 and K131900 for a Gibson assembly. The PCRs were checked with a gel electrophoresis.<br />
* made chips with K131026 in DH5α and NEB. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_16_09_2014_K131026_neb_serie.png|title=Sensor Chips with K131026 in NEB in LB|subtitle=Sensor chips with K131026 in NEB in LB medium with 1,5% agarose, right chip induced. A) 0.5&nbsp;h after induction with 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 1&nbsp;h after induction C) 1.5&nbsp;h after induction D) 2&nbsp;h after induction E) 2.5&nbsp;h after induction F) 3&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
== 17th ==<br />
<br />
* prepped and autoclaved 33 500&nbsp;mL shake flasks.<br />
<br />
== 18th ==<br />
* SDS page of REACh constructs with TEV and IPTG<br />
* over night cultures of K131026, B0015, K1319013, K1319014, K1319013 + K1319008 and K1319014 + K1319008 all in BL21<br />
* tested ''Pseudomonas fluoresence'' if they are suitable for a growth experiment that is planned for our collaboration with the NEAnderLab next week. Therefore, she filled 2 500&nbsp;mL flasks with 30&nbsp;mL LB Pseudomonas-F medium, and inoculated each one with 1&nbsp;mL culture medium of the overnight preculture. Flasks were inoculated at 30°C at 250&nbsp;rpm. However, after 5 hours no exponential growth could be shown (s. plot below). Thus, it was decided to use a ''E. coli'' K12 derivate strain in TB medium instead, and 30&nbsp;mL of TB medium in a 500&nbsp;mL flask were inoculated with ''E. coli'' DH5α cells and incubated at 37°C at 300 rpm over night. According to the [https://www.dsmz.de/catalogues/catalogue-microorganisms/groups-of-organisms-and-their-applications/strains-for-schools-and-universities.html DSMZ] ''E . coli'' K12 strain derivates, such as DH5α, are adequate for the kind of school experiment we are planning with the NEAnderLab.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-09-19_NEAnderLab_Test_Growth_Curves_of_Pf_in_LB_iNB.png|title=Growth Curves|subtitle=Unfortunately, ''P. fluorescens'' did not show a nice exponential growth curve over the observed 5 hours.|width=1000px}}<br />
</center><br />
<br />
== 19th ==<br />
* made flask cultures of K1319013, K1319013 + K1319008, K1319013 + K1319008 + iPTG, K1319014, K1319014 + K1319008, K1319014 + K1319008 + iPTG, B0015 (negative control) and I20260 (positive control). iPTG was added at an OD of ~0.5. Inoculation was done via precultures in 500 ml shake flasks (50 ml filling volume). Media was always LB. Cultivation was done at 37°C and 300&nbsp;rpm. The starting OD was aimed to be 0.1. Inoculation occured directly from the precultures. Samples were taken every hour and checked for OD and fluorescence using a spectrophotometer and plate reader, respectively.<br />
<br />
* did plasmid preparation from the cultures of the day before (K1319013, K1319013 + K1319008, K1319013 + K1319008 + iPTG, K1319014, K1319014 + K1319008, K1319014 + K1319008 + iPTG, B0015 and I20260). The plasmid were then be cut with EcoRI and PstI, and the results were be put on an agarose gel in order to perform a restriction test. Also plasmids of K1319013 and K1319014 will be cut with EcoRi and SpeI. K1319008 will be cut with XbaI and PstI. These will then be ligated together and then ligated into a pSB1A3 vector via the 3A assembly (vector cut with EcoRI and PstI). These constructs will be transformed into BL21 (and NEB as a backup). The created construts will be known as K1319018 (K1319013.K1319008) and K1319019 (K1319014.K1319008).<br />
<br />
* made precultures of the master plates from the day before (K1319008, K1319013, K1319015 and pSBX1A3 with Gal3).<br />
<br />
* also inoculated 4 cultures for the further testing of the OD/F Device (the F part). The cultures are 2 shake flasks of I20260 and 2 shake flasks of B0015. <br />
<br />
* Furthermore, did a growth experiment with DH5α for the NEAnderLab school experiment. 3 500&nbsp;mL shake flasks were filled with 50&nbsp;mL TB medium, and inoculated to an OD of 1.5 with the overnight preculture. Samples were taken every 30 minutes and tested for OD using our own device as well as the spectrophotometer. The resulting growth curve is shown below. we concluded that the growth was fast enough for these growth conditions to be used for the school experiment on the 24th. <br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-09-19_NEAnderLab_Test_Growth_Curves_in_TB_iNB.png|title=Growth Curves|subtitle=Growth under these conditions was sufficient for the school experiment to be carried in 5 hours. And our device did a good job measuring, too!|width=1000px}}<br />
</center><br />
<br />
* made chips with K1319013 + K1319008, K1319014 + K1319008, K1319013, K1319014, B0015 and K131026. Images were taken every 30 minutes with our own device.<br />
<br />
* tested our OD/F Device with a dilution test. Samples were checked with the spectrophotometer (OD), our OD/F Device (fluorescence) and platereader (fluorescence).<br />
<br />
* made two SDS gels. <br />
<br />
* inoculated a culture of K1319008, B0015 as well as I20260 to check whether the results from our construct are from a wrongly done Gibson assembly with a still functioning superfolded GFP (the TEV protease was inserted in a backbone that formely contained superfolded GFP.)<br />
<br />
== 20th ==<br />
* SDS page of REACh constructs with TEV protease and induced by IPTG<br />
<br />
== 22nd ==<br />
<br />
* we poured several Pseudomonas-F agar plates with 0, 150 and 300&nbsp;µg/L for the NEAnderLab school experiment. She also autoclaved 12 500&nbsp;mL shake flasks, partly to be used for the school collaboration on Wednesday.<br />
<br />
== 26th ==<br />
* We did a check PCR on several cryo cultures. All samples with G00100_Alternative+K1319004_check_R combinations resulted in a strong band at ~2300&nbsp;bp that we cannot explain. All G00100_Alternative+K1319004_check_R combinations resulted in a strong band at 900&nbsp;bp that we cannot explain either. We concluded that the annealing temperatures were wrong and favored unspecific products. Therefore, we decided to do a gradient PCR to find out the optimal annealing temperatures for our new primers.<br />
<br />
* Gradient PCR to test new primer:<br />
did gradient PCR with these new primers:<br />
<br />
<center><br />
{| class="wikitable"<br />
! name !! sequence<br />
|-<br />
| G00100_Alternative || GTGCCACCTGACGTCTAAGAAACCATTATTATC<br />
|-<br />
| G00101_Alternative || ATTACCGCCTTTGAGTGAGCTGATACCGCTCG<br />
|-<br />
| K1319004_check_R || ACGGAATTTCAGTTTCTGCGGGAACGGCGG<br />
|-<br />
| I746909_check_R || ATCTTTAGACAGAACGCTTTGCGTGCTCAG<br />
|}<br />
</center><br />
<br />
Three PCRs with different primer combinations were run. In all of them the templates were K1319004&nbsp;in pSB1C3, K1319008&nbsp;in&nbsp;pSB1C3 and I746909&nbsp;in&nbsp;pSB1C3.<br />
<br />
The first gradient PCR tested the G00100_Alternative + G00101_Alternative combination:<br />
<br />
<center><br />
{| class="wikitable"<br />
! primer_F !! primer_R !! template !! expected length !! best annealing temperature<br />
|-<br />
| G00100_Alternative || G00101_Alternative || K1319004&nbsp;in pSB1C3 || 1057 || ???<br />
|-<br />
| G00100_Alternative || G00101_Alternative || K1319008&nbsp;in&nbsp;pSB1C3 || 1245 || ???<br />
|-<br />
| G00100_Alternative || G00101_Alternative || I746909&nbsp;in&nbsp;pSB1C3 || 1221 || ???<br />
|-<br />
| G00100_Alternative || G00101_Alternative || water || --- || ???<br />
|}<br />
{{Team:Aachen/Figure|Aachen_14-09-26_gradientPCR_1.png|title=Gradient PCR 1|subtitle=the primers were G00100_Alternative and G00101_Alternative and they worked well at all temperatures from 55-65°C.|width=800px}}<br />
</center><br />
<br />
The second gradient PCR tested the G00100_Alternative + I746916_check_R combination:<br />
<center><br />
{| class="wikitable"<br />
! primer_F !! primer_R !! template !! expected length !! best annealing temperature<br />
|-<br />
| G00100_Alternative || I746916_check_R || K1319004&nbsp;in pSB1C3 || none || ???<br />
|-<br />
| G00100_Alternative || I746916_check_R || K1319008&nbsp;in&nbsp;pSB1C3 || none || ???<br />
|-<br />
| G00100_Alternative || I746916_check_R || I746909&nbsp;in&nbsp;pSB1C3 || 820 || ???<br />
|-<br />
| G00100_Alternative || I746916_check_R || water || --- || ???<br />
|}<br />
{{Team:Aachen/Figure|Aachen_14-09-26_gradientPCR_2.png|title=Gradient PCR 2|subtitle=the primers were G00100_Alternative and I746916_check_R and they worked well at all temperatures from 55-65°C. Apparently the K1319008 template contained I746916.|width=800px}}<br />
</center><br />
<br />
The third gradient PCR tested the G00100_Alternative + K1319004_check_R combination:<br />
<center><br />
{| class="wikitable"<br />
! primer_F !! primer_R !! template !! expected length !! best annealing temperature<br />
|-<br />
| G00100_Alternative || K1319004_check_R || K1319004&nbsp;in pSB1C3 || 541 || ???<br />
|-<br />
| G00100_Alternative || K1319004_check_R || K1319008&nbsp;in&nbsp;pSB1C3 || 502 || ???<br />
|-<br />
| G00100_Alternative || K1319004_check_R || I746909&nbsp;in&nbsp;pSB1C3 || none || ???<br />
|-<br />
| G00100_Alternative || K1319004_check_R || water || --- || ???<br />
|}<br />
{{Team:Aachen/Figure|Aachen_14-09-26_gradientPCR_3.png|title=Gradient PCR 3|subtitle=The primers were G00100_Alternative and K1319004_check_R and they worked well at all temperatures from 60-68°C. To our disappointment, the K1319008 template did not contain K1319004. It is unclear why the 5 bands of K1319008 and I746916 look different.|width=800px}}<br />
</center><br />
<br />
The results of these three PCRs are:<br />
# KAPA2G Fast ReadyMix worked well<br />
# all three primers work well at >65°C annealing temperature<br />
# K1319008 template contained I746916 instead of the intended K1319004 ORF<br />
<br />
It was concluded that a similar check PCR with 65°C annealing temperature will be done on all plasmids and cryos of K1319008.<br />
<br />
== 27th ==<br />
* First we transformed K1319001, K1319002, K1319003 and K1319004 (all in pSB1C3) into NEB10β cells. He tested the PCR machine for semi-automated heat-shocking by splitting the 50&nbsp;µL cells with the plasmid into 2x 25&nbsp;µL. All 100&nbsp;µL were plated for all construct/machine combinations.<br />
<br />
* transformed several constructs into chemically competent BL21(DE3) cells.<br />
<br />
* we did colony-PCR on all plasmids, cryos and colonies that should contain the K1319004 sequence.<br />
<br />
* we also made check a PCR on galectin-constructs:<br />
<center><br />
{| class="wikitable"<br />
! label !! primer_F !! primer_R !! expected length !! result<br />
|-<br />
| Gal3 in pSBX1A3 #1 || G00100_Alternative || K1319003_R || 1684 || ???<br />
|-<br />
| Gal3 in pSBX1A3 #2 || G00100_Alternative || K1319003_R || 1684 || ???<br />
|-<br />
| Gal3 in pSBX1A3 #3 || G00100_Alternative || K1319003_R || 1684 || ???<br />
|-<br />
| Gal3 YFP #3 || pETGal3_seq_F || K1319003_R || 867 || ???<br />
|-<br />
| Gal3 YFP #3 || pETGal3_seq_F || K1319003_R || 867 || ???<br />
|-<br />
| Gal3 YFP pet17 AmpR || pETGal3_seq_F || K1319003_R || 867 or none || ???<br />
|-<br />
| pET17 Gal3 #1 || pETGal3_seq_F || K1319003_R || none || ???<br />
|-<br />
| K1319003 in pSB1C3 || G00100_Alternative || K1319003_R || 930 || ???<br />
|}<br />
</center><br />
<br />
== 28th ==<br />
* made a restriction of BioBrick K1319020 and vector pSB1C3 with restriction enzymes EcoRI and PstI. Then we ligated the restricted parts and made a transformation using ''E. coli'' NEB 10ß cells.<br />
<br />
== 29th ==<br />
<br />
* made cryo cultures and plasmid preparation of K1319010, K1319011, K1319012, K1319021 and K1319042. We determined the contentration of plasmids and made did a restriction digest of K1319010, K1319011, K1319012, pSB1C3, K1319021, K1319013 and K1319014, followed by a ligation in K1319010.pSB1C3, K1319011.pSB1C3, K1319012.pSB1C3, K1319021.K1319013.pSB1A3 and K1319021.K1319013.pSB1A3. All constructs were transformed into ''E. coli'' NEB 10ß.<br />
<br />
* prepared 3 500&nbsp;mL flasks with 30&nbsp;mL LB medium which were inoculated with a ''Pseudomonas putida'' strain. The cells were cultured over night at 28°C and ~300&nbsp;rpm. The cultures are supposed to be used to test our OD device.<br />
<br />
== 30th ==<br />
<br />
* Sequencing samples were sent in for K1319020 clone #2, 3 & 5 (in pSB1C3), K1319017 clone #1 (in pSB1C3), K1319010 clone #2 (in pSB3K3), K1319011 clone #1 (in pSB3K3), K1319012 clone #2 (in pSB3K3), K1319013 clone #1 (in pSB1C3), K1319014 clone #1 (in pSB1C3), K1319001 (in pSB1C3) and K1319002 (in pSB1C3). <br />
<br />
* A plasmid prep of K1319013 and K1319014 was run.<br />
<br />
* A Gibson assembly with the K1319015 from the I20260 backbone and the K1319000 insert, forming K3139015, was conducted. The product was subsequently transformed into NEB10β cells. <br />
<br />
* The pSB1C3 plasmid backbones were amplified via PCR and purified.<br />
<br />
* Colony-PCRs of K1319008 and K1319012 master plates were made to confirm the colony's identity. Subsequently, pre-cultures were inoculated. <br />
<br />
* A transformation of K1319010 and K1319010 in pSB1C3 was conducted.<br />
<br />
* Another plasmid prep of K1319010 clone #2, K1319011 clone #1, K1319012 clone #2 (all in pSB3K3), K1319013 clone #4, K1319014 #3, K139020 #2, 3, 5 (all in pSB1C3) was run.<br />
<br />
* The OD device was tested with a dilution series of a ''Pseudomonas putida'' culture.<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
== References ==<br />
[1] Kupper CE, Böcker S, Liu H, et al. Fluorescent SNAP-tag galectin fusion proteins as novel tools in glycobiology. Curr Pharm Des. 2013;19(30):5457-67. Available at: http://www.ncbi.nlm.nih.gov/pubmed/23431989.<br />
<br />
<br />
<br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/SeptemberTeam:Aachen/Notebook/Wetlab/September2014-10-17T22:57:35Z<p>VeraA: </p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= September =<br />
== 1st ==<br />
* 5&nbsp;ml cultures of K1319003 and K1319004<br />
* plasmid prep<br />
<center><br />
{| class="wikitable"<br />
|-<br />
! Plasmid !! DNA [ng/µl] <br />
|-<br />
| J23101.K516032 pSB1K3|| 23.5<br />
|-<br />
| J23115.K516032 pSB1K3|| 20.5<br />
|-<br />
| J04450 pSB1A3|| 57.5<br />
|-<br />
| J04450 pSB1K1|| 63.5<br />
|} </center><br />
* over night cultures of K131026 in DH5α and NEB<br />
<br />
== 2nd ==<br />
* made chips with K131026 in DH5α and NEB. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_02_09_2014_K131026_dh5a_serie.png|title=Sensor Chips with K131026 in DH5α in LB taken with the second version of our own device|subtitle=Sensor chips with K131026 in DH5α in LB medium with 1,5% agarose, right chip induced. A) befor induction with 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 0.5&nbsp;h after induction C) 1&nbsp;h after induction D) 1.5&nbsp;h after induction E) 2.5&nbsp;h after induction F) 3&nbsp;h after induction|width=900px}}<br />
</center><br />
* gel purification of vector backbones <br />
* sent to sequencing:<br />
** K1318003<br />
** K1319004<br />
** J23101.K516032 <br />
** J23115.K516032<br />
<br />
== 3rd ==<br />
* prepared 50&nbsp;mL LB+antibiotic overnight-cultures of pSBX-vectors that were sent in by team Heidelberg.<br />
<br />
== 4th ==<br />
* In the morning, at 10:15, we inoculated the precultures for the interlab study experiment.<br />
* prepared cryo stocks of the pSBX-carrying ''E.&nbsp;coli'' from the overnight cultures. He also purified each pSBX-vector, eluting with 15+30&nbsp;µL water, and resulting in the following DNA concentrations:<br />
<br />
<center><br />
{| class="wikitable"<br />
! vector !! concentration [ng/µL]<br />
|-<br />
| pSBX1A3 || 111<br />
|-<br />
| pSBX4A5 || 14.1<br />
|-<br />
| pSBX1C3 || 31<br />
|-<br />
| pSB4C5 || 98.5<br />
|-<br />
| pSBX1K3 || 18<br />
|-<br />
| pSBX4K5 || 30<br />
|-<br />
| pSBX1T3 || 39<br />
|-<br />
| constitutive expression plasmid || 73<br />
|}<br />
</center><br />
<br />
* PCRs for Gibson assembly of K1319003 into pET17. Duplicates of 25&nbsp;µL reaction volume (12.5&nbsp;µL Q5 2x Master Mix, 1.25&nbsp;µL per primer, 2&nbsp;µL template)<br />
<center><br />
{| class="wikitable"<br />
! PCR tube # !! components<br />
|-<br />
| 1 and 2 || pET17 + pET17_Gal3_Gib_F + pET17_Gal3_Gib_R<br />
|-<br />
| 3 and 4 || K1319003 + K1319003_Gib_F + K1319003_Gib_R<br />
|-<br />
|}<br />
</center><br />
<br />
The PCR conditions:<br />
<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
|-<br />
| denature || 98 || 30", 98°C for 10", 55°C for 30", 72°C for 2'15"<br />
|-<br />
| denature || 98 || 10"<br />
|-<br />
| anneal || 50 (insert) 55 (backbone) || 30"<br />
|-<br />
| elongate || 72 || 0'30" (insert) 2'15" (backbone)<br />
|-<br />
| elongate || 72 || 2"<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
<br />
* Finally, we did the Gibson assembly and a heat shock transformation into NEB10β cells.<br />
<br />
* At 10:15, we inoculated the primary cultures of the interlab study experiment and began with regular fluorescence measurements.<br />
<br />
== 5th ==<br />
* made master plates of yesterday's transformed cells.<br />
* As described in the article by Elling [1], Gal3 binds on the LPS of '''Pseudomonas aeruginosa'''.<br />
To demonstrate this behavior several experiments were conducted. The experiments included the binding of Gal3 to Saccharomyces cerevisiae, E.coli, Pseudomonas putida and Pseudomonas aeruginosa. The precultures were washed two times in PBS, resuspended in 10 and 50 ng/ml of YFP-Gal3 and then incubated for 1 h at room temperature. Afterwards, all samples were examined in the fluorescence microscope. As a positive control NEB10ß cells with E0030 were used. Unfortunatly, a fluorescence was not visually detectable, with exception of the positive control.<br />
<br />
== 6th ==<br />
* made precultures of 3 clones from each prepared master palte and inoculated precultures for OD/F measurements as well as chip production on the 7th.<br />
<br />
== 7th ==<br />
* made cryos stocks of the precultures<br />
* made chips with K131026 in DH5α and NEB and B0015 in NEB. Images were taken every 30 min with our own device <br />
<center><br />
{{Team:Aachen/Figure|Aachen_07_09_2014_B0015_neb_serie.png|title=Sensor Chips with B0015 in NEB (negativ control) in TB taken with the second version of our own device|subtitle=Sensor chips with B0015 in NEB in TB medium with 1,5% agar, right chip induced. A) befor induction with 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 0&nbsp;h after induction C) 0.5&nbsp;h after induction D) 1&nbsp;h after induction E) 2&nbsp;h after induction F) 2.5&nbsp;h after induction|width=900px}}<br />
</center><br />
* purification of the following plasmids:<br />
<br />
<center><br />
{| class="wikitable"<br />
! plasmid !! strain !! resistance !! vector !! # of clone picked !! concentration [ng/µl]<br />
|-<br />
|K1319000 in I20260 || NEB10ß || K || pSB3K3 || 1 ||<br />
|-<br />
|K1319000 in I20260 || NEB10ß || K || pSB3K3 || 3 ||<br />
|-<br />
|K1319000 in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319001 in I20260 || NEB10ß || K || pSB3K3 || 1 ||<br />
|-<br />
|K1319001 in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319001 in I20260 || NEB10ß || K || pSB3K3 || 6 ||<br />
|-<br />
|K1319002 in I20260 || NEB10ß || K || pSB3K3 || 1 ||<br />
|-<br />
|K1319002 in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319002 in I20260 || NEB10ß || K || pSB3K3 || 6 ||<br />
|-<br />
|K1319001_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 4 ||<br />
|-<br />
|K1319001_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319001_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 6 ||<br />
|-<br />
|K1319002_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 3 ||<br />
|-<br />
|K1319002_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 4 ||<br />
|-<br />
|K1319002_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|His-SNAP-YFP-K1319003 || NEB10ß || A || pET17 || 3 ||<br />
|-<br />
|His-SNAP-YFP-K1319003 || NEB10ß || A || pET17 || 4 ||<br />
|-<br />
|His-SNAP-YFP-K1319003 || NEB10ß || A || pET17 || 6 ||<br />
|}<br />
</center><br />
<br />
Elution was performed twice with 15&nbsp;µL of nuclease free water each time.<br />
<br />
== 9th ==<br />
* made chips with K131026 in DH5α and NEB and without cells. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_09_09_2014_K131026_neb_agarose_serie.png|title=Sensor Chips with K131026 in DH5α in LB|subtitle=Sensor chips with K131026 in DH5α in LB medium with 1,5% agarose, right chip induced. A) befor induction with 1&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 1&nbsp;h after induction C) 1.5&nbsp;h after induction D) 2&nbsp;h after induction E) 2.5&nbsp;h after induction F) 3&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
== 10th ==<br />
* SDS page of REACh constructs after Gibson <br />
* plasmid prep of Gal3 YFP<br />
** #3: 20&nbsp;ng/µl<br />
** #4: 21.5&nbsp;ng/µl<br />
** #6: 15.9&nbsp;ng/µl<br />
<br />
== 15th ==<br />
analyze the sequencing data from the clones of GFP_Reach 1, GFP_Reach 2 and K1319008. <br />
<br />
GFP_Reach 2 clone #3 and #5 were fine, including the Leu to Ile mutation.<br />
GFP_Reach 1 clone #4 and #5 were fine and did not contain the Leu to Ile mutation. Clone #6 was fine but contained the Leu to Ile mutation from the Reach 1 quick change mutations. <br />
<br />
For future experiments, we will use the GFP_Reach 1 clone #4 and the GFP_Reach 2 clone #4.<br />
<br />
Transformation of GFP_Reach 1 clone #3 and GFP_Reach 2 clones #3 and #5 were performed together with the TEV protease to create two plasmid construct. <br />
<br />
The GFP_Reach 1 and GFP_Reach 2 constructs were also restricted and ligated into the pSB1C3 vector from the pSB3K3 vector.<br />
* over night cultures of K131026 in DH5α and NEB<br />
<br />
== 16th ==<br />
<br />
* made master plates of the transformation from the day before. <br />
* Also PCRs were made from pSBXA3, I20260 and K131900 for a Gibson assembly. The PCRs were checked with a gel electrophoresis.<br />
* made chips with K131026 in DH5α and NEB. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_16_09_2014_K131026_neb_serie.png|title=Sensor Chips with K131026 in NEB in LB|subtitle=Sensor chips with K131026 in NEB in LB medium with 1,5% agarose, right chip induced. A) 0.5&nbsp;h after induction with 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 1&nbsp;h after induction C) 1.5&nbsp;h after induction D) 2&nbsp;h after induction E) 2.5&nbsp;h after induction F) 3&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
== 17th ==<br />
<br />
* prepped and autoclaved 33 500&nbsp;mL shake flasks.<br />
<br />
== 18th ==<br />
* SDS page of REACh constructs with TEV and IPTG<br />
* over night cultures of K131026, B0015, K1319013, K1319014, K1319013 + K1319008 and K1319014 + K1319008 all in BL21<br />
* tested ''Pseudomonas fluoresence'' if they are suitable for a growth experiment that is planned for our collaboration with the NEAnderLab next week. Therefore, she filled 2 500&nbsp;mL flasks with 30&nbsp;mL LB Pseudomonas-F medium, and inoculated each one with 1&nbsp;mL culture medium of the overnight preculture. Flasks were inoculated at 30°C at 250&nbsp;rpm. However, after 5 hours no exponential growth could be shown (s. plot below). Thus, it was decided to use a ''E. coli'' K12 derivate strain in TB medium instead, and 30&nbsp;mL of TB medium in a 500&nbsp;mL flask were inoculated with ''E. coli'' DH5α cells and incubated at 37°C at 300 rpm over night. According to the [https://www.dsmz.de/catalogues/catalogue-microorganisms/groups-of-organisms-and-their-applications/strains-for-schools-and-universities.html DSMZ] ''E . coli'' K12 strain derivates, such as DH5α, are adequate for the kind of school experiment we are planning with the NEAnderLab.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-09-19_NEAnderLab_Test_Growth_Curves_of_Pf_in_LB_iNB.png|title=Growth Curves|subtitle=Unfortunately, ''P. fluorescens'' did not show a nice exponential growth curve over the observed 5 hours.|width=1000px}}<br />
</center><br />
<br />
== 19th ==<br />
* made flask cultures of K1319013, K1319013 + K1319008, K1319013 + K1319008 + iPTG, K1319014, K1319014 + K1319008, K1319014 + K1319008 + iPTG, B0015 (negative control) and I20260 (positive control). iPTG was added at an OD of ~0.5. Inoculation was done via precultures in 500 ml shake flasks (50 ml filling volume). Media was always LB. Cultivation was done at 37°C and 300&nbsp;rpm. The starting OD was aimed to be 0.1. Inoculation occured directly from the precultures. Samples were taken every hour and checked for OD and fluorescence using a spectrophotometer and plate reader, respectively.<br />
<br />
* did plasmid preparation from the cultures of the day before (K1319013, K1319013 + K1319008, K1319013 + K1319008 + iPTG, K1319014, K1319014 + K1319008, K1319014 + K1319008 + iPTG, B0015 and I20260). The plasmid were then be cut with EcoRI and PstI, and the results were be put on an agarose gel in order to perform a restriction test. Also plasmids of K1319013 and K1319014 will be cut with EcoRi and SpeI. K1319008 will be cut with XbaI and PstI. These will then be ligated together and then ligated into a pSB1A3 vector via the 3A assembly (vector cut with EcoRI and PstI). These constructs will be transformed into BL21 (and NEB as a backup). The created construts will be known as K1319018 (K1319013.K1319008) and K1319019 (K1319014.K1319008).<br />
<br />
* made precultures of the master plates from the day before (K1319008, K1319013, K1319015 and pSBX1A3 with Gal3).<br />
<br />
* also inoculated 4 cultures for the further testing of the OD/F Device (the F part). The cultures are 2 shake flasks of I20260 and 2 shake flasks of B0015. <br />
<br />
* Furthermore, did a growth experiment with DH5α for the NEAnderLab school experiment. 3 500&nbsp;mL shake flasks were filled with 50&nbsp;mL TB medium, and inoculated to an OD of 1.5 with the overnight preculture. Samples were taken every 30 minutes and tested for OD using our own device as well as the spectrophotometer. The resulting growth curve is shown below. we concluded that the growth was fast enough for these growth conditions to be used for the school experiment on the 24th. <br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-09-19_NEAnderLab_Test_Growth_Curves_in_TB_iNB.png|title=Growth Curves|subtitle=Growth under these conditions was sufficient for the school experiment to be carried in 5 hours. And our device did a good job measuring, too!|width=1000px}}<br />
</center><br />
<br />
* made chips with K1319013 + K1319008, K1319014 + K1319008, K1319013, K1319014, B0015 and K131026. Images were taken every 30 minutes with our own device.<br />
<br />
* tested our OD/F Device with a dilution test. Samples were checked with the spectrophotometer (OD), our OD/F Device (fluorescence) and platereader (fluorescence).<br />
<br />
* made two SDS gels. <br />
<br />
* inoculated a culture of K1319008, B0015 as well as I20260 to check whether the results from our construct are from a wrongly done Gibson assembly with a still functioning superfolded GFP (the TEV protease was inserted in a backbone that formely contained superfolded GFP.)<br />
<br />
== 20th ==<br />
* SDS page of REACh constructs with TEV protease and induced by IPTG<br />
<br />
== 22nd ==<br />
<br />
* we poured several Pseudomonas-F agar plates with 0, 150 and 300&nbsp;µg/L for the NEAnderLab school experiment. She also autoclaved 12 500&nbsp;mL shake flasks, partly to be used for the school collaboration on Wednesday.<br />
<br />
== 26th ==<br />
* We did a check PCR on several cryo cultures. All samples with G00100_Alternative+K1319004_check_R combinations resulted in a strong band at ~2300&nbsp;bp that we cannot explain. All G00100_Alternative+K1319004_check_R combinations resulted in a strong band at 900&nbsp;bp that we cannot explain either. We concluded that the annealing temperatures were wrong and favored unspecific products. Therefore, we decided to do a gradient PCR to find out the optimal annealing temperatures for our new primers.<br />
<br />
* Gradient PCR to test new primer:<br />
did gradient PCR with these new primers:<br />
<br />
<center><br />
{| class="wikitable"<br />
! name !! sequence<br />
|-<br />
| G00100_Alternative || GTGCCACCTGACGTCTAAGAAACCATTATTATC<br />
|-<br />
| G00101_Alternative || ATTACCGCCTTTGAGTGAGCTGATACCGCTCG<br />
|-<br />
| K1319004_check_R || ACGGAATTTCAGTTTCTGCGGGAACGGCGG<br />
|-<br />
| I746909_check_R || ATCTTTAGACAGAACGCTTTGCGTGCTCAG<br />
|}<br />
</center><br />
<br />
Three PCRs with different primer combinations were run. In all of them the templates were K1319004&nbsp;in pSB1C3, K1319008&nbsp;in&nbsp;pSB1C3 and I746909&nbsp;in&nbsp;pSB1C3.<br />
<br />
The first gradient PCR tested the G00100_Alternative + G00101_Alternative combination:<br />
<br />
<center><br />
{| class="wikitable"<br />
! primer_F !! primer_R !! template !! expected length !! best annealing temperature<br />
|-<br />
| G00100_Alternative || G00101_Alternative || K1319004&nbsp;in pSB1C3 || 1057 || ???<br />
|-<br />
| G00100_Alternative || G00101_Alternative || K1319008&nbsp;in&nbsp;pSB1C3 || 1245 || ???<br />
|-<br />
| G00100_Alternative || G00101_Alternative || I746909&nbsp;in&nbsp;pSB1C3 || 1221 || ???<br />
|-<br />
| G00100_Alternative || G00101_Alternative || water || --- || ???<br />
|}<br />
{{Team:Aachen/Figure|Aachen_14-09-26_gradientPCR_1.png|title=Gradient PCR 1|subtitle=the primers were G00100_Alternative and G00101_Alternative and they worked well at all temperatures from 55-65°C.|width=800px}}<br />
</center><br />
<br />
The second gradient PCR tested the G00100_Alternative + I746916_check_R combination:<br />
<center><br />
{| class="wikitable"<br />
! primer_F !! primer_R !! template !! expected length !! best annealing temperature<br />
|-<br />
| G00100_Alternative || I746916_check_R || K1319004&nbsp;in pSB1C3 || none || ???<br />
|-<br />
| G00100_Alternative || I746916_check_R || K1319008&nbsp;in&nbsp;pSB1C3 || none || ???<br />
|-<br />
| G00100_Alternative || I746916_check_R || I746909&nbsp;in&nbsp;pSB1C3 || 820 || ???<br />
|-<br />
| G00100_Alternative || I746916_check_R || water || --- || ???<br />
|}<br />
{{Team:Aachen/Figure|Aachen_14-09-26_gradientPCR_2.png|title=Gradient PCR 2|subtitle=the primers were G00100_Alternative and I746916_check_R and they worked well at all temperatures from 55-65°C. Apparently the K1319008 template contained I746916.|width=800px}}<br />
</center><br />
<br />
The third gradient PCR tested the G00100_Alternative + K1319004_check_R combination:<br />
<center><br />
{| class="wikitable"<br />
! primer_F !! primer_R !! template !! expected length !! best annealing temperature<br />
|-<br />
| G00100_Alternative || K1319004_check_R || K1319004&nbsp;in pSB1C3 || 541 || ???<br />
|-<br />
| G00100_Alternative || K1319004_check_R || K1319008&nbsp;in&nbsp;pSB1C3 || 502 || ???<br />
|-<br />
| G00100_Alternative || K1319004_check_R || I746909&nbsp;in&nbsp;pSB1C3 || none || ???<br />
|-<br />
| G00100_Alternative || K1319004_check_R || water || --- || ???<br />
|}<br />
{{Team:Aachen/Figure|Aachen_14-09-26_gradientPCR_3.png|title=Gradient PCR 3|subtitle=The primers were G00100_Alternative and K1319004_check_R and they worked well at all temperatures from 60-68°C. To our disappointment, the K1319008 template did not contain K1319004. It is unclear why the 5 bands of K1319008 and I746916 look different.|width=800px}}<br />
</center><br />
<br />
The results of these three PCRs are:<br />
# KAPA2G Fast ReadyMix worked well<br />
# all three primers work well at >65°C annealing temperature<br />
# K1319008 template contained I746916 instead of the intended K1319004 ORF<br />
<br />
It was concluded that a similar check PCR with 65°C annealing temperature will be done on all plasmids and cryos of K1319008.<br />
<br />
== 27th ==<br />
* First we transformed K1319001, K1319002, K1319003 and K1319004 (all in pSB1C3) into NEB10β cells. He tested the PCR machine for semi-automated heat-shocking by splitting the 50&nbsp;µL cells with the plasmid into 2x 25&nbsp;µL. All 100&nbsp;µL were plated for all construct/machine combinations.<br />
<br />
* transformed several constructs into chemically competent BL21(DE3) cells.<br />
<br />
* we did colony-PCR on all plasmids, cryos and colonies that should contain the K1319004 sequence.<br />
<br />
* we also made check a PCR on galectin-constructs:<br />
<center><br />
{| class="wikitable"<br />
! label !! primer_F !! primer_R !! expected length !! result<br />
|-<br />
| Gal3 in pSBX1A3 #1 || G00100_Alternative || K1319003_R || 1684 || ???<br />
|-<br />
| Gal3 in pSBX1A3 #2 || G00100_Alternative || K1319003_R || 1684 || ???<br />
|-<br />
| Gal3 in pSBX1A3 #3 || G00100_Alternative || K1319003_R || 1684 || ???<br />
|-<br />
| Gal3 YFP #3 || pETGal3_seq_F || K1319003_R || 867 || ???<br />
|-<br />
| Gal3 YFP #3 || pETGal3_seq_F || K1319003_R || 867 || ???<br />
|-<br />
| Gal3 YFP pet17 AmpR || pETGal3_seq_F || K1319003_R || 867 or none || ???<br />
|-<br />
| pET17 Gal3 #1 || pETGal3_seq_F || K1319003_R || none || ???<br />
|-<br />
| K1319003 in pSB1C3 || G00100_Alternative || K1319003_R || 930 || ???<br />
|}<br />
</center><br />
<br />
== 28th ==<br />
* made a restriction of BioBrick K1319020 and vector pSB1C3 with restriction enzymes EcoRI and PstI. Then we ligated the restricted parts and made a transformation using ''E. coli'' NEB 10ß cells.<br />
<br />
== 29th ==<br />
<br />
* made cryo cultures and plasmid preparation of K1319010, K1319011, K1319012, K1319021 and K1319042. We determined the contentration of plasmids and made did a restriction digest of K1319010, K1319011, K1319012, pSB1C3, K1319021, K1319013 and K1319014, followed by a ligation in K1319010.pSB1C3, K1319011.pSB1C3, K1319012.pSB1C3, K1319021.K1319013.pSB1A3 and K1319021.K1319013.pSB1A3. All constructs were transformed into ''E. coli'' NEB 10ß.<br />
<br />
* prepared 3 500&nbsp;mL flasks with 30&nbsp;mL LB medium which were inoculated with a ''Pseudomonas putida'' strain. The cells were cultured over night at 28°C and ~300&nbsp;rpm. The cultures are supposed to be used to test our OD device.<br />
<br />
== 30th ==<br />
<br />
* Sequencing samples were sent in for K1319020 clone #2, 3 & 5 (in pSB1C3), K1319017 clone #1 (in pSB1C3), K1319010 clone #2 (in pSB3K3), K1319011 clone #1 (in pSB3K3), K1319012 clone #2 (in pSB3K3), K1319013 clone #1 (in pSB1C3), K1319014 clone #1 (in pSB1C3), K1319001 (in pSB1C3) and K1319002 (in pSB1C3). <br />
<br />
* A plasmid prep of K1319013 and K1319014 was run.<br />
<br />
* A Gibson assembly with the K1319015 from the I20260 backbone and the K1319000 insert, forming K3139015, was conducted. The product was subsequently transformed into NEB10β cells. <br />
<br />
* The pSB1C3 plasmid backbones were amplified via PCR and purified.<br />
<br />
* Colony-PCRs of K1319008 and K1319012 master plates were made to confirm the colony's identity. Subsequently, pre-cultures were inoculated. <br />
<br />
* A transformation of K1319010 and K1319010 in pSB1C3 was conducted.<br />
<br />
* Another plasmid prep of K1319010 clone #2, K1319011 clone #1, K1319012 clone #2 (all in pSB3K3), K1319013 clone #4, K1319014 #3, K139020 #2, 3, 5 (all in pSB1C3) was run.<br />
<br />
* The OD device was tested with a dilution series of a ''Pseudomonas putida'' culture.<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
== References ==<br />
[1] Kupper CE, Böcker S, Liu H, et al. Fluorescent SNAP-tag galectin fusion proteins as novel tools in glycobiology. Curr Pharm Des. 2013;19(30):5457-67. Available at: http://www.ncbi.nlm.nih.gov/pubmed/23431989.<br />
<br />
<br />
<br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/SeptemberTeam:Aachen/Notebook/Wetlab/September2014-10-17T22:56:02Z<p>VeraA: /* 5th */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= September =<br />
== 1st ==<br />
* 5&nbsp;ml cultures of K1319003 and K1319004<br />
* plasmid prep<br />
<center><br />
{| class="wikitable"<br />
|-<br />
! Plasmid !! DNA [ng/µl] <br />
|-<br />
| J23101.K516032 pSB1K3|| 23.5<br />
|-<br />
| J23115.K516032 pSB1K3|| 20.5<br />
|-<br />
| J04450 pSB1A3|| 57.5<br />
|-<br />
| J04450 pSB1K1|| 63.5<br />
|} </center><br />
* over night cultures of K131026 in DH5α and NEB<br />
<br />
== 2nd ==<br />
* made chips with K131026 in DH5α and NEB. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_02_09_2014_K131026_dh5a_serie.png|title=Sensor Chips with K131026 in DH5α in LB taken with the second version of our own device|subtitle=Sensor chips with K131026 in DH5α in LB medium with 1,5% agarose, right chip induced. A) befor induction with 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 0.5&nbsp;h after induction C) 1&nbsp;h after induction D) 1.5&nbsp;h after induction E) 2.5&nbsp;h after induction F) 3&nbsp;h after induction|width=900px}}<br />
</center><br />
* gel purification of vector backbones <br />
* sent to sequencing:<br />
** K1318003<br />
** K1319004<br />
** J23101.K516032 <br />
** J23115.K516032<br />
<br />
== 3rd ==<br />
* prepared 50&nbsp;mL LB+antibiotic overnight-cultures of pSBX-vectors that were sent in by team Heidelberg.<br />
<br />
== 4th ==<br />
* In the morning, at 10:15, we inoculated the precultures for the interlab study experiment.<br />
* prepared cryo stocks of the pSBX-carrying ''E.&nbsp;coli'' from the overnight cultures. He also purified each pSBX-vector, eluting with 15+30&nbsp;µL water, and resulting in the following DNA concentrations:<br />
<br />
<center><br />
{| class="wikitable"<br />
! vector !! concentration [ng/µL]<br />
|-<br />
| pSBX1A3 || 111<br />
|-<br />
| pSBX4A5 || 14.1<br />
|-<br />
| pSBX1C3 || 31<br />
|-<br />
| pSB4C5 || 98.5<br />
|-<br />
| pSBX1K3 || 18<br />
|-<br />
| pSBX4K5 || 30<br />
|-<br />
| pSBX1T3 || 39<br />
|-<br />
| constitutive expression plasmid || 73<br />
|}<br />
</center><br />
<br />
* PCRs for Gibson assembly of K1319003 into pET17. Duplicates of 25&nbsp;µL reaction volume (12.5&nbsp;µL Q5 2x Master Mix, 1.25&nbsp;µL per primer, 2&nbsp;µL template)<br />
<center><br />
{| class="wikitable"<br />
! PCR tube # !! components<br />
|-<br />
| 1 and 2 || pET17 + pET17_Gal3_Gib_F + pET17_Gal3_Gib_R<br />
|-<br />
| 3 and 4 || K1319003 + K1319003_Gib_F + K1319003_Gib_R<br />
|-<br />
|}<br />
</center><br />
<br />
The PCR conditions:<br />
<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
|-<br />
| denature || 98 || 30", 98°C for 10", 55°C for 30", 72°C for 2'15"<br />
|-<br />
| denature || 98 || 10"<br />
|-<br />
| anneal || 50 (insert) 55 (backbone) || 30"<br />
|-<br />
| elongate || 72 || 0'30" (insert) 2'15" (backbone)<br />
|-<br />
| elongate || 72 || 2"<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
<br />
* Finally, we did the Gibson assembly and a heat shock transformation into NEB10β cells.<br />
<br />
* At 10:15, we inoculated the primary cultures of the interlab study experiment and began with regular fluorescence measurements.<br />
<br />
== 5th ==<br />
* made master plates of yesterday's transformed cells.<br />
* As described in the article by Elling [1], Gal3 binds on the LPS of '''Pseudomonas aeruginosa'''.<br />
To demonstrate this behavior several experiments were conducted. The experiments included the binding of Gal3 to Saccharomyces cerevisiae, E.coli, Pseudomonas putida and Pseudomonas aeruginosa. The precultures were washed two times in PBS, resuspended in 10 and 50 ng/ml of YFP-Gal3 and then incubated for 1 h at room temperature. Afterwards, all samples were examined in the fluorescence microscope. As a positive control NEB10ß cells with E0030 were used. Unfortunatly, a fluorescence was not visually detectable, with exception of the positive control.<br />
<br />
== 6th ==<br />
* made precultures of 3 clones from each prepared master palte and inoculated precultures for OD/F measurements as well as chip production on the 7th.<br />
<br />
== 7th ==<br />
* made cryos stocks of the precultures<br />
* made chips with K131026 in DH5α and NEB and B0015 in NEB. Images were taken every 30 min with our own device <br />
<center><br />
{{Team:Aachen/Figure|Aachen_07_09_2014_B0015_neb_serie.png|title=Sensor Chips with B0015 in NEB (negativ control) in TB taken with the second version of our own device|subtitle=Sensor chips with B0015 in NEB in TB medium with 1,5% agar, right chip induced. A) befor induction with 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 0&nbsp;h after induction C) 0.5&nbsp;h after induction D) 1&nbsp;h after induction E) 2&nbsp;h after induction F) 2.5&nbsp;h after induction|width=900px}}<br />
</center><br />
* purification of the following plasmids:<br />
<br />
<center><br />
{| class="wikitable"<br />
! plasmid !! strain !! resistance !! vector !! # of clone picked !! concentration [ng/µl]<br />
|-<br />
|K1319000 in I20260 || NEB10ß || K || pSB3K3 || 1 ||<br />
|-<br />
|K1319000 in I20260 || NEB10ß || K || pSB3K3 || 3 ||<br />
|-<br />
|K1319000 in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319001 in I20260 || NEB10ß || K || pSB3K3 || 1 ||<br />
|-<br />
|K1319001 in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319001 in I20260 || NEB10ß || K || pSB3K3 || 6 ||<br />
|-<br />
|K1319002 in I20260 || NEB10ß || K || pSB3K3 || 1 ||<br />
|-<br />
|K1319002 in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319002 in I20260 || NEB10ß || K || pSB3K3 || 6 ||<br />
|-<br />
|K1319001_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 4 ||<br />
|-<br />
|K1319001_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319001_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 6 ||<br />
|-<br />
|K1319002_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 3 ||<br />
|-<br />
|K1319002_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 4 ||<br />
|-<br />
|K1319002_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|His-SNAP-YFP-K1319003 || NEB10ß || A || pET17 || 3 ||<br />
|-<br />
|His-SNAP-YFP-K1319003 || NEB10ß || A || pET17 || 4 ||<br />
|-<br />
|His-SNAP-YFP-K1319003 || NEB10ß || A || pET17 || 6 ||<br />
|}<br />
</center><br />
<br />
Elution was performed twice with 15&nbsp;µL of nuclease free water each time.<br />
<br />
== 9th ==<br />
* made chips with K131026 in DH5α and NEB and without cells. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_09_09_2014_K131026_neb_agarose_serie.png|title=Sensor Chips with K131026 in DH5α in LB|subtitle=Sensor chips with K131026 in DH5α in LB medium with 1,5% agarose, right chip induced. A) befor induction with 1&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 1&nbsp;h after induction C) 1.5&nbsp;h after induction D) 2&nbsp;h after induction E) 2.5&nbsp;h after induction F) 3&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
== 10th ==<br />
* SDS page of REACh constructs after Gibson <br />
* plasmid prep of Gal3 YFP<br />
** #3: 20&nbsp;ng/µl<br />
** #4: 21.5&nbsp;ng/µl<br />
** #6: 15.9&nbsp;ng/µl<br />
<br />
== 15th ==<br />
analyze the sequencing data from the clones of GFP_Reach 1, GFP_Reach 2 and K1319008. <br />
<br />
GFP_Reach 2 clone #3 and #5 were fine, including the Leu to Ile mutation.<br />
GFP_Reach 1 clone #4 and #5 were fine and did not contain the Leu to Ile mutation. Clone #6 was fine but contained the Leu to Ile mutation from the Reach 1 quick change mutations. <br />
<br />
For future experiments, we will use the GFP_Reach 1 clone #4 and the GFP_Reach 2 clone #4.<br />
<br />
Transformation of GFP_Reach 1 clone #3 and GFP_Reach 2 clones #3 and #5 were performed together with the TEV protease to create two plasmid construct. <br />
<br />
The GFP_Reach 1 and GFP_Reach 2 constructs were also restricted and ligated into the pSB1C3 vector from the pSB3K3 vector.<br />
* over night cultures of K131026 in DH5α and NEB<br />
<br />
== 16th ==<br />
<br />
* made master plates of the transformation from the day before. <br />
* Also PCRs were made from pSBXA3, I20260 and K131900 for a Gibson assembly. The PCRs were checked with a gel electrophoresis.<br />
* made chips with K131026 in DH5α and NEB. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_16_09_2014_K131026_neb_serie.png|title=Sensor Chips with K131026 in NEB in LB|subtitle=Sensor chips with K131026 in NEB in LB medium with 1,5% agarose, right chip induced. A) 0.5&nbsp;h after induction with 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 1&nbsp;h after induction C) 1.5&nbsp;h after induction D) 2&nbsp;h after induction E) 2.5&nbsp;h after induction F) 3&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
== 17th ==<br />
<br />
* prepped and autoclaved 33 500&nbsp;mL shake flasks.<br />
<br />
== 18th ==<br />
* SDS page of REACh constructs with TEV and IPTG<br />
* over night cultures of K131026, B0015, K1319013, K1319014, K1319013 + K1319008 and K1319014 + K1319008 all in BL21<br />
* tested ''Pseudomonas fluoresence'' if they are suitable for a growth experiment that is planned for our collaboration with the NEAnderLab next week. Therefore, she filled 2 500&nbsp;mL flasks with 30&nbsp;mL LB Pseudomonas-F medium, and inoculated each one with 1&nbsp;mL culture medium of the overnight preculture. Flasks were inoculated at 30°C at 250&nbsp;rpm. However, after 5 hours no exponential growth could be shown (s. plot below). Thus, it was decided to use a ''E. coli'' K12 derivate strain in TB medium instead, and 30&nbsp;mL of TB medium in a 500&nbsp;mL flask were inoculated with ''E. coli'' DH5α cells and incubated at 37°C at 300 rpm over night. According to the [https://www.dsmz.de/catalogues/catalogue-microorganisms/groups-of-organisms-and-their-applications/strains-for-schools-and-universities.html DSMZ] ''E . coli'' K12 strain derivates, such as DH5α, are adequate for the kind of school experiment we are planning with the NEAnderLab.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-09-19_NEAnderLab_Test_Growth_Curves_of_Pf_in_LB_iNB.png|title=Growth Curves|subtitle=Unfortunately, ''P. fluorescens'' did not show a nice exponential growth curve over the observed 5 hours.|width=1000px}}<br />
</center><br />
<br />
== 19th ==<br />
* made flask cultures of K1319013, K1319013 + K1319008, K1319013 + K1319008 + iPTG, K1319014, K1319014 + K1319008, K1319014 + K1319008 + iPTG, B0015 (negative control) and I20260 (positive control). iPTG was added at an OD of ~0.5. Inoculation was done via precultures in 500 ml shake flasks (50 ml filling volume). Media was always LB. Cultivation was done at 37°C and 300&nbsp;rpm. The starting OD was aimed to be 0.1. Inoculation occured directly from the precultures. Samples were taken every hour and checked for OD and fluorescence using a spectrophotometer and plate reader, respectively.<br />
<br />
* did plasmid preparation from the cultures of the day before (K1319013, K1319013 + K1319008, K1319013 + K1319008 + iPTG, K1319014, K1319014 + K1319008, K1319014 + K1319008 + iPTG, B0015 and I20260). The plasmid were then be cut with EcoRI and PstI, and the results were be put on an agarose gel in order to perform a restriction test. Also plasmids of K1319013 and K1319014 will be cut with EcoRi and SpeI. K1319008 will be cut with XbaI and PstI. These will then be ligated together and then ligated into a pSB1A3 vector via the 3A assembly (vector cut with EcoRI and PstI). These constructs will be transformed into BL21 (and NEB as a backup). The created construts will be known as K1319018 (K1319013.K1319008) and K1319019 (K1319014.K1319008).<br />
<br />
* made precultures of the master plates from the day before (K1319008, K1319013, K1319015 and pSBX1A3 with Gal3).<br />
<br />
* also inoculated 4 cultures for the further testing of the OD/F Device (the F part). The cultures are 2 shake flasks of I20260 and 2 shake flasks of B0015. <br />
<br />
* Furthermore, did a growth experiment with DH5α for the NEAnderLab school experiment. 3 500&nbsp;mL shake flasks were filled with 50&nbsp;mL TB medium, and inoculated to an OD of 1.5 with the overnight preculture. Samples were taken every 30 minutes and tested for OD using our own device as well as the spectrophotometer. The resulting growth curve is shown below. we concluded that the growth was fast enough for these growth conditions to be used for the school experiment on the 24th. <br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-09-19_NEAnderLab_Test_Growth_Curves_in_TB_iNB.png|title=Growth Curves|subtitle=Growth under these conditions was sufficient for the school experiment to be carried in 5 hours. And our device did a good job measuring, too!|width=1000px}}<br />
</center><br />
<br />
* made chips with K1319013 + K1319008, K1319014 + K1319008, K1319013, K1319014, B0015 and K131026. Images were taken every 30 minutes with our own device.<br />
<br />
* tested our OD/F Device with a dilution test. Samples were checked with the spectrophotometer (OD), our OD/F Device (fluorescence) and platereader (fluorescence).<br />
<br />
* made two SDS gels. <br />
<br />
* inoculated a culture of K1319008, B0015 as well as I20260 to check whether the results from our construct are from a wrongly done Gibson assembly with a still functioning superfolded GFP (the TEV protease was inserted in a backbone that formely contained superfolded GFP.)<br />
<br />
== 20th ==<br />
* SDS page of REACh constructs with TEV protease and induced by IPTG<br />
<br />
== 22nd ==<br />
<br />
* we poured several Pseudomonas-F agar plates with 0, 150 and 300&nbsp;µg/L for the NEAnderLab school experiment. She also autoclaved 12 500&nbsp;mL shake flasks, partly to be used for the school collaboration on Wednesday.<br />
<br />
== 26th ==<br />
* We did a check PCR on several cryo cultures. All samples with G00100_Alternative+K1319004_check_R combinations resulted in a strong band at ~2300&nbsp;bp that we cannot explain. All G00100_Alternative+K1319004_check_R combinations resulted in a strong band at 900&nbsp;bp that we cannot explain either. We concluded that the annealing temperatures were wrong and favored unspecific products. Therefore, we decided to do a gradient PCR to find out the optimal annealing temperatures for our new primers.<br />
<br />
* Gradient PCR to test new primer:<br />
did gradient PCR with these new primers:<br />
<br />
<center><br />
{| class="wikitable"<br />
! name !! sequence<br />
|-<br />
| G00100_Alternative || GTGCCACCTGACGTCTAAGAAACCATTATTATC<br />
|-<br />
| G00101_Alternative || ATTACCGCCTTTGAGTGAGCTGATACCGCTCG<br />
|-<br />
| K1319004_check_R || ACGGAATTTCAGTTTCTGCGGGAACGGCGG<br />
|-<br />
| I746909_check_R || ATCTTTAGACAGAACGCTTTGCGTGCTCAG<br />
|}<br />
</center><br />
<br />
Three PCRs with different primer combinations were run. In all of them the templates were K1319004&nbsp;in pSB1C3, K1319008&nbsp;in&nbsp;pSB1C3 and I746909&nbsp;in&nbsp;pSB1C3.<br />
<br />
The first gradient PCR tested the G00100_Alternative + G00101_Alternative combination:<br />
<br />
<center><br />
{| class="wikitable"<br />
! primer_F !! primer_R !! template !! expected length !! best annealing temperature<br />
|-<br />
| G00100_Alternative || G00101_Alternative || K1319004&nbsp;in pSB1C3 || 1057 || ???<br />
|-<br />
| G00100_Alternative || G00101_Alternative || K1319008&nbsp;in&nbsp;pSB1C3 || 1245 || ???<br />
|-<br />
| G00100_Alternative || G00101_Alternative || I746909&nbsp;in&nbsp;pSB1C3 || 1221 || ???<br />
|-<br />
| G00100_Alternative || G00101_Alternative || water || --- || ???<br />
|}<br />
{{Team:Aachen/Figure|Aachen_14-09-26_gradientPCR_1.png|title=Gradient PCR 1|subtitle=the primers were G00100_Alternative and G00101_Alternative and they worked well at all temperatures from 55-65°C.|width=800px}}<br />
</center><br />
<br />
The second gradient PCR tested the G00100_Alternative + I746916_check_R combination:<br />
<center><br />
{| class="wikitable"<br />
! primer_F !! primer_R !! template !! expected length !! best annealing temperature<br />
|-<br />
| G00100_Alternative || I746916_check_R || K1319004&nbsp;in pSB1C3 || none || ???<br />
|-<br />
| G00100_Alternative || I746916_check_R || K1319008&nbsp;in&nbsp;pSB1C3 || none || ???<br />
|-<br />
| G00100_Alternative || I746916_check_R || I746909&nbsp;in&nbsp;pSB1C3 || 820 || ???<br />
|-<br />
| G00100_Alternative || I746916_check_R || water || --- || ???<br />
|}<br />
{{Team:Aachen/Figure|Aachen_14-09-26_gradientPCR_2.png|title=Gradient PCR 2|subtitle=the primers were G00100_Alternative and I746916_check_R and they worked well at all temperatures from 55-65°C. Apparently the K1319008 template contained I746916.|width=800px}}<br />
</center><br />
<br />
The third gradient PCR tested the G00100_Alternative + K1319004_check_R combination:<br />
<center><br />
{| class="wikitable"<br />
! primer_F !! primer_R !! template !! expected length !! best annealing temperature<br />
|-<br />
| G00100_Alternative || K1319004_check_R || K1319004&nbsp;in pSB1C3 || 541 || ???<br />
|-<br />
| G00100_Alternative || K1319004_check_R || K1319008&nbsp;in&nbsp;pSB1C3 || 502 || ???<br />
|-<br />
| G00100_Alternative || K1319004_check_R || I746909&nbsp;in&nbsp;pSB1C3 || none || ???<br />
|-<br />
| G00100_Alternative || K1319004_check_R || water || --- || ???<br />
|}<br />
{{Team:Aachen/Figure|Aachen_14-09-26_gradientPCR_3.png|title=Gradient PCR 3|subtitle=The primers were G00100_Alternative and K1319004_check_R and they worked well at all temperatures from 60-68°C. To our disappointment, the K1319008 template did not contain K1319004. It is unclear why the 5 bands of K1319008 and I746916 look different.|width=800px}}<br />
</center><br />
<br />
The results of these three PCRs are:<br />
# KAPA2G Fast ReadyMix worked well<br />
# all three primers work well at >65°C annealing temperature<br />
# K1319008 template contained I746916 instead of the intended K1319004 ORF<br />
<br />
It was concluded that a similar check PCR with 65°C annealing temperature will be done on all plasmids and cryos of K1319008.<br />
<br />
== 27th ==<br />
* First we transformed K1319001, K1319002, K1319003 and K1319004 (all in pSB1C3) into NEB10β cells. He tested the PCR machine for semi-automated heat-shocking by splitting the 50&nbsp;µL cells with the plasmid into 2x 25&nbsp;µL. All 100&nbsp;µL were plated for all construct/machine combinations.<br />
<br />
* transformed several constructs into chemically competent BL21(DE3) cells.<br />
<br />
* we did colony-PCR on all plasmids, cryos and colonies that should contain the K1319004 sequence.<br />
<br />
* we also made check a PCR on galectin-constructs:<br />
<center><br />
{| class="wikitable"<br />
! label !! primer_F !! primer_R !! expected length !! result<br />
|-<br />
| Gal3 in pSBX1A3 #1 || G00100_Alternative || K1319003_R || 1684 || ???<br />
|-<br />
| Gal3 in pSBX1A3 #2 || G00100_Alternative || K1319003_R || 1684 || ???<br />
|-<br />
| Gal3 in pSBX1A3 #3 || G00100_Alternative || K1319003_R || 1684 || ???<br />
|-<br />
| Gal3 YFP #3 || pETGal3_seq_F || K1319003_R || 867 || ???<br />
|-<br />
| Gal3 YFP #3 || pETGal3_seq_F || K1319003_R || 867 || ???<br />
|-<br />
| Gal3 YFP pet17 AmpR || pETGal3_seq_F || K1319003_R || 867 or none || ???<br />
|-<br />
| pET17 Gal3 #1 || pETGal3_seq_F || K1319003_R || none || ???<br />
|-<br />
| K1319003 in pSB1C3 || G00100_Alternative || K1319003_R || 930 || ???<br />
|}<br />
</center><br />
<br />
== 28th ==<br />
* made a restriction of BioBrick K1319020 and vector pSB1C3 with restriction enzymes EcoRI and PstI. Then we ligated the restricted parts and made a transformation using ''E. coli'' NEB 10ß cells.<br />
<br />
== 29th ==<br />
<br />
* made cryo cultures and plasmid preparation of K1319010, K1319011, K1319012, K1319021 and K1319042. We determined the contentration of plasmids and made did a restriction digest of K1319010, K1319011, K1319012, pSB1C3, K1319021, K1319013 and K1319014, followed by a ligation in K1319010.pSB1C3, K1319011.pSB1C3, K1319012.pSB1C3, K1319021.K1319013.pSB1A3 and K1319021.K1319013.pSB1A3. All constructs were transformed into ''E. coli'' NEB 10ß.<br />
<br />
* prepared 3 500&nbsp;mL flasks with 30&nbsp;mL LB medium which were inoculated with a ''Pseudomonas putida'' strain. The cells were cultured over night at 28°C and ~300&nbsp;rpm. The cultures are supposed to be used to test our OD device.<br />
<br />
== 30th ==<br />
<br />
* Sequencing samples were sent in for K1319020 clone #2, 3 & 5 (in pSB1C3), K1319017 clone #1 (in pSB1C3), K1319010 clone #2 (in pSB3K3), K1319011 clone #1 (in pSB3K3), K1319012 clone #2 (in pSB3K3), K1319013 clone #1 (in pSB1C3), K1319014 clone #1 (in pSB1C3), K1319001 (in pSB1C3) and K1319002 (in pSB1C3). <br />
<br />
* A plasmid prep of K1319013 and K1319014 was run.<br />
<br />
* A Gibson assembly with the K1319015 from the I20260 backbone and the K1319000 insert, forming K3139015, was conducted. The product was subsequently transformed into NEB10β cells. <br />
<br />
* The pSB1C3 plasmid backbones were amplified via PCR and purified.<br />
<br />
* Colony-PCRs of K1319008 and K1319012 master plates were made to confirm the colony's identity. Subsequently, pre-cultures were inoculated. <br />
<br />
* A transformation of K1319010 and K1319010 in pSB1C3 was conducted.<br />
<br />
* Another plasmid prep of K1319010 clone #2, K1319011 clone #1, K1319012 clone #2 (all in pSB3K3), K1319013 clone #4, K1319014 #3, K139020 #2, 3, 5 (all in pSB1C3) was run.<br />
<br />
* The OD device was tested with a dilution series of a ''Pseudomonas putida'' culture.<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/AugustTeam:Aachen/Notebook/Wetlab/August2014-10-17T21:59:24Z<p>VeraA: /* 5th */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= August =<br />
== 1st ==<br />
* made electrocompetent ''E.coli'' rosetta cells.<br />
* prepared cultures of K1319042 and K131026<br />
<br />
== 2nd ==<br />
* tested the OD measurement device and compared it to the spectrophotometer and the plate reader. <br />
* tested K131026 and K1319042 for fluorescence in the plate reader<br />
* did a heat shock transformation of I746909 into NEB TOP 10 cells<br />
* did an electroshock transformation of pET17-Gal3 into ''E.coli'' rosetta<br />
<br />
== 3rd ==<br />
* OD measurements of the iGEM device in comparison to the spectrophotometer were taken. <br />
* cryo cultures of K131026 and K1319042 were prepared<br />
* master plates of Gal3 #1-#10 and I746909 #1-#4 and overnight cultures<br />
<br />
== 4th ==<br />
* made cryo stocks of K1319042 and K131026 in NEB/BL21/DH5α, I746909 in BL21 and pET17-His-SNAP-YFP-Gal3 in ''E.&nbsp;coli'' rosetta (DE3), respectively.<br />
* made plasmid prep, most of them using 1.5&nbsp;mL culture medium, and eluted with 1x 50&nbsp;µL of ddH{{sub|2}}O. The resulting DNA concentrations are shown below.<br />
<br />
<center><br />
{| class="wikitable"<br />
! combination !! concentration [ng/µl]<br />
|-<br />
| I746909 BL21 #1 || 73.5<br />
|-<br />
| I746909 BL21 #2 || 45<br />
|-<br />
| I746909 BL21 #3 || 49<br />
|-<br />
| K1319042 DH5α || 60<br />
|-<br />
| K131026 DH5α || 150<br />
|-<br />
| pET17-Gal3 #1 || 30.5<br />
|-<br />
| pET17-Gal3 #2 || 6.4<br />
|-<br />
| pET17-Gal3 #3 || 6.3<br />
|-<br />
| pET17-Gal3 #4 || 9.4<br />
|-<br />
| pET17-Gal3 #5 || 10.1<br />
|-<br />
| pET17-Gal3 #6 || 8.2<br />
|-<br />
| pET17-Gal3 #7 || 13.8<br />
|-<br />
| pET17-Gal3 #8 || 6.9<br />
|-<br />
| pET17-Gal3 #9 || 10.2<br />
|}<br />
</center><br />
<br />
To confirm the quality of pET17-Gal3 transformations, the purified plasmids were tested by carrying out a digest. Results are shown in the below picture and table.<br />
<br />
<center><br />
{{Team:Aachen/Figure|14-08-04_Test-Digest.png|title=Test digest|subtitle=clones were test-digested|width=400px}}<br />
<br />
{| class="wikitable"<br />
! combination !! cut products[bp]<br />
|-<br />
| I746909 BL21 #1 || 2029, 947<br />
|-<br />
| K1319042 DH5α || 2029, 1780<br />
|-<br />
| K131026 DH5α || 2029, 1848<br />
|-<br />
| pET17-Gal3 #1 || 3086, 923, 1262<br />
|}<br />
</center><br />
<br />
All pET17-Gal3 clones were positive and clone #1 was selected for further experiments.<br />
* prepared an over night cultur of K1319042 for chips<br />
<br />
== 5th ==<br />
* assembly of a V{{sub|R}}=2.5&nbsp;L bioreactor for cultivation of a 1&nbsp;L expression culture.<br />
* Two precultures of 20&nbsp;mL LB+A were inoculated at 19:00<br />
* transformation of K746909 into BL21 cells and K1319000 into NEB10β cells.<br />
* made Chips with K1319042 in HM. Images were taken every 30 min with the Geldoc<br />
* made alliquots of HM, 1&nbsp;L HM + glucose + supplements and 500&nbsp;ml LB<br />
<br />
* The '''Quikchange''' mutagenesis PCR with a tamplate K1319000 and following primers was made. The PCR was made in two steps. The first step is PCR with both primers separatly and the second step includes PCR with two PCR products mixed with each other.<br />
** forward primer EYFPtoREACh1_F: AGTACAACTGGAACAGCCACAACGTCTATATC<br />
** rewerse primer EYFPtoREACh1_R: GTTGTGGCTGTTCCAGTTGTACTCCAGCTTG<br />
** forward primer EYFPtoREACh2_F: AGTACAACTGGAACAGCCGCAACGTCTATATCATG<br />
** rewerse primer EYFPtoREACh2_R: ATAGACGTTGCGGCTGTTCCAGTTGTACTCCAGCTTG<br />
<br />
'''1. Step''' with 3 cycles<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| anneal || 55 || 30"<br />
|-<br />
| elongate || 72 || 30"<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
'''2. Step''' with 14 cycles<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| anneal || 55 || 60"<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-07-5_PCR_toREACh1%262.png|title=Agarose gel with PCR products after Quikchange from K1319000 to K1319001 and K1319002 |width=400px}}<br />
</center><br />
<br />
* REACh1 gets number K1319001 and REACh2 gets number K1319002.<br />
<br />
* PCR product was restricted with DpnI 60&nbsp;min at 37°C to destroy the methylated template. Then DpnI was deaktevated at 80°C during 20&nbsp;min.<br />
* PCR product was purifired and transformated in DH5α.<br />
<br />
== 6th ==<br />
* transformation of J04450 in pSB1K3 and pSB1A3 in NEB10β cells.<br />
* They also did a plasmid prep of J04450 in pSB1C3 and Flo's vectors.<br />
* made precultures of NEB10β and DH5α cells<br />
* inoculation of the fermenter at 11:40, and induced the fermentation of pET17-Gal3. The fermentation is expected to run 24&nbsp;h.<br />
* as the first Quickchange PCR for REACh2 was not sucsessful, it was reapeted as a gradient PCR with annealing temperatire 55°C, 57°C and 60°C. Then the agarose gel with PCR product samples was made.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-08-06_to_REACh2.png|title=Agarose gel with PCR products after Quickchange from K1319000 to K1319002 |width=400px}}<br />
</center><br />
<br />
== 7th ==<br />
* made media for ''Pseudomonas flourescens''<br />
** Nutrient Broth<br />
** Pseudomonas-F<br />
** Pseudomonas-P<br />
* made 2&nbsp;L LB<br />
<br />
== 8th ==<br />
* prepared 2x 60&nbsp;ml (LB + cam + IPTG) with K1319042<br />
* prepared 5&nbsp;ml K131026 and C0179<br />
* made SDS page<br />
<br />
== 9th ==<br />
* made a plate reader experiment with K131026 in LB and LB + HM<br />
<br />
== 11th ==<br />
* plated on LB + antibiotics<br />
** K131026<br />
** I746909<br />
** K13190042<br />
** I04450 in pSB1C3<br />
** I04450 in pSB1A3<br />
** I04450 in pSB1K3<br />
** pSEVA construct (pSEVA 641_FP pSEVA 234-LasR)<br />
<br />
== 13th ==<br />
* Agarose chips were prepared:<br />
** ''E. coli'' DH5α K131026 and I746909 in LB and HM<br />
** K1319042 and the pSEVA two plasmid construct in HM<br />
* Images were taken every 30 min with the Geldoc<br />
<br />
==15th ==<br />
* A bioreactor containing 1&nbsp;L Medium was inoculated with pET17-His-SNAP-YFP-Gal3.<br />
<br />
== 16th ==<br />
* The above mentioned Bioreactor was stopped after 20&nbsp;h and all cells were lysed.<br />
<br />
== 18th ==<br />
* Overnight cultures of I746909 and K131026 in LB, TB, 2x HM+ were made<br />
* 3x J23101.E0240 was plated<br />
* pET17-His-SNAP-YFP-Gal3 was purified with Äkta via a histidine-tagged protein purification.<br />
<br />
== 19th ==<br />
* Chips with K131026 and I746909 in HM were made. Images were taken every 30 min with the Geldoc<br />
* A PCR of J23101.E0240, K1319000, K1319001, K1319002 was run and the product was separated on a 1,2% agarose gel<br />
* A SDS gel with samples of protein purification of pET17-His-SNAP-YFP-Gal3 was made to check if the purifired samples contain the target protein - YFP-Gal3. The purification or the gel resulted in two samples with a yellow color. For the SDS we also used the two samples before and the two samples after ones with the yellow color, 6&nbsp;mL. <br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-08-18_Gal3_purification_iVA.png|title=YFP-Gal3 protein purification|subtitle=|width=400px}}<br />
</center><br />
<br />
* Two samples with YFP-Gal3 were concentrated till 1&nbsp;mL <br />
* The concentration of YFP-Gal3 was calculated on Tecan. Calculation showed concentration 13,42&nbsp;mg/ml<br />
<br />
== 20th ==<br />
* repeat PCR for REACh1 and J23101.E0240 and run a gel<br />
* plasmid prep of pSEVA BfsB, pSEVA lasR and I746909<br />
<br />
== 24th ==<br />
* made 2.5&nbsp;L LB<br />
* made chips of K131026 in NEB , DH5α and BL21 in LB and additionally K131026 in DH5α in HM+. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_24_08_2014_K131026_bl21_serie.png|title=Sensor Chips with K131026 in BL21 in LB taken with first prototyp of our own device|subtitle=Sensor chips with K131026 in BL21 in LB medium with 1,5% agar, lower chip induced. A) befor induction with 2&nbsp;µl of 5000&nbsp;µg/ml HSL (3-oxo-C12) B) 0.5&nbsp;h after induction C) 1&nbsp;h after induction D) 1.5&nbsp;h after induction E) 2&nbsp;h after induction F) 2.5&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
== 25th ==<br />
* did a plasmid restriction of I20260 (EcoRI,PstI), J23115 (EcoRI, SpeI), K516032 (XbaI,PstI), and J23101 (EcoRI, SpeI)<br />
* tested the growth of ''Pseudomonas fluorescens'' in different liquid media for high OD and strong fluorescence. She tested Standard I medium, Cetrimide medium and Pseudomonas-F medium, and Pseudomonas-F medium supplemented with 300&nbsp;µL Fe3+ in 500&nbsp;mL flasks with a filling volume of 30&nbsp;mL. The flasks were inoculated with ''P. fluorescens'' cells on Standard I agar, and incubated at 30°C at 250&nbsp;rpm.<br />
* prepared over night cultures of K131026 in DH5α and NEB for chips<br />
* prepared 2x 5&nbsp;ml of pSB1C3, psB3K3 and pSB1A2 for plasmid prep<br />
<br />
== 26th ==<br />
* ligation of J23115 and K516032 to J23115.K516032, and J23101 and K516032 to J23101.K516032, respectively.<br />
* plasmid prep of I20260, K516032 and B0034<br />
* restriction of plasmids I20260, K516032, B0034 with EcoRI and PstI<br />
* gel with restricted the I20260, K516032 and B0034 was run<br />
* purification of vector backbones pSB1A2, pSB3K3 and pSB1C3<br />
* restriciton of synthesized TEV protease with EcoRI and PstI<br />
* qualitatively tested the ''Pseudomonas fluorescens'' that had grown over night for OD and fluorescence. She determined that Pseudomonas-F medium is the most adequate for the cultivation of the strain we use, since both OD and fluorescence were best in the flask containing the respective medium. Growth in the Pseudomonas-F medium supplemented with 300&nbsp;µg/L Fe3+ was weaker, however, fluorescence was also successfully suppressed.<br />
* made chips with K131026 in DH5α and NEB, in LB and LB + 10% glycerol. Images were taken with our own device every 10 min (illumination problems).<br />
<center><br />
{{Team:Aachen/Figure|Aachen_26_08_2014_K131026_neb_serie.png|title=Sensor Chips with K131026 in NEB in LB taken with first prototyp of our own device|subtitle=Sensor chips with K131026 in NEB in LB medium with 1,5% agar. Chip on the top induced with 0.5&nbsp;µl of 500&nbsp;µg/ml HSL and on the bottom with less than 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12). A) befor induction B) 1&nbsp;h after induction C) 1.5&nbsp;h after induction D) 2&nbsp;h after induction |width=600px}}<br />
</center><br />
* plasmid prep of the back bones, restriction and gel purification<br />
<br />
== 27th ==<br />
* transformation of some BioBricks<br />
* ligation of J23101.K516032 into pSB3K3 and J23115.K516032 into pSB3K3 and K1319004 into pSB1C3<br />
* transformation of K1319004 into pUC and pSB1C3, and J04450 into pSB1K3 and pSB1A3, respectively<br />
<br />
== 28th ==<br />
* transformation of some BioBricks<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Project/Gal3Team:Aachen/Project/Gal32014-10-17T17:38:44Z<p>VeraA: /* References */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
= Galectin-3 =<br />
<br />
We are committed to constantly improve our detection methods. Therefore, we already thought ahead and came up with an alternative approach for the detection of pathogens. The current method uses the quorum sensing system pathogens and is thus limited to bacteria that secrete autoinducers. Our alternative detection system involves biomolecules tagged with a fluorescent reporter that bind to the surface of the cell and reveal its presence.<br />
<br />
<html><br />
<center><br />
<ul class="team-grid" style="width:inherit;"><br />
<!-- Overview --><br />
<br />
<li><a href="https://2014.igem.org/Team:Aachen/Project/Gal3#alternativesensing" style="color:black"><br />
<div class="team-item team-info" ><br />
<div class="menukachel">An Alternative Sensing Molecule</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/7/74/Aachen_14-10-13_Galectin-3-YFP_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"> </div></a><br />
</li><br />
<br />
<li><a href="https://2014.igem.org/Team:Aachen/Project/Gal3#naturalfunctions" style="color:black"><br />
<div class="team-item team-info" ><br />
<div class="menukachel">Natural Functions</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/7/76/Aachen_14-10-13_Galectin-3_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"> </div></a><br />
</li><br />
<br />
<li><a href="https://2014.igem.org/Team:Aachen/Project/Gal3#gal3achievements" style="color:black"><br />
<div class="team-item team-info" ><br />
<div class="menukachel">Achievements</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/e/ef/Aachen_14-10-15_Medal_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"> </div></a><br />
</li><br />
</ul><br />
</center><br />
</html><br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-13_Galectin-3-YFP_iNB.png|150px|right]]<br />
<br />
== An Alternative Sensing Molecule ==<br />
<span class="anchor" id="alternativesensing"></span><br />
<br />
{{Team:Aachen/FigureFloat|Aachen_14-10-09_Pseudomonas_LPS_iNB.png|title=Cell wall composition of ''Pseudomonas aeruginosa''|subtitle=Gram-negative bacteria have two cell membranes. The LPS are embedded in the outer membrane and are composed of a lipid and an O polysaccharide.|width=420px}}<br />
<br />
The specific binding of galectin-3 enables the construction of such a detection system. Parts of the '''lipopolysaccharide structure (LPS)''' of ''Pseudomonas aeruginosa'' can be bound by galectin-3. Specifically, the O polysaccharide (see figure on the left) of the LPS is recognized by galectin-3. A fusion protein of galectin-3 and a reporter protein, such as a fluorescent protein, can be built and applied in the detection of ''Pseudomonas&nbsp;aeruginosa''.<br />
<br />
In our approach, a '''galectin-3-YFP fusion protein''' is built and expressed in ''E.&nbsp;coli''. A his-tag and a snap-tag for purification are included. The fusion protein can then be incorporated into a '''cell-free biosensor system'''. Such biosensors have many advantages over systems that use living cells; storage, for example, is much easier. From a [https://2014.igem.org/Team:Aachen/Safety biosafety] and social acceptance perspective, it is also advantageous if the sensor system does not contain live genetically modified organisms.<br />
<br />
{{Team:Aachen/FigureFloatRight|align=center|Aachen_14-10-09_Cell_Free_Biosensor_iNB.png|width=500px}}<br />
<br />
<br />
<br />
<br />
<br />
To detect ''P.&nbsp;aeruginosa'' cells, an agar chip could be used to sample a solid surface. However, other materials but agar can be considered to collect the pathogens. The cell stick to the sampling chip which is then immersed in a detection buffer containing the galectin-3-YFP fusion protein. Excess protein is removed during washing in a suitable buffer. The galectin-3 remains bound to the pathogen and '''illumination with 514&nbsp;nm''', the excitation frequency of YFP, in a modified version of our measurement device reveals the location of the cells. The picture taken by the measurement device can then be analyzed by our software ''Measurarty''.<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-13_Galectin-3_iNB.png|150px|right]]<br />
<br />
= Natural Functions of Galectin-3 =<br />
<span class="anchor" id="naturalfunctions"></span><br />
<br />
Galectins are proteins of the lectin family, which posess '''carbonhydrate recognition domains''' binding specifically to β-galactoside sugar residues. In humans, 10 different galectines have been identified, among which is galectin-3. <br />
<br />
Galectin-3 has a size of about 31&nbsp;kDA and is encoded by a single gene, LGALS3. It has many physiological functions, such as '''cell adhesion, cell growth and differentiation,''' and contributes to the development of '''cancer, inflammation, fibrosis and others'''.<br />
<br />
Human galectin-3 is a protein of the lectin-family that was shown to bind the LPS of multiple human pathogens.<br />
Some of them, including ''Pseudomonas&nbsp;aeruginosa'' protect themselves against the human immune system by mimicking the lipopolysaccharides (LPS) present on human erythrocytes. <br />
<br />
By making fusion proteins from galectin-3 and fluorescent reporter proteins, pathogens can be labelled and made visible by fluorescence microscopy.<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-15_Medal_Cellocks_iNB.png|right|150px]]<br />
<br />
= Achievements =<br />
<span class="anchor" id="gal3achievements"></span><br />
<br />
Due to the generous support of Sophia Böcker and Prof.&nbsp;Dr.&nbsp;Elling of the Helmholtz Institute for Biomedical Engineering in Aachen, we got access to a pET17-derived expression plasmid for a His- and SNAP-tagged YFP-galectin-3 fusion protein. We transformed the fusion protein into ''E.&nbsp;coli''&nbsp;Rosetta cells and conducted a batch fermentation to obtain large amounts of protein (FIGURE).<br />
<br />
<br />
<br />
With the help of David Schönauer and Alan Mertens from the RWTH Aachen Institute of Biotechnolgy we then purified the fusion protein using FPLC.<br />
<br />
<br />
<br />
We attempted to do an experiment to test the binding of the Gal-3 fusion protein to the LPS of ''Pseudomonas aeruginosa'' as shown previously [1], but we were unable to obtain useful results because our fluorescence microscope was not sensitive enough.<br />
<br />
After we received the collection of [https://2014.igem.org/Team:Aachen/Collaborations/Heidelberg pSBX-expression vectors] from Team Heidelberg, we used Gibson assembly to make K1319020 from K1319003 and pSBX1A3, which is the translational unit for an mRFP-Gal3 fusion protein with a C-terminal 6xHis tag:<br />
<center>{{Team:Aachen/Figure|Aachen_K1319020.png|width=800px|title=K1319009|This BioBrick is a construction intermediate of K1319003 (gal3), E1010 (mRFP), K1319007 (6xHis tag) to K1319020 (translational unit of the fusion protein).}}</center><br />
<br />
We also cloned our K1319003 into the pET17 expression vector and expressed all combinations of fusion proteins in E.&nbsp;coli&nbsp;BL21(DE3). An SDS-PAGE showed that all fusion proteins were fully translated:<br />
<br />
{{Team:Aachen/FigureDual<br />
|Aachen_14-10-04_Expression_Pellets_iMO.png|Aachen_Gal3_Expression.png|title1=Pellets of different fusion protein expressions|title2=SDS-PAGE of K1319020 expression|subtitle1=Expression in the pET17 vector was much more leaky than the expression in the pSBX vectors.|subtitle2=The fusion protein was fully translated to the correct molecular mass of 74&nbsp;kDa.|width=425px}} <br />
<br />
== References ==<br />
[1] Kupper CE, Böcker S, Liu H, et al. Fluorescent SNAP-tag galectin fusion proteins as novel tools in glycobiology. Curr Pharm Des. 2013;19(30):5457-67. Available at: http://www.ncbi.nlm.nih.gov/pubmed/23431989. <br />
<br />
<br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Project/Gal3Team:Aachen/Project/Gal32014-10-17T17:38:23Z<p>VeraA: /* Achievements */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
= Galectin-3 =<br />
<br />
We are committed to constantly improve our detection methods. Therefore, we already thought ahead and came up with an alternative approach for the detection of pathogens. The current method uses the quorum sensing system pathogens and is thus limited to bacteria that secrete autoinducers. Our alternative detection system involves biomolecules tagged with a fluorescent reporter that bind to the surface of the cell and reveal its presence.<br />
<br />
<html><br />
<center><br />
<ul class="team-grid" style="width:inherit;"><br />
<!-- Overview --><br />
<br />
<li><a href="https://2014.igem.org/Team:Aachen/Project/Gal3#alternativesensing" style="color:black"><br />
<div class="team-item team-info" ><br />
<div class="menukachel">An Alternative Sensing Molecule</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/7/74/Aachen_14-10-13_Galectin-3-YFP_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"> </div></a><br />
</li><br />
<br />
<li><a href="https://2014.igem.org/Team:Aachen/Project/Gal3#naturalfunctions" style="color:black"><br />
<div class="team-item team-info" ><br />
<div class="menukachel">Natural Functions</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/7/76/Aachen_14-10-13_Galectin-3_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"> </div></a><br />
</li><br />
<br />
<li><a href="https://2014.igem.org/Team:Aachen/Project/Gal3#gal3achievements" style="color:black"><br />
<div class="team-item team-info" ><br />
<div class="menukachel">Achievements</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/e/ef/Aachen_14-10-15_Medal_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"> </div></a><br />
</li><br />
</ul><br />
</center><br />
</html><br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-13_Galectin-3-YFP_iNB.png|150px|right]]<br />
<br />
== An Alternative Sensing Molecule ==<br />
<span class="anchor" id="alternativesensing"></span><br />
<br />
{{Team:Aachen/FigureFloat|Aachen_14-10-09_Pseudomonas_LPS_iNB.png|title=Cell wall composition of ''Pseudomonas aeruginosa''|subtitle=Gram-negative bacteria have two cell membranes. The LPS are embedded in the outer membrane and are composed of a lipid and an O polysaccharide.|width=420px}}<br />
<br />
The specific binding of galectin-3 enables the construction of such a detection system. Parts of the '''lipopolysaccharide structure (LPS)''' of ''Pseudomonas aeruginosa'' can be bound by galectin-3. Specifically, the O polysaccharide (see figure on the left) of the LPS is recognized by galectin-3. A fusion protein of galectin-3 and a reporter protein, such as a fluorescent protein, can be built and applied in the detection of ''Pseudomonas&nbsp;aeruginosa''.<br />
<br />
In our approach, a '''galectin-3-YFP fusion protein''' is built and expressed in ''E.&nbsp;coli''. A his-tag and a snap-tag for purification are included. The fusion protein can then be incorporated into a '''cell-free biosensor system'''. Such biosensors have many advantages over systems that use living cells; storage, for example, is much easier. From a [https://2014.igem.org/Team:Aachen/Safety biosafety] and social acceptance perspective, it is also advantageous if the sensor system does not contain live genetically modified organisms.<br />
<br />
{{Team:Aachen/FigureFloatRight|align=center|Aachen_14-10-09_Cell_Free_Biosensor_iNB.png|width=500px}}<br />
<br />
<br />
<br />
<br />
<br />
To detect ''P.&nbsp;aeruginosa'' cells, an agar chip could be used to sample a solid surface. However, other materials but agar can be considered to collect the pathogens. The cell stick to the sampling chip which is then immersed in a detection buffer containing the galectin-3-YFP fusion protein. Excess protein is removed during washing in a suitable buffer. The galectin-3 remains bound to the pathogen and '''illumination with 514&nbsp;nm''', the excitation frequency of YFP, in a modified version of our measurement device reveals the location of the cells. The picture taken by the measurement device can then be analyzed by our software ''Measurarty''.<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-13_Galectin-3_iNB.png|150px|right]]<br />
<br />
= Natural Functions of Galectin-3 =<br />
<span class="anchor" id="naturalfunctions"></span><br />
<br />
Galectins are proteins of the lectin family, which posess '''carbonhydrate recognition domains''' binding specifically to β-galactoside sugar residues. In humans, 10 different galectines have been identified, among which is galectin-3. <br />
<br />
Galectin-3 has a size of about 31&nbsp;kDA and is encoded by a single gene, LGALS3. It has many physiological functions, such as '''cell adhesion, cell growth and differentiation,''' and contributes to the development of '''cancer, inflammation, fibrosis and others'''.<br />
<br />
Human galectin-3 is a protein of the lectin-family that was shown to bind the LPS of multiple human pathogens.<br />
Some of them, including ''Pseudomonas&nbsp;aeruginosa'' protect themselves against the human immune system by mimicking the lipopolysaccharides (LPS) present on human erythrocytes. <br />
<br />
By making fusion proteins from galectin-3 and fluorescent reporter proteins, pathogens can be labelled and made visible by fluorescence microscopy.<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-15_Medal_Cellocks_iNB.png|right|150px]]<br />
<br />
= Achievements =<br />
<span class="anchor" id="gal3achievements"></span><br />
<br />
Due to the generous support of Sophia Böcker and Prof.&nbsp;Dr.&nbsp;Elling of the Helmholtz Institute for Biomedical Engineering in Aachen, we got access to a pET17-derived expression plasmid for a His- and SNAP-tagged YFP-galectin-3 fusion protein. We transformed the fusion protein into ''E.&nbsp;coli''&nbsp;Rosetta cells and conducted a batch fermentation to obtain large amounts of protein (FIGURE).<br />
<br />
<br />
<br />
With the help of David Schönauer and Alan Mertens from the RWTH Aachen Institute of Biotechnolgy we then purified the fusion protein using FPLC.<br />
<br />
<br />
<br />
We attempted to do an experiment to test the binding of the Gal-3 fusion protein to the LPS of ''Pseudomonas aeruginosa'' as shown previously [1], but we were unable to obtain useful results because our fluorescence microscope was not sensitive enough.<br />
<br />
After we received the collection of [https://2014.igem.org/Team:Aachen/Collaborations/Heidelberg pSBX-expression vectors] from Team Heidelberg, we used Gibson assembly to make K1319020 from K1319003 and pSBX1A3, which is the translational unit for an mRFP-Gal3 fusion protein with a C-terminal 6xHis tag:<br />
<center>{{Team:Aachen/Figure|Aachen_K1319020.png|width=800px|title=K1319009|This BioBrick is a construction intermediate of K1319003 (gal3), E1010 (mRFP), K1319007 (6xHis tag) to K1319020 (translational unit of the fusion protein).}}</center><br />
<br />
We also cloned our K1319003 into the pET17 expression vector and expressed all combinations of fusion proteins in E.&nbsp;coli&nbsp;BL21(DE3). An SDS-PAGE showed that all fusion proteins were fully translated:<br />
<br />
{{Team:Aachen/FigureDual<br />
|Aachen_14-10-04_Expression_Pellets_iMO.png|Aachen_Gal3_Expression.png|title1=Pellets of different fusion protein expressions|title2=SDS-PAGE of K1319020 expression|subtitle1=Expression in the pET17 vector was much more leaky than the expression in the pSBX vectors.|subtitle2=The fusion protein was fully translated to the correct molecular mass of 74&nbsp;kDa.|width=425px}} <br />
<br />
== References ==<br />
[1] Kupper CE, Böcker S, Liu H, et al. Fluorescent SNAP-tag galectin fusion proteins as novel tools in glycobiology. Curr Pharm Des. 2013;19(30):5457-67. Available at: http://www.ncbi.nlm.nih.gov/pubmed/23431989. Accessed October 17, 2014. <br />
<br />
<br />
<br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Project/Gal3Team:Aachen/Project/Gal32014-10-17T17:30:08Z<p>VeraA: /* Achievements */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
= Galectin-3 =<br />
<br />
We are committed to constantly improve our detection methods. Therefore, we already thought ahead and came up with an alternative approach for the detection of pathogens. The current method uses the quorum sensing system pathogens and is thus limited to bacteria that secrete autoinducers. Our alternative detection system involves biomolecules tagged with a fluorescent reporter that bind to the surface of the cell and reveal its presence.<br />
<br />
<html><br />
<center><br />
<ul class="team-grid" style="width:inherit;"><br />
<!-- Overview --><br />
<br />
<li><a href="https://2014.igem.org/Team:Aachen/Project/Gal3#alternativesensing" style="color:black"><br />
<div class="team-item team-info" ><br />
<div class="menukachel">An Alternative Sensing Molecule</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/7/74/Aachen_14-10-13_Galectin-3-YFP_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"> </div></a><br />
</li><br />
<br />
<li><a href="https://2014.igem.org/Team:Aachen/Project/Gal3#naturalfunctions" style="color:black"><br />
<div class="team-item team-info" ><br />
<div class="menukachel">Natural Functions</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/7/76/Aachen_14-10-13_Galectin-3_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"> </div></a><br />
</li><br />
<br />
<li><a href="https://2014.igem.org/Team:Aachen/Project/Gal3#gal3achievements" style="color:black"><br />
<div class="team-item team-info" ><br />
<div class="menukachel">Achievements</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/e/ef/Aachen_14-10-15_Medal_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"> </div></a><br />
</li><br />
</ul><br />
</center><br />
</html><br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-13_Galectin-3-YFP_iNB.png|150px|right]]<br />
<br />
== An Alternative Sensing Molecule ==<br />
<span class="anchor" id="alternativesensing"></span><br />
<br />
{{Team:Aachen/FigureFloat|Aachen_14-10-09_Pseudomonas_LPS_iNB.png|title=Cell wall composition of ''Pseudomonas aeruginosa''|subtitle=Gram-negative bacteria have two cell membranes. The LPS are embedded in the outer membrane and are composed of a lipid and an O polysaccharide.|width=420px}}<br />
<br />
The specific binding of galectin-3 enables the construction of such a detection system. Parts of the '''lipopolysaccharide structure (LPS)''' of ''Pseudomonas aeruginosa'' can be bound by galectin-3. Specifically, the O polysaccharide (see figure on the left) of the LPS is recognized by galectin-3. A fusion protein of galectin-3 and a reporter protein, such as a fluorescent protein, can be built and applied in the detection of ''Pseudomonas&nbsp;aeruginosa''.<br />
<br />
In our approach, a '''galectin-3-YFP fusion protein''' is built and expressed in ''E.&nbsp;coli''. A his-tag and a snap-tag for purification are included. The fusion protein can then be incorporated into a '''cell-free biosensor system'''. Such biosensors have many advantages over systems that use living cells; storage, for example, is much easier. From a [https://2014.igem.org/Team:Aachen/Safety biosafety] and social acceptance perspective, it is also advantageous if the sensor system does not contain live genetically modified organisms.<br />
<br />
{{Team:Aachen/FigureFloatRight|align=center|Aachen_14-10-09_Cell_Free_Biosensor_iNB.png|width=500px}}<br />
<br />
<br />
<br />
<br />
<br />
To detect ''P.&nbsp;aeruginosa'' cells, an agar chip could be used to sample a solid surface. However, other materials but agar can be considered to collect the pathogens. The cell stick to the sampling chip which is then immersed in a detection buffer containing the galectin-3-YFP fusion protein. Excess protein is removed during washing in a suitable buffer. The galectin-3 remains bound to the pathogen and '''illumination with 514&nbsp;nm''', the excitation frequency of YFP, in a modified version of our measurement device reveals the location of the cells. The picture taken by the measurement device can then be analyzed by our software ''Measurarty''.<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-13_Galectin-3_iNB.png|150px|right]]<br />
<br />
= Natural Functions of Galectin-3 =<br />
<span class="anchor" id="naturalfunctions"></span><br />
<br />
Galectins are proteins of the lectin family, which posess '''carbonhydrate recognition domains''' binding specifically to β-galactoside sugar residues. In humans, 10 different galectines have been identified, among which is galectin-3. <br />
<br />
Galectin-3 has a size of about 31&nbsp;kDA and is encoded by a single gene, LGALS3. It has many physiological functions, such as '''cell adhesion, cell growth and differentiation,''' and contributes to the development of '''cancer, inflammation, fibrosis and others'''.<br />
<br />
Human galectin-3 is a protein of the lectin-family that was shown to bind the LPS of multiple human pathogens.<br />
Some of them, including ''Pseudomonas&nbsp;aeruginosa'' protect themselves against the human immune system by mimicking the lipopolysaccharides (LPS) present on human erythrocytes. <br />
<br />
By making fusion proteins from galectin-3 and fluorescent reporter proteins, pathogens can be labelled and made visible by fluorescence microscopy.<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-15_Medal_Cellocks_iNB.png|right|150px]]<br />
<br />
= Achievements =<br />
<span class="anchor" id="gal3achievements"></span><br />
<br />
Due to the generous support of Sophia Böcker and Prof.&nbsp;Dr.&nbsp;Elling of the Helmholtz Institute for Biomedical Engineering in Aachen, we got access to a pET17-derived expression plasmid for a His- and SNAP-tagged YFP-galectin-3 fusion protein. We transformed the fusion protein into ''E.&nbsp;coli''&nbsp;Rosetta cells and conducted a batch fermentation to obtain large amounts of protein (FIGURE).<br />
<br />
<br />
<br />
With the help of David Schönauer and Alan Mertens from the RWTH Aachen Institute of Biotechnolgy we then purified the fusion protein using FPLC.<br />
<br />
<br />
<br />
We attempted to do an experiment to test the binding of the Gal-3 fusion protein to the LPS of ''Pseudomonas aeruginosa'' as shown previously [LITERATURE-REFERENCE], but we were unable to obtain useful results because our fluorescence microscope was not sensitive enough.<br />
<br />
After we received the collection of [https://2014.igem.org/Team:Aachen/Collaborations/Heidelberg pSBX-expression vectors] from Team Heidelberg, we used Gibson assembly to make K1319020 from K1319003 and pSBX1A3, which is the translational unit for an mRFP-Gal3 fusion protein with a C-terminal 6xHis tag:<br />
<center>{{Team:Aachen/Figure|Aachen_K1319020.png|width=800px|title=K1319009|This BioBrick is a construction intermediate of K1319003 (gal3), E1010 (mRFP), K1319007 (6xHis tag) to K1319020 (translational unit of the fusion protein).}}</center><br />
<br />
We also cloned our K1319003 into the pET17 expression vector and expressed all combinations of fusion proteins in E.&nbsp;coli&nbsp;BL21(DE3). An SDS-PAGE showed that all fusion proteins were fully translated:<br />
<br />
{{Team:Aachen/FigureDual<br />
|Aachen_14-10-04_Expression_Pellets_iMO.png|Aachen_Gal3_Expression.png|title1=Pellets of different fusion protein expressions|title2=SDS-PAGE of K1319020 expression|subtitle1=Expression in the pET17 vector was much more leaky than the expression in the pSBX vectors.|subtitle2=The fusion protein was fully translated to the correct molecular mass of 74&nbsp;kDa.|width=425px}} <br />
<br />
<br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Notebook/Engineering/ODFTeam:Aachen/Notebook/Engineering/ODF2014-10-17T16:45:27Z<p>VeraA: /* Light Filters */</p>
<hr />
<div>__NOTOC__<br />
{{Team:Aachen/Header}}<br />
{{Team:Aachen/Stylesheet}}<br />
= OD/F Device =<br />
<br />
On this page we present the technical details of our OD/F device. You can skip to specific chapters by clicking on the panels below:<br />
<center><br />
<html><ul class="team-grid" style="width:1064px;"><br />
<!-- Overview --><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook/Engineering/ODF#dev" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<br/><br><br />
<b>General Considerations</b><br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/0/0f/Aachen_14-10-10_ODF_Button_ipo.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook/Engineering/ODF#od" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<br/><br/><br />
<b>OD Device</b><br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/0/04/Aachen_Cuvette_button_v1_ipo.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook/Engineering/ODF#f" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<br/><br/><br />
<b>F Device</b><br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/5/55/Aachen_17-10-14_Glowing_cuvette-ipo.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook/Engineering/ODF#diy" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<br/><br/><br />
<b>DIY</b><br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/9/9e/Aachen_14-10-15_DIY_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
Building the OD/F device has been an interesting task. On the one hand, this device has been developed mainly by the IT division of our team. On the other hand, we got assistance from biologists suffering from color-blindness, yet eager to help selecting the best color filters for the LEDs.<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-10_ODF_Button_ipo.png|right|150px]]<br />
<br />
= General Considerations =<br />
<span class="anchor" id="dev"></span><br />
<br />
=== Measuring Principle ===<br />
<br />
The measuring principle for both optical density (OD) and fluorescence measurement is depicted below.<br />
For OD measurement we shine through the sample with an LED and a fixed width. A filter blocks any other light but 600&nbsp;nm. This way, the sensor mainly senses the 600&nbsp;nm light which is needed for OD600 measurement.<br />
<br />
For fluorescence measurement a similar approach is chosen. The filter again is used to block the exciting light from being sensed. That way only the emitted light from the fluorescence protein is measured.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_odf_schemes.png|title=Measuring principle for OD/F device|subtitle=The left image shows the measurement approach for the optical density. The light shines through the sample with a fixed width. The right image shows the fluorescence measurement approach, exciting the fluorescence proteins from below and measuring from the side.|width=500px}}<br />
</center><br />
<br />
The details about selecting filters, code and a construction manual follows.<br />
<br />
=== Cuvette Holder ===<br />
The essential part of this device is the '''cuvette holder which has also been the most tricky thing to design'''. In short, we had to overcome a dilemma created by the need for an optimal height for the sensor:<br />
* A too low sensor position bears problems with sedimentation as well as light diffraction from the bottom of the cuvette.<br />
* The sensor has to be as close as possible to the bottom so that enough light shines through for the fluorescence measurement.<br />
<br />
As a compromise, we place the sensor at a height of 0.75&nbsp;cm, which, as it turned out later, is very close to one of the standard heights (0.2&nbsp;cm, 0.8&nbsp;cm, 1.2&nbsp;cm) of OD meters. It is important to note that despite the official minimal fill height of 1.2&nbsp;mL of the 1.5&nbsp;mL cuvettes we used, our device also works with filling volumens of just 1&nbsp;mL which in fact comes closer to reality in the lab.<br />
<br />
The final cuvette holder design is rendered from a [https://2014.igem.org/Team:Aachen/Notebook/Engineering/Cuvette3D?action=raw stl-file] shown below:<br />
<br />
<html><br />
<center> <br />
<iframe src="https://2014.igem.org/Team:Aachen/Notebook/Engineering/Cuvette3D?action=render<br />
" width=500px height=500px frameBorder="0"></iframe><br />
</center><br />
</html><br />
<br />
=== Light Filters ===<br />
Once the cuvette holder was finished, '''finding good filters was a tough challenge'''. A main goal throughout our project has been to choose easily available parts which are also inexpensive. Thus choosing Schott glasses as filters unfortunately could not be considered. Instead, filters used for illumination of theaters seemed to be an ideal solution.<br />
<br />
Especially for the fluorescence measurements of GFP finding the right filter has been a big problem. [http://parts.igem.org/Part:BBa_E0040 GFPmut3b] has a peak excitation at 501&nbsp;nm and a peak emission at 511&nbsp;nm - too close together for our low-cost filters to block the excitation light but transmit the emitted light. Thus, we chose to excite at around 485&nbsp;nm reduce false positive results below 500&nbsp;nm. However, no adequate filter for these settings could be found.<br />
Eventually, using the dark greenish [http://leefilters.com/lighting/colour-details.html#736 Twickenham Green] filter only little amounts of light shorter than 500&nbsp;nm gets through, reducing any bias from excitation illumination significantly. Unfortunately, the transmission rate of this filter is quite bad, 20% only, for the target emission wavelength of 511&nbsp;nm.<br />
<br />
For the OD measurement, too, we had similar problems. Indeed, due to our goal of inexpensive parts, we only filter light below 600&nbsp;nm. Further filters would lower the base transmittance and result in a loss of resolution which is not tolerable.<br />
Finally the red filter [http://leefilters.com/lighting/colour-details.html#019 Fire] permits over 70&nbspr; of the light to the sensor and is thus suited for our purposes.<br />
<br />
<html><br />
<sup><span class="anchor" id="fn1"></span>1. Quite a good random number generator from a computer-scientific perspective!<a href="#ref1" title="">↩</a></sup><br />
</html><br />
<br />
== Linearity ==<br />
<span class="anchor" id="lin"></span><br />
As for any scientifc device it is crucial to question the results one gets from the device. To ensure that our device actually works, we performed a set of measurements which are presented below.<br />
<br />
It is crucial that the selected hardware is mapping reality into the digital world of our $\mu$-Controller.<br />
In order to sense reality our setup uses a light to frequency sensor, [https://www.sparkfun.com/datasheets/Sensors/Imaging/TSL235R-LF.pdf TSL235R-LF].<br />
The light to frequency sensor resembles the most to a photo transistor and thus is less sensible to temperature than a light dependant resistor.<br />
Additionally counting a frequency using interrupts seems to be easier and more accurate than using the analog to digital converter.<br />
<br />
Using a dilution series of purified [https://2011.igem.org/Team:Glasgow/LOV2 iLOV] we could determine the characteristic curve for the light sensor. Finally we can conclude that the sensor is linear as expected and shown in the [https://www.sparkfun.com/datasheets/Sensors/Imaging/TSL235R-LF.pdf datasheet].<br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Linearity iFG.PNG|title=Linearity of TSL235R-LF sensor|subtitle=Dilution series of GFP expressing E. coli showing linearity between fluorescence count and dilution.|width=700px}}<br />
</center><br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
[[File:Aachen_Cuvette_button_v1_ipo.png|right|150px]]<br />
<br />
= OD Device =<br />
<span class="anchor" id="od"></span><br />
<br />
We are measuring optical density using the presented cuvette holder.<br />
Particularly for optical density measurement the amount of light shining through the sample is crucial.<br />
If there is too few light, there will be not enough light registered at the sensor, and the resolution of the measurement shrinks. This should be prevented.<br />
The chosen light to frequency sensor is reported to be very sensitive on the amount of light shining on it.<br />
There are reports of the sensor breaking when put into [https://www.sparkfun.com/products/9768 sunlight on a nice day], and not being sensitive at both high light or low light [http://kesslerarduino.wordpress.com/author/kevinmkessler/page/2/ conditions].<br />
<br />
Commercial systems usually use a laser beam to shine through the sample. For reasons of available components, we omitted this in our plans. Finding a suitable orange laser is not easy.<br />
Instead we chose an LED, which unfortunately scatters light, both in the spectrum as well as in all directions.<br />
Using a filter we reduce the effect of scattering.<br />
Finally the [http://leefilters.com/lighting/colour-details.html#019 Fire 019] filters solves our problems, but is far away from ideal.<br />
<br />
== Evaluation ==<br />
=== From Transmittance to True Optical Density ===<br />
At very low levels, uncorrected photometric determinations of cell densities show a decreasing proportionaility to actual cell density.<br />
<br />
This can also be observed using our OD measurement device.<br />
<br />
In general, photometric determination of bacterial concentrations depends primarily on light scattering, rather than light absorption. Therefore. often not absorption is measured, but transmittance. For this, the relationship between optical density (OD) and transmitted light $\frac{I_0}{I}$ exists as:<br />
<br />
$$ OD = \frac{I_0}{I} = \kappa \cdot c$$<br />
<br />
However, this equation is linear only in a certain range.<br />
While one can tackle this non-linearity by using dilutions of the culture, correcting the error systematically is another way to overcome this limitation.<br />
<br />
For our OD device we needed to correlate the transmittance measured by our sensor to an optical density anyway.<br />
Our team members from the deterministic sciences emphasized on the correction method, which was conducted according to Lawrence and Maier [1]:<br />
<br />
* The relative density ($RD$) of each sample in a dilution series is calculated using $\frac{min(dilution)}{dilution}$.<br />
* The uncorrected optical density is derived from the transmission T [%]: $OD = 2 - \log T$<br />
* Finally, the unit optical density is calculated as $\frac{OD}{TD}$.<br />
* The average of the stable unit optical densities is used to calculate the true optical density $ OD_{unit} \cdot RD $.<br />
This way, the correlation between transmission and true optical density can be computed.<br />
The derived function allows the conversion from transmission to optical density on our device and therefore calibrates our device.<br />
<br />
Lawrence and Maier could show that correcting transmittance this way, the corrected optical density shows a linear relationship between true optical density and dry weight in cell suspensions.<br />
<br />
In our experiments, we find in accordance to [1] that the correction majorly depends on the technical equipment used, especially the LED, sensor and cuvettes.<br />
While this at first sight looks disappointing, it is also expected:<br />
Transmittance is the fraction of light not absorbed by some medium relative to the cell-free and clear medium.<br />
However, the transmittance is not only dependent on the amount of cells in the way of the light's beam, but also how much light shines through the cuvette in which fashion, and in which fraction is received by the sensor in which angles.<br />
<br />
Using the above formula we performed this experiment for Pseudomonas putida and Saccharomyces cerevisiae.<br />
<br />
=== Experiments ===<br />
<br />
We performed several experiments during the development of the OD/F device.<br />
Finally we can relate the measured transmittance to the true Optical Density, and further, we can relate that true OD to the one of the photospectrometer in our lab.<br />
By doing to we can calibrate our device to meaningful values.<br />
<br />
We have done this according to the previous section for Pseudomonas putida and Saccharomyces cerevisiae.<br />
<br />
The final function for calculating the OD from the transmission calculated by our device can be calculated as<br />
<br />
$$ OD = f(T) \circ g(device) $$<br />
<br />
where $f$ transforms transforms transmittance to true optical density for our device, and $g$ transforms true optical density of our device into the true optical density of the photospectrometer. This way our device is calibrated according to the photospectrometer.<br />
<br />
==== ''Pseudomonas putida'' ====<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Pputida iFG.PNG|title=True Optical Density to Transmittance plot for P. putida|subtitle=|width=700px}}<br />
</center><br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Pputida OD iFG.PNG|title=Corrolating the true optical density of the OD/F device to true optical density of the photospectrometer|subtitle=|width=700px}}<br />
</center><br />
<br />
==== ''Saccharomyces cerevisiae'' ====<br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Scer iFG.PNG|title=True Optical Density to Transmittance plot for S. cerivisiae|subtitle=|width=700px}}<br />
</center><br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Scer OD iFG.PNG|title=Corrolating the true optical density of the OD/F device to true optical density of the photospectrometer|subtitle=|width=700px}}<br />
</center><br />
<br />
From these plots it can first be seen that our device delivers robust and reproducible results for both procaryotes and eucaryotes.<br />
Also the function from transmittance to true od can be expressed as a lower polynomial function, making its calculation easily possible on a low-end device like a microcontroller.<br />
<br />
Most encouraging is that the function for relating the true OD of our device to the photospectrometer is, as seen by the regression coefficient, close together for both ''P. putida'' and ''S. cerivisae''. In fact, 3.416 and 3.461 are such close together, that the minor deviation could be just measuring inaccuracy.<br />
Therefore we fix the regression coefficient for converting true OD of our device to true OD of the photospectrometer to 3.432 .<br />
<br />
It is interesting to note, that also the function $f$ for the conversion of transmittance to true optical density fit nicely together, as can be seen in the following figure.<br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Pp Sc combined iFG.PNG|title=Combined plot of Transmittance to true Optical Density for P putida and S. cerivisiae|subtitle=|width=700px}}<br />
</center><br />
<br />
By this evaluation we have shown that our self-build optical density measurement device can compete with commercial systems, and moreover, is easy to calibrate by just calculating the true optical density.<br />
Therefore we present a device which measures accurately and is made of easily available parts at a low cost.<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_17-10-14_Glowing_cuvette-ipo.png|right|150px]]<br />
<br />
= F device =<br />
<span class="anchor" id="f"></span><br />
<br />
Similarly to the OD measurement, the fluorescence is measured using the same cuvette holder. In fact, if one does not build a combined device, the only thing one is supposed to change is the cuvette holder. <br />
However, as for optical density measurement, a filter needs to be placed between led, sample and the light sensor.<br />
Selecting the filter has been troublesome.<br />
Either the tried filters had a good transmittance but did not screen for the correct wavelength, or they screened for the correct wavelength but showed bad transmittance.<br />
Finally we chose the [ Twickenham green] filter with bad transmittance, and raised the sampling interval from 1&nbsp;s to 4&nbsp;s to allow a distinct signal.<br />
This is by far not optimal, but delivers stable and reliable results.<br />
<br />
For fluorescence measurement we luckily are not that much relying on the optical density of the cell culture to measure (if the sample contains cells at all).<br />
We compared the values of our device against the [https://2014.igem.org/Team:Aachen/Notebook/LabEquipment platereader].<br />
<br />
== Evaluation ==<br />
Figure 1 shows the absolute measurements for both the platereader and our OD/F device. The abrupt jump at 50% concentration can be explained by a second dilution step and is prevalent in both devices.<br />
It can be seen that the platereader show a much higher difference between the GFP and non-GFP cell culture at a higher standard deviation.<br />
Another interesting metric is the difference between the GFP and non-GFP, which can be seen as the normalized fluorescence measure.<br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachn 15-10-14 F platereader ODF iFG.PNG|title=Fluorescence Measurement comparison OD/F device and Platereader|subtitle=Comparison of a fluorescence measurement of our device and the platereader. Our OD/F device shows no significant.|width=700px}}<br />
</center><br />
<br />
If one compares the results there, as in Figure 2, interesting observations can be made.<br />
First, both platereader and OD/F device show very similar results.<br />
The regression curves differ only in a linear factor.<br />
Most interestingly the general fit of the OD/F device to a linear function seems to be better than the platereader.<br />
Overall the linearity which has been observed earlier (in testing the general setup) could be verified.<br />
Therefore our do-it-yourself OD/F device can be used to determine fluorescence.<br />
At higher concentrations our OD/F device struggles regarding accuracy. However, this is also true for the platereader, but at a lower rate.<br />
<br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 F platereader ODF2 iFG.PNG|title=Fluorescence Measurement comparison OD/F device and Platereader|subtitle=Comparison of a fluorescence measurement of our device and the platereader. Our OD/F device shows no significant. A non-GFP expressing E. coli dilution has been used to normalize the GFP dilution series. A linear correlation can be seen.|width=700px}}<br />
</center><br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-15_DIY_Cellocks_iNB.png|right|150px]]<br />
<br />
= DIY: How to Build Your Own Device =<br />
<span class="anchor" id="diy"></span><br />
== Technical Components ==<br />
<br />
While the casing and the cuvette holder are custom made, most of the parts are pre-made and only need to be bought. The previous section lists all needed parts. To get all these parts for creating your own OD/F device is easy by using the internet. A lot of companies all over the world are specialized in selling electronically equipment not only in the internet but also in local shops. However '''potential customers have a market access''' connected to the parts of building. <br />
<br />
Please find our custom parts for download below. Despite being custom parts, these are quite inenxpensive - so feel free to give our OD/F device a test :) ! <span class="anchor" id="ref2"></span><br />
<br />
* cuvette holder [https://2014.igem.org/Template:Team:Aachen/cuvette.stl?action=raw STL file]<br />
* casing single device [ SVG file]<br />
* casing combined device [ SVG file]<br />
* Arduino Code for single device [https://2014.igem.org/Template:Team:Aachen/arduino_single.ino?action=raw Sketchbook (.ino)]<br />
* Arduino Code for combined device [https://2014.igem.org/Template:Team:Aachen/arduino_combined.ino?action=raw Sketchbook (.ino)]<br />
<br />
You will need a special [http://www.exp-tech.de/images/product_images/description%20images/YWRobot/1602/LiquidCrystal_I2C1602V2.rar library] for the display, which can not be uploaded for legal reasons.<br />
<br />
<br />
'''Table 2''': Needed number of pieces, components and prices for creating your own OD or F device<br />
{| class="wikitable"<br />
! align="center" |'''OD/F device'''<br />
!! align="center" | <br />
!! align="center" |''' 1€='''<br />
!! align="center" |''' $1.27'''<br />
!! align="center" |''' on 14/10/2014'''<br />
!! align="center" | <br />
|-<br />
! Quantity!!Component!! Costs € !! Costs $ !! Final € !! Final $ <br />
|-<br />
| 1||[http://www.dx.com/p/uno-r3-development-board-microcontroller-mega328p-atmega16u2-compat-for-arduino-blue-black-215600#.VDzwV9ysWBp Arduino UNO R3]|| - € || $11.65 || 9.17 € || $11.65 <br />
|-<br />
| 1||[http://www.mouser.com/ProductDetail/ams/TSL235R-LF/%3Fqs%3D14HO7rLZPQsjmBHaoYCzkA%253D%253D&sa=U&ei=3fA8VN3sN8T0OuLPgLAJ&ved=0CCUQ2yk&sig2=WOchotQO4XDym0jpXDjtzw&usg=AFQjCNGNr9DthURC_BKhgthh8EuJhjqutg TSL 235R]|| - € || $3.14 || 2.47 € || $3.14 <br />
|-<br />
| 1||[http://www.dx.com/p/16-x-2-character-lcd-display-module-with-blue-backlight-121356#.VDzxHNysWBp Display 16x2]|| - € || $3.28 || 2.58 € || $3.28 <br />
|-<br />
| 1||[http://www.dx.com/p/lcd1602-adapter-board-w-iic-i2c-interface-black-works-with-official-arduino-boards-216865#.VDzxHNysWBp LCD Display to I2C]|| - € || $1.99 || 1.57 € || $1.99 <br />
|-<br />
| 1||[http://www.newark.com/multicomp/mcpas6b1m1ce3/switch-pushbutton-spst-400ma-125v/dp/12P7696?ost=1638329 Pushbutton]|| - € || $3.69 || 2.90 € || $3.69 <br />
|-<br />
| 1||[http://shop.leefiltersusa.com/Swatch-Book-Designers-Edition-SWB.htm filter leaflet]|| - € || $2.00 || 1.57 € || $2.00 <br />
|-<br />
| 20||[http://www.dx.com/p/diy-male-to-female-dupont-breadboard-jumper-wires-black-multi-color-40-pcs-10cm-339078#.VDzxSdysWBp jumper wire cables]|| - € || $0.11 || 0.09 € || $2.28 <br />
|-<br />
| 1||[http://www.dx.com/p/syb-170-mini-breadboard-for-diy-project-red-140101#.VDzyudysWBo small breadboard]|| - € || $2.51 || 1.98 € || $2.51 <br />
|-<br />
| 1||[http://www.dx.com/p/universal-ac-charger-w-dual-usb-output-for-iphone-ipad-ipod-white-us-plug-244893#.VDzzMNysWBo power supply]|| - € || $2.80 || 2.20 € || $2.80 <br />
|-<br />
| 1||cuvette holder (3D print service of your choice)|| 6.44 € || $8.18 || 6.44 € || $8.18 <br />
|-<br />
| 1||3&nbsp;mm acrylic glas (black)|| 7.98 € || $10.14 || 7.98 € || $10.14 <br />
|-<br />
| 1||[http://www.dx.com/p/prototype-universal-printed-circuit-board-breadboard-golden-10-piece-pack-143913#.VDz3ttysWBo Prototype Universal Printed Circuit Board]|| - € || $2.88 || 2.27 € || $2.88 <br />
|-<br />
| 1||[http://www.dx.com/p/2-54mm-1x40-pin-breakaway-straight-male-header-10-piece-pack-144191#.VDz4HtysWBo Male Headers]|| - € || $2.72 || 2.14 € || $2.72 <br />
|-<br />
| || || || || || <br />
|-<br />
| 1||[http://www.mouser.de/ProductDetail/Dialight/550-2505F/?qs=0KZIkTEbAAvqMAW7suDOXg== LED 600nm]|| 0.99 € || $1.11 || 0.87 € || $1.11 <br />
|-<br />
! Total OD !!!!!!!! 45.94 € !! $58.37 <br />
|-<br />
| 1||[http://www.leds.de/Low-Mid-Power-LEDs/SuperFlux-LEDs/Nichia-Superflux-LED-blau-3lm-100-NSPBR70BSS.html LED 480nm]|| 0.99 € || $1.26 || 0.99 € || $1.26 <br />
|-<br />
! Total F !!!!!!!! 46.06 € !! $58.52 <br />
|-<br />
| 1||[http://www.mouser.de/ProductDetail/Dialight/550-2505F/?qs=0KZIkTEbAAvqMAW7suDOXg== LED 600nm]|| 0.99 € || $1.11 || 0.87 € || $1.11 <br />
|-<br />
| 1||[http://www.leds.de/Low-Mid-Power-LEDs/SuperFlux-LEDs/Nichia-Superflux-LED-blau-3lm-100-NSPBR70BSS.html LED 480nm]|| 0.99 € || $1.26 || 0.99 € || $1.26 <br />
|-<br />
! Total OD/F !!!!!!!! 47.05 € !! $59.78 <br />
|-<br />
|}<br />
<br />
For more detailed economical information about the OD/F project visit our [https://2014.igem.org/Team:Aachen/PolicyPractices/Economics Economical View] page.<br />
<br />
== Breadboards ==<br />
<br />
=== Optical Density ===<br />
<br />
{{Team:Aachen/Figure|Aachen ODdevice Steckplatine.png|align=center|title=Breadboard of our OD device|subtitle=To build your own OD device, connect the parts as shown in this diagram.|width=900px}}<br />
<br />
If you want to build our OD device, make sure to use the following secret ingredients:<br />
* Filter: [http://www.leefilters.com/lighting/colour-details.html#019 Fire 019]<br />
* LED: [http://www.mouser.de/ProductDetail/Dialight/550-2505F/?qs=0KZIkTEbAAvqMAW7suDOXg== 600 nm] Dialight 550-2505F<br />
<br />
=== Fluorescence ===<br />
<br />
{{Team:Aachen/Figure|Aachen_Fdevice_Steckplatine.png|align=center|title=Our novel biosensor approach|subtitle=Expression of the TEV protease is induced by HSL. The protease cleaves the GFP-REACh fusion protein to elecit a fluorescence response.|width=900px}}<br />
If you want to build the OD device, make sure to use the following secret ingredients:<br />
* Filter: [http://www.leefilters.com/lighting/colour-details.html#736 Twickenham Green 736]<br />
* LED: [http://www.leds.de/Low-Mid-Power-LEDs/SuperFlux-LEDs/Nichia-Superflux-LED-blau-3lm-100-NSPBR70BSS.html 480 nm] NSPBR70BSS LED<br />
<br />
=== Combined Device ===<br />
Even though evaluation of the measurements have been performed in two separate device, it is fairly well possible to put everything into one casing.<br />
All you need to do is choosing another lid, and connect a second light to frequency sensor to your Arduino.<br />
Right at the bottom we present you the differences in wiring things up.<br />
Building the combined device is straight forward and very similar to the single device. You will need a slightly larger connector, a different lid for your case, and maybe more cables. The changed fritzing-layout is presented below.<br />
<br />
{{Team:Aachen/Figure|Aachen_ODF_combined_Steckplatine.png|align=center|title=Our novel biosensor approach|subtitle=Expression of the TEV protease is induced by HSL. The protease cleaves the GFP-REACh fusion protein to elecit a fluorescence response.|width=900px}}<br />
<br />
== Construction Steps ==<br />
{| class="wikitable centered"<br />
|-<br />
| [[File:Aachen_ODF_9.JPG|300px]] || First we want to assemble the casing. Once you have all the cut parts, you can start to assemble them. For cutting, we really recommend using a laser cutter.<br />
|-<br />
| [[File:Aachen_ODF_8.JPG|300px]] || Attach the cuvette-holder holders such that the cuvette holder is placed directly under the opening hole.<br />
|-<br />
| [[File:Aachen_ODF_4.JPG|300px]] || Next build the lid of the device. At this stage you can already mount the button. We recommend to glue any parts.<br />
|-<br />
| [[File:Aachen_ODF_3.JPG|300px]] || Your lid finally should look like this.<br />
|-<br />
| [[File:Aachen_ODF_11.JPG|150px]][[File:Aachen_ODF_10.JPG|150px]] || Next we want to assemble the cuvette holders. On the side with the square hole attach the light-to-frequency sensor with glue. For the OD case place the orange LED opposite, or for fluorescence, the LED in the hole in the bottom. Make sure to close any remaining open hole! Please attach a piece of filter foil (approx. $7 \times 7 mm^2$) from the inside in front of the light to frequency converter. Forceps is highly recommended.<br />
|-<br />
| [[File:Aachen_ODF_12.JPG|300px]] || Your final assembly should then look like this. Now place the correct filter into the cuvette holder, directly in front of the sensor. Make sure that the filter does not degrade due to the glue!<br />
|-<br />
| [[File:Aachen_ODF_14.JPG|300px]] || As the case can be used for both, fluorescence and OD measurement, we use a combined plug. Just three header rows (7 pins, 9pins for combined) and connect them as we did.<br />
|-<br />
| [[File:Aachen_ODF_1.JPG|300px]] || Now we're doing the wiring. Connect the Arduino 5V and GND such that you have one 5V and one GND line on your breadboard.<br />
|-<br />
| [[File:Aachen_ODF_2.JPG|300px]] || Then connect the button to 5V on the one side, and to GND via a resistor on the other side. Connect this side also to port __ on your Arduino. This will sense the blank. Next connect the display to the Arduino and our connector. See the Fritzing diagram at the bottom for a detailed information.<br />
|-<br />
| [[File:Aachen_ODF_13.JPG|300px]] || Now put everything into the case and ...<br />
|-<br />
| [[File:Aachen_ODF_6.JPG|300px]] || ... also place the cuvette holder into the device. Attach the display to the device lid and close the casing.<br />
|-<br />
| [[File:Aachen_ODF_7.JPG|300px]] || Congratulations! You have finished constructing your own OD/F device!<br />
|-<br />
| [[File:Aachen_zwei_Kuevetten.jpg|300px]] || ... or even the combined device!<br />
|}<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
== References ==<br />
Lawrence, J. V., & Maier, S. (1977). Correction for the inherent error in optical density readings. Applied and Environmental Microbiology, 33(2), 482–484. Available at: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=170707&tool=pmcentrez&rendertype=abstract.<br />
<br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Notebook/Engineering/WatsOnTeam:Aachen/Notebook/Engineering/WatsOn2014-10-17T16:44:24Z<p>VeraA: /* Hardware */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
= ''WatsOn'' =<br />
<br />
This page contains technical details and construction manuals for our measurement device ''WatsOn'' as well as information on the software controlling the hardware. For more details, please click on the respective tile. For the image analysis software, please visit our [https://2014.igem.org/Team:Aachen/Notebook/Software/Measurarty ''Measurarty''] page.<br />
<br />
<html><br />
<center><br />
<ul class="team-grid" style="width:inherit;"><br />
<!-- Overview --><br />
<br />
<li><a href="https://2014.igem.org/Team:Aachen/Notebook/Engineering/WatsOn#watsonhardware" style="color:black"><br />
<div class="team-item team-info" ><br />
<div class="menukachel">Hardware</div><br />
<!-- <br />
<br/><br/><br />
<b>Hardware</b><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/5/59/Aachen_14-10-16_Hardware_button_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"> </div></a><br />
</li><br />
<br />
<br />
<li><a href="https://2014.igem.org/Team:Aachen/Notebook/Engineering/WatsOn#watsonsoftware" style="color:black"><br />
<div class="team-item team-info" ><br />
<div class="menukachel">Software</div><br />
<!-- <br/><br><br />
<b>Software</b><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/1/13/Aachen_14-10-16_Software_button_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"> </div></a><br />
</li><br />
<br />
<li><a href="https://2014.igem.org/Team:Aachen/Notebook/Engineering/WatsOn#watsondiy" style="color:black"><br />
<div class="team-item team-info" ><br />
<div class="menukachel">DIY</div><br />
<!-- <br/><br/><br />
<b>DIY</b><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/9/9e/Aachen_14-10-15_DIY_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"> </div></a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
= Hardware =<br />
<span class="anchor" id="watsonhardware"></span><br />
<br />
{{Team:Aachen/FigureFloat|Aachen_Device_11.jpg|title=''WatsOn''|subtitle= |width=200px}}<br />
<br />
Our hardware consists of the casing and the electronical components. The casing which can be seen on the left was built from laser cut acrylic glass. A detailed description of the assembly is described in the section [https://2014.igem.org/Team:Aachen/Notebook/Engineering/WatsOn#watsondiy Build your own ''WatsOn].<br />
<br />
''Download the laser cutting plan here: [https://2014.igem.org/File:Aachen_WatsOn_laser_cut.svg.zip Download] (for acrylic glass with a height of 6&nbsp;mm)<br />
<br />
<br />
The connection between the different electronical elements is visualized below.<br />
<br />
<br />
<br />
{{Team:Aachen/Figure|Aachen_Device_Hardware_Graphics.png|title=Eletronical components||width=750px}}<br />
<br />
* '''Raspberry Pi''' : The Raspberry Pi is a small single-board computer which runs a Linux operating system from an inserted SD card. The steps which are required to set up a fully working system are described in the [https://2014.igem.org/Team:Aachen/Notebook/Engineering/WatsOn#pisetup DIY section] of this page. The main purpose of the Raspberry Pi is to run the software described above, to control the attached camera and to show the GUI on the display. The big advantage of this board is that it is very powerful, cheap and therefore perfectly fit for our needs.<br />
<br />
* '''Raspberry Pi camera''': The camera is directly connected to the Raspberry Pi board and takes the images of the chips.<br />
<br />
* '''Arduino''': The Arduino board is also a single-board computer with less computing power than the Raspberry Pi but with a greater focus on controlling electronical components. Therefore, it is used to control the LEDs and the Peltier heater.<br />
<br />
* '''Relay''': The 2-channel relay works like two light switches which are either turned on or off. They control the 450&nbsp;nm and 480&nbsp;nm LEDs. The channels are connected and turned on and off by the Arduino board.<br />
<br />
* '''Peltier element''': A Peltier component transforms an applied power into a temperature gradient which leads to a hot surface on one side of the element and a cooler one on the other side. The Peltier element connected to the aluminum block heats up the interior of the device to incubate the sensing cells at 37°C.<br />
<br />
* '''USB WiFi stick''': The USB WiFi stick connects the Raspberry Pi to a local network.<br />
<br />
* '''Display''': An 8-digit display is connected to the Arduino board and shows the current interior temperature<br />
<br />
{{Team:Aachen/FigureFloatRight|Aachen_Filter_010.png|title=010|subtitle=|width=70px}}<br />
{{Team:Aachen/FigureFloatRight|Aachen_Filter_505.png|title=505|subtitle=|width=70px}}<br />
<br />
* '''Filter slides''': To block the undesired wavelenghts emitted from the LEDs a filter slide is placed in front of the camera. This step is taken to get a clear fluorescence signal from the chips. The characteristic of the filter slide is selected depending on the frequency of the LEDs which are either 450&nbsp;nm or 480&nbsp;nm ones. We used '505 Sally Green' for the 450&nbsp;nm and '010 Medium Yellow' for the 480&nbsp;nm LEDs. The filters are shown on the right.<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
= Software =<br />
<span class="anchor" id="watsonsoftware"></span><br />
<br />
The software consists of several parts which provide a user interface and manage the connection to the hardware.<br />
The scheme below shows the different components of the software:<br />
<br />
<br />
[[File:Aachen_Device_GUI.png|center|800px]]<br />
<br />
===GUI (Graphical User Interface)===<br />
On the graphical interface, the user can take images and time lapses of the chips inside the device. The software is written in C++. It makes use of the [http://qt-project.org/ Qt-Library] to provide a clear interface and a comfortable way to manage various software aspects such as handling images and establishing network connections. An advantage resulting from the utilization of Qt-Library is the multi-platform support for Windows, MacOS and Linux. Additionally, Qt is available with an Open Source license which can be used for free. The software can be used locally on the Raspberry Pi or remotely from a device in the same network.<br />
<br />
Features of the GUI include:<br />
* Change settings (1):<br />
** The user can specify the iso-value and the shutter speed of the camera.<br />
** Custom settings can be labeled and saved for future reference.<br />
** Existing settings can be updated or deleted unless they are default configurations.<br />
** The excitation wavelength of GFP (480&nbsp;nm) and iLOV (450&nbsp;nm) can be selected.<br />
* Take image/s (2): <br />
** The GUI offers two possibilities to take images:<br />
*** Take a single image with the active camera settings.<br />
*** Take time lapse shootings with the active camera settings and the specified interval. When activated, the images are saved automatically to a user defined directory with ascending filenames.<br />
** The last image which was taken by the camera is shown in the GUI, information containing the time stamp and used camera settings are displayed next to the image (3). Previous images can be selected with the arrow buttons.<br />
* Analyze image (4):<br />
** The image is analyzed by an image segmentation algorithm and shows whether the pathogen ''Pseudomonas&nbsp;aeruginosa'' is present on the chip or not<br />
<br />
===Backend===<br />
The backend is a software that runs on the Raspberry Pi and is responsible for the connection between the GUI and the hardware. If the user interface is executed on another device, e.g. a notebook, it has to be in the same network as the Raspberry Pi. The backend works like a web server that receives commands and acts according to the submitted parameters. It can take images and returns them to the GUI.<br />
<br />
Before an image is taken, the backend turns on the specified LEDs by sending a command to the connected Arduino board. Afterwards, the LEDs are turned off using the same mechanism. These steps are repeated in the given interval for a time lapse shooting.<br />
<br />
''Download the backend sourcecode:'' [https://2014.igem.org/File:Aachen_Device_Backend.zip Download]<br />
<html><br></html><br />
<br />
{{Team:Aachen/Figure|Aachen_Device_SoftwareBackend.png|title=Sample connection between GUI and backend for taking an image|subtitle= |width=900px}}<br />
<br />
===Arduino===<br />
The software on the Arduino board sets the power and thus controls the temperature of the Peltier heater. The power is set by evaluating the received values from the temperature sensors for the interior of the device and the aluminum block. Additionally, the Arduino receives commands from the Raspberry Pi to turn the LEDs on and off.<br />
<br />
''Download the Arduino sourcecode:'' [https://static.igem.org/mediawiki/2014/1/1e/Aachen_WatsOn_arduino.ino.zip Download] <br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-15_DIY_Cellocks_iNB.png|right|150px]]<br />
<br />
= DIY: How To Build Your Own ''WatsOn'' =<br />
<span class="anchor" id="watsondiy"></span><br />
<br />
==Technical Components==<br />
If you want to create your own ''WatsOn'' first take a look at the following list of necessary components. All parts except the laser cut acrylic glass can be readily purchased and do not require further adjustments.<br />
<br />
'''All needed components, their quantities and prices for creating your own ''WatsOn'''''<br />
{| class="wikitable sortable"<br />
! align="center" |'''''WatsOn'''''<br />
!! align="center" | <br />
!! align="center" |''' 1€='''<br />
!! align="center" |''' $1.27'''<br />
!! align="center" |''' on 14/10/2014'''<br />
!! align="center" | <br />
|- class="unsortable"<br />
!Quantity !! Component !! Costs [€]!! Costs [$]!! Final [€]!! Final [$]<br />
|-<br />
| 1|| [http://www.prolighting.de/Zubehoer/Farbfilter/Lee-Filter_HT/Lee-Filters_Musterheft_Designer_Edition_i174_3965_0.htm filter slides] (medium yellow 010, sally green 505)||1.57||2.00||1.57||2.00<br />
|-<br />
| 1|| [http://www.dx.com/p/uno-r3-development-board-microcontroller-mega328p-atmega16u2-compat-for-arduino-blue-black-215600 Arduino UNO R3]||9.17||11.65||9.17||11.65<br />
|-<br />
| 1|| [http://www.dx.com/p/arduino-2-channel-relay-shield-module-red-144140 2-channel relay shield]||2.72||3.46||2.72||3.46<br />
|-<br />
| 40||jumper-wire cable||2.35||2.99||2.35||2.99<br />
|-<br />
| 1|| [http://www.dx.com/p/2-54mm-1x40-pin-breakaway-straight-male-header-10-piece-pack-144191 40er male header (10-Piece Pack)]||2.14||2.72||2.14||2.72<br />
|-<br />
| 1|| [http://www.dx.com/p/jtron-2-54mm-40-pin-single-row-seat-single-row-female-header-black-10-pcs-278953 40er female header (10-Piece Pack)]||2.05||2.60||2.05||2.60<br />
|-<br />
| 1|| [http://www.dx.com/p/prototype-universal-printed-circuit-board-breadboard-brown-5-piece-pack-130926 circuit board]||2.35||2.99||2.35||2.99<br />
|-<br />
| 1|| [http://www.newark.com/pro-signal/rp006/audio-video-cable-hdmi-1m-black/dp/96T7446 HDMI cable]||1.47||1.87||1.47||1.87<br />
|-<br />
| 1|| [http://www.dx.com/p/hd-053-high-speed-usb-2-0-7-port-hub-black-174817 7 port USB hub]||5.28||6.71||5.28||6.71<br />
|-<br />
| 1||[http://www.dx.com/p/dx-original-ultra-mini-usb-2-0-802-11n-b-g-150mbps-wi-fi-wlan-wireless-network-adapter-black-252716 USB WiFi stick]||4.21||5.35||4.21||5.35<br />
|-<br />
| 1||USB mouse and keyboard||9.84||12.50||9.84||12.50<br />
|-<br />
| 1|| [http://corporate.evonik.com/en/products/pages/default.aspx case acrylic glass XT 6mm~0.5<sup>2</sup>]||39.88||50.65||39.88||50.65<br />
|-<br />
| 1||spray paint for acrylic glass||5.15||6.54||5.15||6.54<br />
|-<br />
| 1|| [http://www.newark.com/raspberry-pi/raspberry-modb-512m/raspberry-pi-model-b-board/dp/68X0155 Raspberry Pi model B board]||27.56||35.00||27.56||35.00<br />
|-<br />
| 1||[http://www.newark.com/raspberry-pi/rpi-camera-board/add-on-brd-camera-module-raspberry/dp/69W0689 Raspberry Pi camera module]||19.69||25.00||19.69||25.00<br />
|-<br />
| 1||[http://www.pollin.de/shop/dt/NzUwOTc4OTk-/ 7” display]||39.35||49.97||39.35||49.97<br />
|-<br />
| 1||[http://www.dx.com/p/diy8-x-seven-segment-displays-module-for-arduino-595-driver-250813 8-segment display]||3.04||3.86||3.04||3.86<br />
|-11.81<br />
| 2|| [http://www.dx.com/p/arduino-dht11-digital-temperature-humidity-sensor-138531 digital temperature sensor DHT-22]||5.91||7.50||11.82||15.00<br />
|-<br />
| 1 ||aluminum block 100x100x15 mm||11.20||14.23||11.20||14.23<br />
|-<br />
| 1|| [http://www.dx.com/p/tec1-12706-semiconductor-thermoelectric-cooler-peltier-white-157283 Peltier heater 12V 60W]||3.54||4.49||3.54||4.49<br />
|-<br />
| 1||power supply||25.90||32.89||25.90||32.89<br />
|-<br />
| 6|| [http://www.leds.de/Low-Mid-Power-LEDs/SuperFlux-LEDs/Nichia-Superflux-LED-blau-3lm-100-NSPBR70BSS.html superflux LED 480nm]||0.99||1.26||5.94||7.54<br />
|-<br />
| 16||LED 450nm||0.37||0.47||5.94||7.54<br />
|-<br />
| 2|| Resistor 40 Ohm||0.12||0.15||0.24||0.30<br />
|-<br />
| 4|| Resistor 100 Ohm||0.12||0.15||0.48||0.60<br />
|-<br />
| 1||cupboard button||0.98||1.24||0.98||1.24<br />
|- class="sortbottom" style="background:#cfe2f4; border-top:2px #808080 solid; font-weight:bold"<br />
| -||total||-||-||243.88||309.70<br />
|}<br />
<br />
You can find more economical information on ''WatsOn'' and on the project on our [https://2014.igem.org/Team:Aachen/PolicyPractices/Economics Economical View] page.<br />
<br />
<br />
For building our '''WatsOn''' we used some tools that are not included in the list of necessary components because we assume that they are already available. We used a soldering iron to solder the resistors to the LEDs and fix the headers on the mount of the LEDs. For building electrical circuits our multimeter was very helpful. Furthermore, we applied special glue for plastic to hold the acrylic glass in place. All other components were fixed with tape or hot glue which is versatile and can be removed quickly during alignment of components.<br />
<br />
==Breadboard==<br />
<br />
{{Team:Aachen/Figure|Aachen_Device_Fritzing.png|align=center|title=Wiring of our device||width=900px}}<br />
<br />
==Construction Manual==<br />
<br />
{| class="wikitable centered"<br />
|-<br />
| [[File:Aachen_Device_1.jpg|300px]] || Start building your own ''WatsOn'' by assembling the base plate, the sides and the interior wall.<br />
|-style="border-top: 2px #808080 solid;"<br />
| [[File:Aachen_Device_2_3.jpg|350px] [File:Aachen_Device_.3jpg|300px]] || Fix the Peltier heater on the back of the aluminum block and place it in the hole of the interior wall.<html><br/></html>Arrange the 4x4 450&nbsp;nm LEDs and the 2x3 480&nbsp;nm LEDs<br />
|-style="border-top: 2px #808080 solid;"<br />
| [[File:Aachen_Device_7.jpg|350px]] || Assemble the camera holder with the camera and the corresponding filter slide on the lower part. Above the camera, you can place the temperature sensor for measuring the indoor temperature. Finally, put the fan on the back of the camera holder. <br />
|-style="border-top: 2px #808080 solid;"<br />
| [[File:Aachen_Device_8.jpg|350px]] || Connect the electronic components on the outside and the inside according to the wiring diagramm.<br />
|-style="border-top: 2px #808080 solid;"<br />
| [[File:Aachen_Device_4.jpg|350px]] || Put together the drawer.<br />
|-style="border-top: 2px #808080 solid;"<br />
| [[File:Aachen_Device_9.jpg|350px]] || Position the front panel and insert the drawer.<br />
|-style="border-top: 2px #808080 solid;"<br />
| [[File:Aachen_Device_10.jpg|350px]] || Place the temperature sensor measuring the aluminum block temperature directly on the block and put the back panel in front of it.<br />
|-style="border-top: 2px #808080 solid;"<br />
| [[File:Aachen_Device_6.jpg|350px]] || Setup the power supply<sup>[https://2014.igem.org/Team:Aachen/Notebook/Engineering/WatsOn#fn1 1]</sup> and connect all devices to either 5&nbsp;V or 12&nbsp;V. The placed it into a aluminium casing for security reasons. Plug the USB hub connector into the Raspberry. If you use the GUI locally on the device a mouse and a keyboard need to be attached to the USB hub to navigate on the user interface. Follow the steps described in the section ‘Raspberry Pi - Setup’[https://2014.igem.org/Team:Aachen/Notebook/Engineering/WatsOn#watsondiy].<br />
|-style="border-top: 2px #808080 solid;"<br />
| [[File:Aachen_Device_11.jpg|350px]] || Mount the device on top of the power supply casing. Add the display and apply some stickers to enjoy your custom-made ''WatsOn''.<br />
|}<br />
<br />
<br />
By German law only certified electricians may work on 230&nbsp;V electronics. Therefore, the electrical workshop at our institute created the power supply specifically for our design.<br />
<br />
== Raspberry Pi - Setup ==<br />
<span class="anchor" id="pisetup"></span><br />
<br />
In order to get a running linux system on the Raspberry Pi which includes all required components and configurations the following steps have to be considered:<br />
<br />
* The Raspberry Pi needs an SD card on which the operating system will be installed. Go to the [http://www.raspberrypi.org/downloads/ download page of the Raspberry Pi Foundation] and select an operating system of your choice - we used Raspbian - or just download the NOOBS package which offers all different operating systems during setup. <br />
* Follow the specific image installation guidelines to install the downloaded system onto your SD card.<br />
* Once finished, insert the SD card in the slot on the Raspberry Pi board, connect a monitor over HDMI, plug in a USB mouse and keyboard and start the Raspberry Pi by connecting it to the micro USB power supply. Follow the installation instructions; these should be straightforward. After the installation you will be shown the desktop of your new system.<br />
* To be able to use the Raspberry Pi camera you need activate it over a terminal. Search for a desktop icon labeled "LxTerminal", double click it and a terminal will appear where you can enter commands which will be executed after you press Return. Enter "raspi-config", press Return and activate the camera with the displayed corresponding option.<br />
* Download the source files for the backend server and the graphical user interface (GUI). To be able to compile the GUI, you need to install the Qt5-libraries. Follow [http://qt-project.org/wiki/Native_Build_of_Qt5_on_a_Raspberry_Pi this guide] on how to get the Qt source code, compile it and setup your environment correctly. Make sure that your Raspberry Pi is constantly running, since this process takes some time and must not be interrupted.<br />
* With the Qt-libraries installed, open a terminal and change to the directory where you put the source for the GUI (command "cd [path to source]"). Call "qmake" followed by "make" and you will start compilation of the program. When finished, you can launch the GUI with the command "./igem_GUI".<br />
* The backend - that will establish the connection between hardware and the user interface - requires you to install additional packages for Python which is a high-level general-purpose programming language and an interpreter that will ship with your system. Open the README in the "Backend" directory and follow the instructions.<br />
* You now should be able to launch the backend by calling "python takeimageserver.py &" from the terminal.<br />
* Now start the GUI. An input dialog will show up asking you to provide the IP address of the backend server or the Raspberry Pi, respectively. Since you are running the GUI and the backend on the same device, just press Enter to select the default entry which is the IP of the local host. After a few seconds, when the connection to the backend server has been established, the user interface gets enabled and you can start to take images and time lapse shootings. If the image is not focused you need to adjust the lense in front of the camera by rotating it. For the full list of features refer to the [https://2014.igem.org/Team:Aachen/Notebook/Engineering/WatsOn#watsonsoftware Software section] of this page.<br />
<br />
In case you want to run the GUI on a remote machine, e.g. your notebook, follow these additional steps:<br />
<br />
* Install the [http://qt-project.org/ Qt-libraries and QtCreator] on your system. This is just an installation - you do not have to compile it. Get the source code for the GUI and open the ".pro" file with QtCreator. After importing the project and selecting a built directory, click the green arrow on the left side. Compilation is started and as soon as it is finished the GUI will start. <br />
* In order to be able to connect to the Raspberry Pi you need to be connected to the same network. Therefore, make sure the Raspberry Pi USB wifi stick is working properly (see [https://2014.igem.org/Team:Aachen/Notebook/Engineering/WatsOn#pitrouble Troubleshooting & Useful Links]), and that you reside in the same network. Start the backend server on the Raspberry Pi. It will print the IP address on start up which you must enter in the GUI on your device running the GUI. Now you should be able to use all the features as if running the GUI on the Raspberry Pi.<br />
<br />
=== Troubleshooting & Useful Links ===<br />
<span class="anchor" id="pitrouble"></span><br />
<br />
* Display resolution: If your connected display is not working properly you may refer to<br />
** http://elinux.org/RPiconfig#Video<br />
** http://www.raspberrypi.org/forums/viewtopic.php?f=29&t=24679<br />
<br />
* Network configuration:<br />
** http://www.raspberrypi.org/documentation/configuration/wireless/README.md<br />
<br />
<br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/JuneTeam:Aachen/Notebook/Wetlab/June2014-10-17T16:38:29Z<p>VeraA: /* 20th */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= June =<br />
== 3rd ==<br />
* 34 BioBricks were transformed<br />
<br />
== 4th ==<br />
<br />
* Preparation of consumables: <br />
** fresh 50% glycerol<br />
** new LB plates with cam and with kanamycin (kan)<br />
** 60 glas tubes<br />
** 2&nbsp;L LB<sup>-</sup><br />
** 100&nbsp;mL steril glas beads for plating<br />
<br />
* Master plates (6 clones per BioBrick) were made<br />
<br />
== 5th ==<br />
* Colony PCRs on all transformed BioBricks were conducted<br />
*: &rarr; 2 clones from each master plate were picked<br />
* Overnight cultures in freshly prepared 5&nbsp;mL LB + cam were inoculated<br />
*: &rarr; 1 culture per BioBrick<br />
<br />
== 6th ==<br />
* 2 glycerol stocks of each BioBrick were made<br />
<br />
== 14th ==<br />
'''PCR of E0030 to K1319000'''<br />
* Q5 and Phusion polymerase were used<br />
<center><br />
{| class="wikitable"<br />
! Parameter !! Duration !! Temp [°C]<br />
|-<br />
| Denature||5:00||98<br />
|-<br />
| '''Denature'''||00:30||98<br />
|-<br />
| '''Anneal'''||00:30||55<br />
|-<br />
| '''Elongate'''||00:50||72<br />
|-<br />
| Elongate||05:00||72<br />
|}<br />
</center><br />
&rarr; 30 cycles<br />
<br />
== 17th ==<br />
* Colony PCR on following constructs:<br />
<center><br />
{| class="wikitable"<br />
|-<br />
! ID !! Colony !! Product Length <br />
|-<br />
| 1, 2 || K1319000 || 1041<br />
|-<br />
| 3, 4 || J23115.E0240 || 1233<br />
|-<br />
| 5, 6|| C0062 || 2937<br />
|-<br />
| 7, 8 || K516032 || 1219<br />
|-<br />
| 9, 10 || J23101.E0240 || 1233<br />
|-<br />
| 11 || negativ control || -<br />
|}<br />
</center><br />
&rarr; Anneling: 50°C<br />
<br />
&rarr; Elongation: 02:57<br />
<br />
== 20th ==<br />
* Colony PCR of K325108, K325218, C0062<br />
<br />
<center><br />
{| class="wikitable"<br />
! Parameter !! Duration !! Temp [°C]<br />
|-<br />
| Denature||5:00||95<br />
|-<br />
| '''Denature'''||00:30||95<br />
|-<br />
| '''Anneal'''||00:30||49<br />
|-<br />
| '''Elongate'''||03:15||72<br />
|-<br />
| Elongate||05:00||72<br />
|}<br />
</center><br />
&rarr; 30 cycles<br />
* PAGE: 30 min on 1.2% agarose gel at 110&nbsp;V<br />
&rarr; weak bands for K325108 a & b at 4.5&nbsp;kb and 9&nbsp;kb respectively<br />
<br />
== 23rd ==<br />
* Yesterdays colony PCR was repeated<br />
* Precultures for plasmid preps were inoculated<br />
** K1319000 &rarr; sequencing<br />
** K592100 &rarr; BFP<br />
** S01022 &rarr; CFP<br />
** J23101.E0240 &rarr; sequencing<br />
** J23115.E0240 &rarr; sequencing<br />
* K516132 and J23101.E0240 were plated on LB + cam plates<br />
<br />
== 24th ==<br />
* 8 plasmid preps were conducted<br />
* Overnight cultures of K516132 and J23101.E0240 were inoculated<br />
<br />
== 25th ==<br />
* Preculture for competent NEB10β cells was set up<br />
* Samples for sequencing were submitted<br />
* Master plates of transformed BioBricks were made<br />
* Overnight expression cultures of J23101.E0240 and K516132 were centrifuged and frozen<br />
* Fresh 50% glycerol was prepared<br />
<br />
== 26th ==<br />
* Competent NEB10β cells were made, however, several things went wrong. (For future reference: pre-cool centrifuge, always check if it is indeed spinning, frequently check OD of the culture)<br />
* Colony PCR on the transformed clones looked awful; there were too many cells in the 10&nbsp;µL reaction volume. Some tubes were not fully sealed during the PCR. Basically, ''only'' primers and smear, except for the positive control, which contained a plasmid template instead of cells.<br />
* 2x 500&nbsp;mL of fresh LB and three sterile flasks were prepared and autoclaved.<br />
<br />
== 27th ==<br />
* Plasmid preps<br />
<center><br />
{| class="wikitable"<br />
|-<br />
! Plasmid !! DNA [ng/µl] <br />
|-<br />
| J23115.E0240 #1 || 99<br />
|-<br />
| J23115.E0240 #2 || 226<br />
|-<br />
| K1319000 #6 || 78<br />
|-<br />
| K1319000 #1 || 221<br />
|-<br />
| K592100 || 240.5<br />
|-<br />
| S01022 || 160<br />
|-<br />
| J23101.E0240 #5 || 347<br />
|-<br />
| J23101.E0240 #6 || 229.5<br />
|}<br />
</center><br />
* Two cryos stocks of each were prepared<br />
<br />
== 28th ==<br />
* Sequencing<br />
* Transformation of 17 BioBricks<br />
<br />
== 30th ==<br />
* Master plates<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Project/2D_BiosensorTeam:Aachen/Project/2D Biosensor2014-10-17T16:28:07Z<p>VeraA: </p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
= 2D Biosensor =<br />
<br />
With our 2D biosensor technology we are able to detect the pathogen ''Pseudomonas aeruginosa'' on solid surfaces. The sensor system is comprised of '''two distinct but inseparable modules''', a biological and a technical part:<br />
<br />
* Sensing chips containing '''''Cellocks''''', our '''engineered detective cells''' that fluoresce in the presence of the pathogen, make up the biological part of ''Cellock Holmes''.<br />
* Our '''measurement device [https://2014.igem.org/Team:Aachen/Project/Measurement_Device ''WatsOn'']''' and the complementary '''software [https://2014.igem.org/Team:Aachen/Notebook/Software/Measurarty ''Measurarty'']''' complete our sensing technology on the technical side. <br />
<br />
<center><br />
<html><ul class="team-grid" style="width:1064px;"><br />
<!-- Overview --><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Project/2D_Biosensor#biosensorpoo" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<div class="menukachel">Principle of Operation</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/6/6e/Aachen_15-10-14_Principle_of_operation_2D_sensor_ipo.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Project/2D_Biosensor#biosensordevelopment" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<div class="menukachel">Development & Optimization</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/a/a7/Aachen_14-10-16_Iterative_Process_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Project/2D_Biosensor#biosensorachievements" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<div class="menukachel">Achievements</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/e/ef/Aachen_14-10-15_Medal_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Project/2D_Biosensor#biosensoroutlook" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<div class="menukachel">Outlook</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-16_Outlook_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_15-10-14_Principle_of_operation_2D_sensor_ipo.png|right|150px]]<br />
<br />
== Principle of Operation ==<br />
<span class="anchor" id="biosensorpoo"></span><br />
<br />
''Cellock Holmes'' is designed upon a SynBio approach comprising a '''two-dimensional biosensor and a measurement unit'''. The two-dimensional biosensor is devised to recognize quorum sensing molecules secreted by the pathogen cells and to generate a distinct fluorescence signal; while the measurement device recognizes and analyzes the produced signal. <br />
<br>On the molecular side, we use the '''[https://2014.igem.org/Team:Aachen/Project/FRET_Reporter REACh construct]''' to transform regular ''E. coli'' cells into ''Cellocks''.<br />
<br />
{{Team:Aachen/Figure|Aachen 17-10-14 The basics of quorum sensing ipo.png||title=The principle of quorum sensing|subtitle=Microorganisms can sense the presence of their own kind based on quorum sensing which is a form of chemical communication. Depending on their cell density, quorum sensing allows these cells to activate or deactivate certain gene expression cascades (Waters and Bassler, 2005) for a specific function.|width=900px}}<br />
<br />
Our '''sensor cells, ''Cellocks'', are immobilized in agar chips'''. To make the chips, we mix the ''Cellocks'' with liquid LB agar. <br />
In the course of our project, we designed a casting mold specifically for the production of our agar chips. When the agar has cooled down, the chips are cut out of the mold and are ready to use. Storage of the readily usable sensor chips is possible for up to 2 days at 4°C when using LB medium or up to 5 days if TB medium is used. A detailed description of the sensor chip manufacturing can be found in our [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection Protocols] section.<br />
<br />
{{Team:Aachen/Figure|Aachen 14-10-14 Flowsheet OD-device part1 ipo.png|title=Assay to detect ''P.&nbsp;aeruginosa'' using ''Cellock Holmes''|subtitle=This flow sheet shows the procedure to sample and detect ''P.&nbsp;aeruginosa'': A sampling chip is briefly put onto the potentially contaminated surface, added onto one of our sensor chips and inserted into ''WatsOn''.|width=900px}}<br />
<br />
Using ''Cellock Holmes'', we developed a simple assay to detect ''P.&nbsp;aeruginosa''. <br />
* First, a sampling chip is placed on a solid surface that is potentially contaminated with the pathogen. <br />
* Second, the sampling chip is removed from the surface and put onto one of our sensor chips. (Theorectically, the sensor chips could be directly used for sampling, however, this was avoided in our project to '''match [https://2014.igem.org/Team:Aachen/Safety biosafety regulations]''' and to prevent the spread of GMOs into the environment.) <br />
* Third, the two layered chip-stack is put into a petri dish which is inserted into our measurement device [https://2014.igem.org/Team:Aachen/Project/Measurement_Device ''WatsOn''] for evalutation.<br />
<br />
{{Team:Aachen/Figure|Aachen 14-10-14 Flowsheet OD-device part2 ipo.png|title=Mode of action inside ''WatsOn''|subtitle=Chips are incubated at 37°C to stimulate cell growth and then illuminated with blue light to excite fluorescence. A picture is taken and analyzed for fluorescence signals using the software ''Measurarty''.|width=900px}}<br />
<br />
Inside ''WatsOn'', the chips are incubated at 37°C and the sampled populations of microorganisms attached on the sampling chip start to grow and multiply. During incubation the chips can be '''illuminated with blue light''' at any time, and a '''photo of the chips''' is taken. The '''software ''Measurarty''''' then analyzes any fluorescent signal. ''P.&nbsp;aeruginosa'' secrets an increasing number of quorum sensing molecules that are recognized by ''Cellocks'', thereby producing a fluorescence signal. For detection of ''P.&nbsp;aeruginosa'', we focused on a quorum sensing molecule called N-3-oxo-dodecanoyl-L-homoserine lactone (for short: 3-oxo-C<sub>12</sub>-HSL), which is involved in virulence regulation of ''P.&nbsp;aeruginosa'' (Jimenez, Koch, Thompson et al., 2012). The incorporation of the 3-oxo-C<sub>12</sub>-HSL detection system into the ''Cellocks'' is explained in detail in the [https://2014.igem.org/Team:Aachen/Project/FRET_Reporter REACh Construct] section.<br />
<br />
<br />
</center><br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
<!-- ==A Novel Molecular Approach==<br />
<span class="anchor" id="biosensormolecularapproach"></span><br />
<br />
For our biosensor, our team genetically modified ''E. coli'' cells to be able to elecit a '''fluorescent response to autoinducers''' produced by the pathogen ''Pseudomonas aeruginosa'' during quorum sensing. In the case of ''P.&nbsp;aeruginosa'', these autoinducers are N-3-oxo-dodecanoyl-L-homoserine lactone, or 3-oxo-C-12-HSL for short. The quorum sensing system of this pathogen contains the '''LasR activator''' which binds 3-oxo-C-12-HSL, and the '''LasI promoter''', which is activated by the LasR-HSL complex. Both LasR activator and LasI promoter are available as BioBricks [http://parts.igem.org/Part:BBa_C0179 C0179] and [http://parts.igem.org/Part:BBa_J64010 J64010].<br />
<br />
As a reporter gene, we use '''GFP'''. However, expression of GFP is not simply controlled through the LasI promoter activity in our approach. Instead, our sensor cells contain genes for a constitutively expressed fusion protein consisting of GFP and a dark quencher, and an '''HSL-inducible protease'''. We use the REACh protein as dark quencher for GFP and the TEV protease to cleave the complex; [https://2014.igem.org/Team:Aachen/Project/FRET_Reporter here] you can read more about the REACh construct and the TEV protease. <br />
<br />
{{Team:Aachen/Figure|align=center|Aachen_REACh_approach.png|title=Our novel biosensor approach|subtitle=Expression of the TEV protease is induced by HSL. The protease cleaves the GFP-REACh fusion protein to elecit a fluorescence response.|width=500px}}<br />
<br />
When ''P.&nbsp;aeruginosa cells'' are stuck on our agar chip and come close to our sensor cells, the latter take up the HSL molecules secreted by the pathogens. Inside the sensor cells, the autoinducer binds to the LasR gene product and activate the expression of the TEV protease. The protease then cleaves the GFP-REACh construct. When '''illuminated with light of 480&nbsp;nm''', the excitation wavelenght of GFP, our sensor cells in the vicinity of ''P.&nbsp;aeruginosa'' give a '''fluorescence signal'''. On the other hand, sensor cells that were not anywhere close to the pathogens do not express the protease. Therefore, the GFP will still be attached to the dark quencher in these cells, and no fluorescence is produced.<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}} --><br />
[[File:Aachen_14-10-16_Iterative_Process_iNB.png|right|150px]]<br />
<br />
== Development & Optimization ==<br />
<span class="anchor" id="biosensordevelopment"></span><br />
<br />
=== Medium ===<br />
{{Team:Aachen/FigureFloat|Aachen_ILOV_GFP_HM_1,5h.png|title=iLOV and GFP in the Gel Doc<sup>TM</sup>|subtitle=Sensor cells producing iLOV (A) and GFP (B) 1.5&nbsp;h after induction.|left|width=500px}}<br />
Prior to using our own device for detection of fluorescence emitted by the sensor chips we used equipment readily available in the lab. A Molecular Imager&reg; Gel Doc™ XR+ from BIO-RAD was available which uses UV and white light illuminators. However, only two different filters were available for the excitation light wavelength, which resulted in very limitted possibilities for the excitation of fluorescent molecules. For example, it was possible to detect the expression of iLOV in our sensor chips but the detection of GFP was not possible. It was thus determined that the '''Gel Doc™ was not suitable for our project'''.<br />
<br />
<!--Regarding the medium used for our sensor chips, LB medium showed a high background fluorescence when exposed to UV light in the Gel Doc. Surprisingly, the background fluorescence resulting from the LB medium was too high to detect a signal emitted by our sensor cells. Hence, minimal media (NA, M9, Hartman (HM)) was used to minimize background fluorescence, but this approach resulted in less to no growth of our sensor cells.<br />
In our device ''WatsOn'', optimized wavelengths of 450&nbsp;nm and 480&nbsp;nm were used for excitation of iLOV and GFP, respectively. When exposed to either excitation wavelength TB medium, which is basically an improved LB medium and highly supports cell growth, showed strong background fluorescence in our own device. High background fluorescence was also observed for TB medum when using the Gel Doc. In contrast to the Gel Doc LB medium showed minimal fluorescence in our device ''WatsOn'' and no difficulties in cultivation of our ''Cellocks'' were observed. Because of the reduced fluorescence compared to TB medium when using ''Watson'' for sensor chip evaluation and because of sufficient cultivation conditions for our 'Cellocks'' LB medium was chosen over TB mediium for sensor chip manufacturing. --><br />
<br />
{{Team:Aachen/FigureFloat|Aachen_Chip_medium_geldoc.png|title=Differend medium in the Gel Doc™|subtitle=complex media exhibited high background fluorescence while less back-ground fluorescence was observed with the minimal media (HM, M9, NA).|right|width=500px}}<br />
<br />
{{Team:Aachen/FigureFloat|Aachen_5days_K131026_neb_tb_1,5h.jpg |title=Testing our chips' shelf-life|subtitle= [http://parts.igem.org/Part:BBa_K131026 K131026] in NEB induced after 5 days of storage at 4°C. The right chip was induced with 0.2&nbsp;µL of 500&nbsp;µg/mL HSL, and the image was taken after 1.5&nbsp;h.|left|width=500px}}<br />
<br />
To determine which medium enables fast and reliable fluorescence response detection of our chip system, the growth behavior on as well as the fluorescence properties of several media have been investigated. The complex media LB, TB and NA and the minimal media M9 and HM were tested.<br />
Because of the reduced background fluorescence compared to TB medium when using Watson for sensor chip evaluation and because of sufficient cultivation conditions for our 'Cellocks, LB medium was chosen for sensor chip manufacturing (table below).<br />
<br />
<br />
<center><br />
{| class="wikitable"<br />
! !! LB !! TB !! NA !! M9 !! HM <br />
|-<br />
| Growth of Cellock || <div style="text-align: center;">'''+'''</div> || <div style="text-align: center;">'''+'''</div> || <div style="text-align: center;">-</div> || <div style="text-align: center;">-</div> || <div style="text-align: center;">-</div><br />
|-<br />
| Background fluorescence in GelDoc || <div style="text-align: center;">'''+'''</div> || <div style="text-align: center;">'''+'''</div> || <div style="text-align: center;">-</div> || <div style="text-align: center;">-</div> || <div style="text-align: center;">-</div><br />
|-<br />
| Background fluorescence in ''WatsOn'' || <div style="text-align: center;">-</div> || <div style="text-align: center;">'''+'''</div> || <div style="text-align: center;">-</div> || <div style="text-align: center;">-</div> || <div style="text-align: center;">-</div><br />
|}<br />
</center><br />
<br />
<br />
Further experiments were conducted to test long-time storage of the sensor chips. Storage at -20°C resulted in the loss of our sensor cells. Adding 5-10% (v/v) glycerol ensured survival of the sensor cells, but resulted in an expression stop of fluorescence proteins. Thus, the idea of long time storage of the sensor chips had to be passed on. However, it was possible to store ready-to-use sensor chips for 2 days at 4°C when using LB medium and storage for 5 days was possible with chips made from TB medium.<br />
<br />
=== Agar Concentration ===<br />
For the sensor chip manufacturing, a concentration of 1.5% agarose was found to be optimal. When agarose concentrations below 1.5% (w/v) were used the sensor chips were easily damaged and were not transportable. Agar concentrations over 1.5% (w/v) had to be avoided, because the agarose started to solidify before it could be poured into the chip casting mold.<br />
Agarose was chosen over agar, because of a more even linkage between molecules resulting in a better chip homogenity. In addition, agarose reduced diffusion of inducer molecules through the chip. A reduction in diffusion was desired in order to achieve distinct fluorescent spots on the sensor chips.<br />
<br />
=== Chip Form ===<br />
{{Team:Aachen/FigureFloat|Aachen_2_chipform.jpg|title=Chips made using the closed mold|subtitle=With this method we encounter problems due to frequent bubble formation.|left|width=500px}}<br />
Various approaches were tried for production of sensor chips with reproducable quality. The first approach was to cast every sensor chip individually. In order to achieve a plain chip surface, which was required for high quality images, we tried to cast the sensor chips between four microscope slides. This approach had to be rejected, because the agar was too liquid. In a second try, we produced a closed mold into which liquid agar was injected using a pipette, but we encountered a high number of bubbles in the chips when using this method. Bubbles in the sensor chips resulted in problems during fluorescence evalutaion.<br />
<br />
{{Team:Aachen/FigureFloat|Aachen_Final_chipform.jpg|title=The finalized chip mold|subtitle=We found the above shown casting mold to be ideal for our purposes.|left|width=500px}}<br />
Finally, we used an open mold into which the agar was poured right after mixing with the sensor cells. When the agar had solidified the chips were cut out along precast indentations in the casting mold. An advantage of the open mold was the ability to simultaneously produce nine sensor chips while the surface tension of the liquid agar ensured a plane chip surface.<br />
<br />
=== Induction ===<br />
For artificially induction of our molecular detection constructs we simluated the presence of ''P.&nbsp;aeruginosa'' by use of IPTG or 3-oxo-C12 HSL. <br />
A minimal pipetting volume was desired for induction, because initial experiments showed that diffusion of the inducers through the chip hindered formation of distinct spots on the chips. Due to the pipetts available the lowest volume we could pipett was limitted to 0.2 &nbsp;µL .<br />
Sensor cells based on ''E. coli'' BL21, which incorporated the [https://2014.igem.org/Team:Aachen/Parts#partsK1319042 K1319042] construct were able to detect IPTG concentrations down to 1&nbsp;mM (0.2&nbsp;µL), so were sensor cells based on ''E. coli'' BL21, which incorporated the REACh constructs.<br />
Sensor cells based on ''E. coli'' BL21, which incorporated the [http://parts.igem.org/Part:BBa_K131026 K131026] construct were able to detect HSL concentrations down to 500&nbsp;µg/mL (0.2&nbsp;µL). Further more, detection of growing ''Pseudomonas aeruginosa'' cells based on secreted HSLs was possible using the [http://parts.igem.org/Part:BBa_K131026 K131026] construct. A detailed description including pictures of the experiments leading to the just mentioned findings can be found in the [https://2014.igem.org/Team:Aachen/Project/2D_Biosensor#biosensorachievements Achievements] section.<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-15_Medal_Cellocks_iNB.png|right|150px]]<br />
<br />
==Achievements==<br />
<span class="anchor" id="biosensorachievements"></span><br />
<br />
We are able to detect IPTG, 3-oxo-C{{sub|12}} HSL and ''Pseudomonas aeruginosa''. To prove that the sensor constructs produce the flourescence signal and not the medium or ''E. coli'' in its own we have [http://parts.igem.org/Part:BBa_B0015 B0015] in NEB as a negativ control for IPTG, HSL and ''Pseudomonas aeruginosa'' induction.<br />
<br />
{{Team:Aachen/Figure|Aachen_B0015_IPTG_HSL_Pseudomonas.png|title=Negativ control |subtitle=B0015 in NEB as negativ control induced with A) 0.2&nbsp;µl of 100&nbsp;mM IPTG, image taken after 2.5&nbsp;h; B) 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12), image after 2.5&nbsp;h; C) with 5 spots of ''Pseudomonas aeruginosa'' on the left and one big spot on the right, image taken after 2&nbsp;h|width=900px}}<br />
<br />
=== Testing our Sensor Chips in a Plate Reader ===<br />
{{Team:Aachen/FigureFloat|Aachen_K1319042_Platereader.gif|title=Testing K1319042 in our sensor chips|subtitle=K1319042 in our sensor chip induced with 2&nbsp;µL IPTG and measured with a plate reader. Blue color indicates no fluorescence, red color indicates fluorescence. Top chip is not induced, bottom chip is induced with IPTG.|width=260px}}<br />
<br />
To establish a prove of principle we used our construct [http://parts.igem.org/Part:BBa_K1319042 K1319042] an IPTG inducible iLOV. They were introduced into our sensor chips and then fluorescence was measured every 15 minutes after an induction with 2&nbsp;µl 100&nbsp;mM IPTG (gif on the left).<br />
<br />
There is a clear difference in fluorescence between the not induced chip (top) and the induced chip (bottom). It is distinctively visible that the middle of the bottom chip start to exhibit fluorescence and then the fluorescence increases over time and spreads outward. The top chip also shows a slight increase in measured fluorescence but it is nowhere near the level of the induced chip and is primarily attributable to a leaky promoter and the background fluorescence. <br />
<br />
This demonstrates a general proof of principle of the sensor chip design. Therefore the next was testing the detection of 3-oxo-C{{sub|12}} HSL.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
=== Detecting 3-oxo-C{{sub|12}} HSL with Sensor Chips ===<br />
<br />
{{Team:Aachen/FigureFloatRight|Aachen_K131026_Platereader.gif|title=Testing K131026 in our sensor chips|subtitle=K131026 in our sensor chip induced with 0.2&nbsp;µL 3-oxo-C{{sub|12}} HSL and measured with a plate reader. Blue color indicates no fluorescence, red color indicates fluorescence. Top chip is not induced, bottom chip is induced with IPTG.|width=360px}}<br />
<br />
As a next step, we used [http://parts.igem.org/Part:BBa_K131026 K131026] from the 2008 iGEM Team Calgary in our sensor chips to detect 3-oxo-C{{sub|12}} HSL which is produced by ''Pseudomonas&nbsp;aeruginosa'' during quorum sensing. First, we tested them by direct induction with purified 3-oxo-C{{sub|12}} HSL (0.2&nbsp;µL, 500&nbsp;µg/mL). A fluorescence measurement was taken every 15&nbsp;minutes with an excitation wavelength of 496&nbsp;nm and an emission wavelength of 516&nbsp;nm (for GFP).<br />
<br />
The measured fluorescence again showed a distinct signal on the induced chip (bottom) compared to the uninduced chip (top). The fluorescence clearly starts in the middle of the chip (point of induction) and then extends outwards, still showing an ever increasing signal of fluorescence. The base level of fluorescence is attributed to leakiness of the promoter and general background fluorescence of growing ''E. coli'' cells. In the induced chip (bottom), the background fluorescence is a lot lower than in the uninduced chip (top) because the signal masks the noise. The difference between the induced and uninduced chips indicates a clear response to the HSL and a proof for the ability of our sensor chip design to detect the HSL produced by ''Pseudomonas&nbsp; aeruginosa''.<br />
<br />
=== Detecting IPTG with Sensor Chips ===<br />
{{Team:Aachen/FigureFloat|Aachen_I746909_slower_reduced.gif|title=IPTG inducible superfolder GFP (I746909) in sensor chips|subtitle=IPTG inducible superfolder GFP (I746909) is induced with IPTG (2 µl, 100mM) on the right chip with a non induced chip on the left|width=480px}}<br />
<br />
This video shows the construct [http://parts.igem.org/Part:BBa_I746909 I746909] from the 2007 iGEM Team Cambridge. This BioBrick is a producer of superfolder GFP under the control of a T7 promoter. It was introduced into BL21(DE3) cells making the expression IPTG inducible through the T7 RNA Polymerase encoded in the genome of BL21(DE3) under the control of a lacI promoter. <br />
<br />
The left chip does not show visible fluorescence and the right chip exhibits a strong fluorescence signal showing clearly the ability of the sensor chip technology to detect IPTG. On top of that, the fluorescence response is strong enough to be detected and analyzed by the measurement device WatsOn.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
===Detecting the 3-oxo-C{{sub|12}} HSL with K131026 in our Sensor Chips with WatsOn===<br />
<br />
{{Team:Aachen/FigureFloatRight|Aachen_K131026_HSLdetection_slow.gif|title=Detection of 3-oxo-C{{sub|12}} HSL with K131026|subtitle=0.2 µL of 3-oxo-C{{sub|12}} HSL was placed in the middle of the chip and then incubated at 37°C in WatsOn.|width=480px}}<br />
<br />
The next step towards the final goal to detect ''Pseudomonas&nbsp;aeruginosa'' was to replicate the detection of 3-oxo-C{{sub|12}} HSL, which was established in the plate reader, in our own [https://2014.igem.org/Team:Aachen/Project/Measurement_Device ''WatsOn''] device. Therefore, we again used K131026 as our construct in ''E. coli'' BL21(DE3) cells and induced with 0.2&nbsp;µL 3-oxo-C{{sub|12}} HSL with a concentration of 500&nbsp;µg/mL. The right chip was induced and - as a negative control - the left chip was not induced. Pictures were taken every 4&nbsp;minutes.<br />
<br />
The result was a clear replication of the success of the plate reader experiment. The induced chip shows a clear fluorescence response eminating from the center where the induction with HSL took place. This demonstrates the ability of not only our sensor chips but also our measurement device WatsOn to successfully detect 3-oxo-C{{sub|12}} HSL.<br />
<br />
===Detecting ''Pseudomonas&nbsp;aeruginosa'' with K131026 in our Sensor Chip with WatsOn===<br />
{{Team:Aachen/FigureFloat|Aachen_K131026_Pseudomonas_aeruginosa_detection.gif|title=Detection of ''Pseudomonas aeruginosa'' with K131026|subtitle=Direct detection of ''Pseudomonas aeruginosa'' on our sensor chips. Sensor cell used were K131026.|width=480px}}<br />
<br />
After establishing the successful detection of 3-oxo-C{{sub|12}} with our sensor chips the next step was the detection of ''Pseudomonas aeruginosa'' with our measurement device WatsOn. Therefore sensor chips with K131026 were again prepared and the right chip was induced with 0.2&nbsp;µl of a ''Pseudomonas aeruginosa'' culture while the left chip was not induced. <br />
<br />
The results clearly demonstrate our ability to detect ''Pseudomonas aeruginosa'' with our measurement device WatsOn. On the induced chip a definite fluorescence response is visible in response to ''Pseudomonas aeruginosa''. The fluorescence eminates outward from the induction point and shows a significant difference to the non induced chip. Therefore detection of ''Pseudomonas aeruginosa'' is possible with our sensor chip technology in our measurement device ''WatsOn''!<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-16_Outlook_Cellocks_iNB.png|right|150px]]<br />
<br />
== Outlook ==<br />
<span class="anchor" id="biosensoroutlook"></span><br />
<br />
After successfully detecting ''P.&nbsp;aeruginosa'', the next step in developing our sensor chip platform further is an '''improvement of the sampling chip'''. The current technique of using a simple agarose chip is not sufficient to collect all microorganisms from the sampled surface. Therefore, the aim is to improve the sampling chip by trying different, more adhesive material. <br />
<br />
Furthermore, diffusion in the sensor chips will be reduced to '''limit the spread of the fluorescence signal'''. Currently, the fluorescence spot grows at lot beyond the point of detection and makes it difficult to successfully differentitate between multiple points of induction. By introducing different diffusion barriers into our chips, the growth of the fluorescence spots might be limited, thus enabling the detection of multiple sources of fluorescence lying close together. <br />
<br />
Additionally, the application of our sensor chips in combination with our ''WatsOn'' device is currently being evaluated for the detection of signals other than fluorescence. '''Detecting bio- and chemiluminescence''' has been identified as an area of potential future application. <br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
==References==<br />
<br />
* Waters, C. M., & Bassler, B. L. (2005). QUORUM SENSING: Cell-to-Cell Communication In Bacteria. Annual Review of Cell and Developmental Biology, 21(1), 319-346. Available online at http://www.annualreviews.org/doi/full/10.1146/annurev.cellbio.21.012704.131001.<br />
<br />
* Jimenez, P. N., Koch, G., Thompson, J. A., Xavier, K. B., Cool, R. H., & Quax, W. J. (2012). The Multiple Signaling Systems Regulating Virulence in Pseudomonas aeruginosa. Microbiology and Molecular Biology Reviews, 76(1), 46-65. Available online at http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3294424/#B63.<br />
<br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Interlab_StudyTeam:Aachen/Interlab Study2014-10-17T10:44:51Z<p>VeraA: </p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
= Interlab Study =<br />
<br />
As our team is competing in the Measurement track for this year's competition, we were also required to participate in the [https://2014.igem.org/Tracks/Measurement/Interlab_study iGEM 2014 Measurement Interlab Study]. This study aims to '''collect data from iGEM teams all over the world''' on the fluorescence of '''three genetic devices expressing GFP'''. The devices differ in their plasmid copy properties and the strength of the promotor. <br />
<br />
We introduced the three constructs into ''E. coli'' cells and measured '''fluorescence as well as optical density''' of the liquid cultures over a period of 18 hours, using '''a spectrophotometer and a plate reader''', respectively. The obtained results confirmed our hypothesis that the fluorescence of the BioBrick in the high copy plasmid pSB1C3, J23101.E0240, would exhibit a stronger signal than the constructs I20260, which is on the low to mid copy plasmid pSB3K3, and J23115.E0240, which has a weaker promotor than J23101.E0240. During the experiment, we could observe a typical growth curve for ''E.coli'' including lag, exponential, stationary and death phase. We could show that the fluorescence we measured is rather a function of each cell than the whole culture, since all cultures had comparable optical densities.<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid" style="width:1040px"><br />
<br />
<li style="width:186px;margin-left: 11px;margin-right: 11px;margin-bottom: 11px;margin-top: 11px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Interlab_Study#isexperimentaldesign" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height: 180px; width: 180px;"><div class="menukachel">Experimental Design</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/10/Aachen_14-10-13_Yellow_Flask_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;height: 180px; width: 180px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:186px;margin-left: 11px;margin-right: 11px;margin-bottom: 11px;margin-top: 11px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Interlab_Study#isexpectedresults" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height: 180px; width: 180px;"><div class="menukachel">Expected Results</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/78/Aachen_14-10-13_Green_Flask_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;height: 180px; width: 180px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:186px;margin-left: 11px;margin-right: 11px;margin-bottom: 11px;margin-top: 11px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Interlab_Study#ismaterials" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height: 180px; width: 180px;"><div class="menukachel">Materials & Methods</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/3/30/Aachen_14-10-13_Empty_Falcon_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;height: 180px; width: 180px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:186px;margin-left: 11px;margin-right: 11px;margin-bottom: 11px;margin-top: 11px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Interlab_Study#isresults" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height: 180px; width: 180px;"><div class="menukachel">Results</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/b/b7/Aachen_14-10-13_Graph_Panel_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;height: 180px; width: 180px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:186px;margin-left: 11px;margin-right: 11px;margin-bottom: 11px;margin-top: 11px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Interlab_Study#isdiscussion" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height: 180px; width: 180px;"><div class="menukachel">Discussion</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/3/3b/Aachen_14-10-13_Graph_with_Error_Bars_Panel_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;height: 180px; width: 180px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-13_Yellow_Flask_iNB.png|right|150px]]<br />
<br />
==Experimental Design==<br />
<span class="anchor" id="isexperimentaldesign"></span><br />
<br />
For the Interlab Study, we tested GFP-containing BioBricks for fluorescence and optical density. Subject of the study were the BioBricks I20260, J23101.E0240 and J23115.E0240. The latter consists of a [http://parts.igem.org/Part:pSB3K3 pSB3K3] backbone with an insert, a combination of the promoter [http://parts.igem.org/Part:BBa_J23101 J23101], the RBS [http://parts.igem.org/Part:BBa_B0032 B0032], the GFP coding sequence [http://parts.igem.org/Part:BBa_E0040 E0040] and the terminator [http://parts.igem.org/Part:BBa_B0015 B0015]. J23101.E0240 has the same insert as I20260, but has [http://parts.igem.org/Part:pSB1C3 pSB1C3] as a backbone. J23115.E0240 only differs from J23101.E0240 in the use of another promotor, namely [http://parts.igem.org/Part:BBa_J23115 J23115]. As a '''negative control''', we used just B0015 in pSB1C3.<br />
<br />
{{Team:Aachen/Figure|Flasks.png|align=center|width=400px}}<br />
<br />
{{Team:Aachen/Figure|Aachen_14-10-11_BioBricks_for_Interlab_iNB.png|align=center|title=Genetic devices tested|subtitle=Composition of I20260, J23101.E0240 (left) and J23115.E040 (right)|width=500px}}<br />
<br />
Over a time span of 18 hours the optical density and fluorescence of cultures containing these BioBricks were measured every 2 hours using the spectrophotometer and plate reader, respectively. <br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-13_Green_Flask_iNB.png|right|150px]]<br />
<br />
==Expected Results==<br />
<span class="anchor" id="isexpectedresults"></span><br />
<br />
Fluorescence was expected to develop in cultures containing I20260, J23101.E0240 and J23115.E0240, as all include the GFP coding sequence. However, the signal was expected to be stronger in J23101.E0240 than in I20260 since pS1C3 is a high copy plasmid while pSB3K3 is a low to mid copy plasmid. Because of this, a higher fluorescence was expected of J23101.E0240 compared to I20260 even though they share the same insert. J23115.E0240, too, was supposed to produce a fluorescent signal, but J23115 (the mutated version K823012 was used) is a lot weaker promotor than J23101. Therefore, a lot lower - if any - fluorescence is expected with this BioBrick.<br />
<br />
{{Team:Aachen/Figure|Aachen_14-10-16_Plasmid_Promotor_Strength_iNB.png|title=Diagram illustrating the different plasmid and promotor properties|subtitle=Plasmid pSB1C3 has a higher copy number than pSB3K3, and J23101 is a stronger promotor than J23115.|width=800px}}<br />
<br />
B0015 was used as our '''negative control''' as the insert only contains a terminator and no expression cassette for GFPmut3b, and so no fluorescence was expected.<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-13_Empty_Falcon_iNB.png|right|150px]]<br />
<br />
==Materials and Methods==<br />
<span class="anchor" id="ismaterials"></span><br />
<br />
===Constructs and strains===<br />
All constructs used were transformed into [https://www.neb.com/products/c3019-neb-10-beta-competent-e-coli-high-efficiency NEB 10β] cells. The constructs I20260 as well as B0015 were taken directly from the iGEM 2014 distribution plates. The constructs J23101.E0240 as well as J23115.E0240 were made using the [http://parts.igem.org/Help:Assembly/3A_Assembly 3A Assembly]. Therefore, the subparts J23101, J23115 as well as E0240 were transformed directly from the 2014 distribution plates into [https://www.neb.com/products/c3019-neb-10-beta-competent-e-coli-high-efficiency NEB 10β] cells. Afterwards the plasmids were recovered using the [https://us.vwr-cmd.com/bin/public/demidoccdownload/50001659/7057R_ge_healthcare_illustra_nucleic_acid_sample_preparation.pdf illustra plasmidPrep Mini Spin Kit]. The purified plasmids J23101 and J23115 were cut with the restriction enzymes EcoRI and SpeI, while E0240 was cut with XbaI and PstI. The restricted plasmids were then ligated together using the T4 DNA Ligase. Afterwards, the ligation product was introduced into the pSB1C3 linearized backbone provided by iGEM headquarters with the 2014 distribution which we had also cut with EcoRI and PstI. All restrictions and ligations were performed using enzymes and buffers of the [http://shop2.neb-online.de/4DCGI/ezshop?action=Direktanzeige&Artikelnummer=NEBIGEM1%40&WorldNr=01&ButtonName=website&skontaktid=1055557&skontaktkey=RrbLvNPZxLRIFbyyyGOZambWfZKxFK NEB iGEM Kit]. The final product was once again transformed into [https://www.neb.com/products/c3019-neb-10-beta-competent-e-coli-high-efficiency NEB 10β] cells.<br />
<br />
The correct identity of the resulting constructs were confirmed by sequencing. The sequencing data (consensus sequences) can be found [https://2014.igem.org/File:Sequencing_Interlab_Study_iGEM_Aachen_2014.zip here].<br />
<br />
Note: We used the mutated version of J23115 as sent out by the iGEM headquarters. The mutation makes J23115 effectively the same promoter as K823012. We will still refer to the promoter as J23115 though, to keep it more easily recognizable with the other Interlab Study results.<br />
<br />
===Inoculation and Cultivation===<br />
The cultivation of our bacteria was performed in 500&nbsp;ml shake flasks filled with 50&nbsp;ml [https://2014.igem.org/Team:Aachen/Notebook/Protocols#LB_medium LB medium]. The cultures were kept at 37°C and 300&nbsp;rpm shaking frequency. Appropiate antibiotics were added to each media (kanamycin for I20260, chloramphenicol for B0015, J23101.E0240 and J23115.E0240). Both antibiotics were added from a 1000X stock stored at -20°C for a final concentration of 35&nbsp;µg/ml chloramphenicol and 50&nbsp;µg/ml kanamycin, respectively.<br />
<br />
The precultures were inoculated from the same cryo stocks. They were cultivated for 16 hours and then sampled for OD measurement with a spectrophotometer. Then 2&nbsp;ml of each preculture were centrifuged (5 minutes, 6000&nbsp;g) and then washed twice with PBS buffer. Afterwards, all cultures were inoculated to have the same starting OD. Inoculations were carried out under sterile conditions at the clean bench.<br />
<br />
===Sampling===<br />
To draw samples, the shake flasks were taken out of the 37°C room and brought onto a nearby bench. 3&nbsp;ml of sample were taken out next to a Bunsen burner flame and pipetted into three 2&nbsp;ml cuvettes. As soon as all samples were taken the flasks were taken back onto the shaker in the 37°C room. The whole process of taking samples for all 12 flasks (3 biological replicates for each construct) took 5 minutes and samples were taken every 2 hours.<br />
<br />
After 4 hours, we had to dilute the samples with LB medium in a ratio of 1:4, and from the 6th to 18th hour we had to dilute in a ratio of 1:9.<br />
<br />
After the measurement of OD in the spectrometer, 100&nbsp;µl of each sample were taken out and put on a 96-well plate (Thermo microfluor 1, flat-bottom, black) to measure fluorescence. <br />
<br />
Each measurement occured in a technical triplicate, resulting in 36 different samples being processed in every sampling step.<br />
<br />
===Measurement of OD using a spectrophotometer===<br />
For OD measurement, the [http://www.unicosci.com/spectro/1200detail.htm Unico Spectrophotometer 1201 of Fisher Bioblock Scientific] was used. The measurement was taken at 600&nbsp;nm and we used pure LB medium (from the same batch as the medium used for cultivation) as our blank. We only measured OD up to an absorbance of 0.8. At a higher OD, we diluted the sample with LB medium (again from the same batch as our cultivation medium). Dilution was done by first filling the cuvettes with the LB medium, and then adding our cultivation sample. Subsequently, each cuvette was vortexed thoroughly. The solution was allowed to settle before measurement.<br />
<br />
===Measurement of fluorescence using a microplate reader===<br />
Measurement of fluorescence was performed using the ''' [http://www.biotek.com/products/microplate_detection/synergymx_monochromator_based_multimode_microplate_reader.html Synergy Mx from BioTek]''' with the Gen5 software, using the following parameters:<br />
{| class="wikitable"<br />
|-<br />
! Parameter !! value<br />
|-<br />
| Software version || 2.1.2014<br />
|-<br />
| Reader Type || Synergy Mx<br />
|-<br />
| Read || GFP 100<br />
|-<br />
| Measurement || fluorescence endpoint<br />
|-<br />
| Measurement range || full plate<br />
|- <br />
| Filter || filter set 1<br />
|- <br />
| Excitation || 496&nbsp;±&nbsp;9.0&nbsp;nm<br />
|- <br />
| Emission || 516&nbsp;±&nbsp;9.0&nbsp;nm<br />
|-<br />
| Gain || 100<br />
|-<br />
| Read Speed || normal<br />
|- <br />
| Delay || 100 msec<br />
|-<br />
| Measurement s/data point || 10<br />
|-<br />
| Read height || 8&nbsp;mm<br />
|}<br />
<br />
As for the OD measurement, we used LB medium as our blank. Since samples for fluorescence measurement were acquired from the cuvettes for the OD measurement, sample processed in plate reader had the same dilutions.<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-13_Graph_Panel_iNB.png|right|150px]]<br />
<br />
==Results==<br />
<span class="anchor" id="isresults"></span><br />
<br />
After observing the optical density (OD) and fluorescence for 18 hours while taking samples every 2 hours, the following results were obtained:<br />
<br />
{{Team:Aachen/Figure|Aachen 14-10-13 InterlabGraph1 iFG.PNG|align=center|title=Interlab Study Results|subtitle=Our measurements of fluorescence and optical density of the three genetic devices and a negative control.|width=700px}}<br />
<br />
This shows that all cultures had ODs in the same range throughout the experiment. After the exponential growth phase the stationary phase started shortly after 4 hours of cultivation time. The OD did not change from thereon until a cultivation time of 16 hours after which it started to decline. <br />
<br />
The development of fluorescence followed largely the pattern of the OD, but differed a lot in between the different cultures. J23101.E0240 exhibited fluorescence three times stronger than I20260, and about 10 times stronger than B0015 and J23115.E0240. The latter two did not differ in terms of fluorescent signal.<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-13_Graph_with_Error_Bars_Panel_iNB.png|right|150px]]<br />
<br />
==Discussion==<br />
<span class="anchor" id="isdiscussion"></span><br />
<br />
The OD is an indirect measurement of the biomass in the shake flask. Through the correlation of both measurements the results show that the difference in biomass of the cultures is not significantly enough to affect the fluorescence data. Therefore, the fluorescence data can be interpreted as a direct result of the fluorescence per cell instead of an overall fluorescence per culture. <br />
<br />
The fluorescence data shows a '''strong difference between the I20260 and J23110.E240'''. Even though both inserts are the same, there is a difference in fluorescence, as expected, because of the different plasmid backbones. The high copy plasmid pSB1C3 shows a '''3 times stronger fluorescence signal''' per cell than the low to mid copy plasmid pSB3K3. This can be directly related to the number of plasmids in the cells coding for GFP.<br />
<br />
Both J23115.E0240 and B0015 show no significant fluorescence. The increase at 4 hours is explained by the '''increase of OD resulting in noise'''. B0015 behaves therefore as expected. J23115.E0240 in its original, non-mutated state was supposed to show a slight but weaker fluorescence than J23101.E0240. However, the mutations introduced made the '''promoter non-functional''', which lead to no expression of GFP and therefore no observation of fluorescence.<br />
<br />
<br />
<br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Project/2D_BiosensorTeam:Aachen/Project/2D Biosensor2014-10-17T10:41:54Z<p>VeraA: </p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
= 2D Biosensor =<br />
<br />
With our 2D biosensor technology we are able to detect the pathogen ''Pseudomonas aeruginosa'' on solid surfaces. The sensor system is comprised of '''two distinct but inseparable modules''', a biological and a technical part:<br />
<br />
* Sensing chips containing '''''Cellocks''''', our '''engineered detective cells''' that fluoresce in the presence of the pathogen, make up the biological part of ''Cellock Holmes''.<br />
* Our '''measurement device ''WatsOn''''' and the complementary '''software ''Measurarty''''' complete our sensing technology on the technical side. <br />
<br />
<center><br />
<html><ul class="team-grid" style="width:1064px;"><br />
<!-- Overview --><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Project/2D_Biosensor#biosensorpoo" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<div class="menukachel">Principle of Operation</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/6/6e/Aachen_15-10-14_Principle_of_operation_2D_sensor_ipo.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Project/2D_Biosensor#biosensordevelopment" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<div class="menukachel">Development & Optimization</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/a/a7/Aachen_14-10-16_Iterative_Process_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Project/2D_Biosensor#biosensorachievements" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<div class="menukachel">Achievements</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/e/ef/Aachen_14-10-15_Medal_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Project/2D_Biosensor#biosensoroutlook" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<div class="menukachel">Outlook</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-16_Outlook_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_15-10-14_Principle_of_operation_2D_sensor_ipo.png|right|150px]]<br />
<br />
== Principle of Operation ==<br />
<span class="anchor" id="biosensorpoo"></span><br />
<br />
''Cellock Holmes'' is designed upon a SynBio approach comprising a '''two-dimensional biosensor and a measurement unit'''. The two-dimensional biosensor is designed to recognize quorum sensing molecules secreted by the pathogen cells and to generate a distinct fluorescence signal; while the measurement device recognizes and analyzes the produced signal. <br />
<br>On the molecular side, we use the '''[https://2014.igem.org/Team:Aachen/Project/FRET_Reporter REACh construct]''' to transform regular ''E. coli'' cells into ''Cellocks''.<br />
<br />
{{Team:Aachen/Figure|Aachen 17-10-14 The basics of quorum sensing ipo.png||title=The basics of quorum sensing.|subtitle=Some microorganisms can sense the presence of their own kind based on quorum sensing which is a form of chemical communication. Quorum sensing allows these cells to behave differently depending on their cell density, e.g. by activation or deactivation of certain gene expression (Waters and Bassler, 2005).|width=1000px}}<br />
<br />
Our '''sensor cells, ''Cellocks'', are immobilized in agar chips'''. To make the chips, we mix the ''Cellocks'' with liquid LB agar. <br />
In the course of our project, we designed a casting mold specifically for the production of our agar chips. When the agar has cooled down, the chips are cut out of the mold and are ready to use. Storage of the readily usable sensor chips is possible for up to 2 days at 4 °C when using LB medium or up to 5 days if TB medium is used. A detailed description of the sensor chip manufacturing can be found in our [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection Protocols] section.<br />
<br />
{{Team:Aachen/Figure|Aachen 14-10-14 Flowsheet OD-device part1 ipo.png|title=Assay to detect ''P.&nbsp;aeruginosa'' using ''Cellock Holmes''|subtitle=This flow sheet shows the procedure to sample and detect ''P.&nbsp;aeruginosa'': A sampling chip is briefly put onto the potentially contaminated surface, added onto one of our sensor chips and inserted into ''WatsOn''.|width=1000px}}<br />
<br />
Using ''Cellock Holmes'', we developed a simple assay to detect ''P.&nbsp;aeruginosa''. <br />
* First, a sampling chip is placed on a solid surface that is potentially contaminated with the pathogen. <br />
* Second, the sampling chip is removed from the surface and put onto one of our sensor chips. (Theorectically, the sensor chips could be directly used for sampling, however, this was avoided in our project to '''match [https://2014.igem.org/Team:Aachen/Safety biosafety regulations]''' and to prevent the spread of GMOs into the environment.) <br />
* Third, the two layered chip-stack is put into a petri dish which is inserted into our measurement device [https://2014.igem.org/Team:Aachen/Project/Measurement_Device ''WatsOn''] for evalutation.<br />
<br />
{{Team:Aachen/Figure|Aachen 14-10-14 Flowsheet OD-device part2 ipo.png|title=Mode of action inside ''WatsOn''.|subtitle=Chips are incubated at 37 °C to stimulate cell growth and then illuminated with blue light to excite fluorescence. A picture is taken and analyzed for fluorescence signals using the software ''Measurarty''.|width=1000px}}<br />
<br />
Inside ''WatsOn'', the chips are incubated at 37&nbsp;°C and the sampled populations of microorganisms attached on the sampling chip start to grow and multiply. During incubation the chips can be '''illuminated with blue light''' at any time, and a '''photo of the chips''' is taken. The '''software ''Measurarty''''' then analyzes any fluorescent signal. ''P.&nbsp;aeruginosa'' secrets an increasing number of quorum sensing molecules that are recognized by ''Cellocks'', thereby producing a fluorescence signal. For detection of ''P.&nbsp;aeruginosa'', we focused on a quorum sensing molecule called N-3-oxo-dodecanoyl-L-homoserine lactone (for short: 3-oxo-C<sub>12</sub>-HSL), which is involved in virulence regulation of ''P.&nbsp;aeruginosa'' (Jimenez, Koch, Thompson et al., 2012). The incorporation of the 3-oxo-C<sub>12</sub>-HSL detection system into the ''Cellocks'' is explained in detail in the [https://2014.igem.org/Team:Aachen/Project/FRET_Reporter REACh Construct] section.<br />
<br />
<br />
</center><br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
<!-- ==A Novel Molecular Approach==<br />
<span class="anchor" id="biosensormolecularapproach"></span><br />
<br />
For our biosensor, our team genetically modified ''E. coli'' cells to be able to elecit a '''fluorescent response to autoinducers''' produced by the pathogen ''Pseudomonas aeruginosa'' during quorum sensing. In the case of ''P.&nbsp;aeruginosa'', these autoinducers are N-3-oxo-dodecanoyl-L-homoserine lactone, or 3-oxo-C-12-HSL for short. The quorum sensing system of this pathogen contains the '''LasR activator''' which binds 3-oxo-C-12-HSL, and the '''LasI promoter''', which is activated by the LasR-HSL complex. Both LasR activator and LasI promoter are available as BioBricks [http://parts.igem.org/Part:BBa_C0179 C0179] and [http://parts.igem.org/Part:BBa_J64010 J64010].<br />
<br />
As a reporter gene, we use '''GFP'''. However, expression of GFP is not simply controlled through the LasI promoter activity in our approach. Instead, our sensor cells contain genes for a constitutively expressed fusion protein consisting of GFP and a dark quencher, and an '''HSL-inducible protease'''. We use the REACh protein as dark quencher for GFP and the TEV protease to cleave the complex; [https://2014.igem.org/Team:Aachen/Project/FRET_Reporter here] you can read more about the REACh construct and the TEV protease. <br />
<br />
{{Team:Aachen/Figure|align=center|Aachen_REACh_approach.png|title=Our novel biosensor approach|subtitle=Expression of the TEV protease is induced by HSL. The protease cleaves the GFP-REACh fusion protein to elecit a fluorescence response.|width=500px}}<br />
<br />
When ''P.&nbsp;aeruginosa cells'' are stuck on our agar chip and come close to our sensor cells, the latter take up the HSL molecules secreted by the pathogens. Inside the sensor cells, the autoinducer binds to the LasR gene product and activate the expression of the TEV protease. The protease then cleaves the GFP-REACh construct. When '''illuminated with light of 480&nbsp;nm''', the excitation wavelenght of GFP, our sensor cells in the vicinity of ''P.&nbsp;aeruginosa'' give a '''fluorescence signal'''. On the other hand, sensor cells that were not anywhere close to the pathogens do not express the protease. Therefore, the GFP will still be attached to the dark quencher in these cells, and no fluorescence is produced.<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}} --><br />
[[File:Aachen_14-10-16_Iterative_Process_iNB.png|right|150px]]<br />
<br />
== Development & Optimization ==<br />
<span class="anchor" id="biosensordevelopment"></span><br />
<br />
=== Medium ===<br />
Prior to using our own device for detection of fluorescence emitted by the sensor chips we used equipment readily available in the lab. A Molecular Imager&reg; Gel Doc<sup>TM</sup> XR+ from BIO-RAD was available which uses UV and white light illuminators. However, only two different filters were available for the excitation ligth wavelength, which resulted in very limitted possibilities for the excitation of fluorescent molecules. For example, it was possible to detect the expression of iLOV in our sensor chips but the detection of GFP was not possible. It was thus determined that the '''Gel Doc<sup>TM</sup> was not suitable for our project'''.<br />
<br />
{{Team:Aachen/Figure|Aachen_ILOV_GFP_HM_1,5h.png|title=iLOV and GFP in the Gel Doc<sup>TM</sup>|subtitle=Sensor cells producing iLOV (A) and GFP (B) 1.5&nbsp;h after induction.|width=900px}}<br />
<br />
Regarding the medium used for our sensor chips, LB medium showed a high background fluorescence when exposed to UV light in the Gel Doc. Surprisingly, the background fluorescence resulting from the LB medium was too high to detect a signal emitted by our sensor cells. Hence, minimal media (NA, M9, Hartman (HM)) was used to minimize background fluorescence, but this approach resulted in less to no growth of our sensor cells.<br />
<br />
{{Team:Aachen/Figure|Aachen_Chip_medium_geldoc.png|title=Differend medium in the Gel Doc<sup>TM</sup>|subtitle=complex media (LB) exhibited high background fluorescence while less background fluorescence was observed with the minimal media (HM, M9, NA).|width=900px}}<br />
{{Team:Aachen/FigureFloat|Aachen_5days_K131026_neb_tb_1,5h.jpg |title=Testing our chips' shelf-life.|subtitle= [http://parts.igem.org/Part:BBa_K131026 K131026] in NEB induced after 5 days of storage at 4&nbsp;°C. The right chip was induced with 0.2&nbsp;µL of 500&nbsp;µg/mL HSL, and the image was taken after 1.5&nbsp;h.|width=300px}}<br />
<br />
In our device ''WatsOn'', optimized wavelengths of 450&nbsp;nm and 480&nbsp;nm were used for excitation of iLOV and GFP, respectively. When exposed to either excitation wavelength TB medium, which is basically an improved LB medium and highly supports cell growth, showed strong background fluorescence in our own device. High background fluorescence was also observed for TB medum when using the Gel Doc. In contrast to the Gel Doc LB medium showed minimal fluorescence in our device ''WatsOn'' and no difficulties in cultivation of our ''Cellocks'' were observed. Because of the reduced fluorescence compared to TB medium when using ''Watson'' for sensor chip evaluation and because of sufficient cultivation conditions for our 'Cellocks'' LB medium was chosen over TB mediium for sensor chip manufacturing.<br />
<br />
Further experiments were conducted to test long-time storage of the sensor chips. Storage at -20 °C resulted in the loss of our sensor cells. Adding 5-10% (v/v) glycerol ensured survival of the sensor cells, but resulted in an expression stop of fluorescence proteins. Thus, the idea of long time storage of the sensor chips had to be passed on. However, it was possible to store ready-to-use sensor chips for 2 days at 4&nbsp;°C when using LB medium and storage for 5 days was possible with chips made from TB medium.<br />
<br />
=== Agar Concentration ===<br />
For the sensor chip manufacturing, a concentration of 1.5% agarose was found to be optimal. When agarose concentrations below 1.5% (w/v) were used the sensor chips were easily damaged and were not transportable. Agar concentrations over 1.5% (w/v) had to be avoided, because the agarose started to solidify before it could be poured into the chip casting mold.<br />
Agarose was chosen over agar, because of a more even linkage between molecules resulting in a better chip homogenity. In addition, agarose reduced diffusion of inducer molecules through the chip. A reduction in diffusion was desired in order to achieve distinct fluorescent spots on the sensor chips.<br />
<br />
=== Chip Form ===<br />
Various approaches were tried for production of sensor chips with reproducable quality. The first approach was to cast every sensor chip individually. In order to achieve a plain chip surface, which was required for high quality images, we tried to cast the sensor chips between four microscope slides. This approach had to be rejected, because the agar was too liquid. In a second try, we produced a closed mold into which liquid agar was injected using a pipette, but we encountered a high number of bubbles in the chips when using this method. Bubbles in the sensor chips resulted in problems during fluorescence evalutaion.<br />
<br />
{{Team:Aachen/Figure|Aachen_2_chipform.jpg|title=Chips made using the closed mold|subtitle=With this method we encounter problems due to frequent bubble formation.|width=600px}}<br />
<br />
Finally, we used an open mold into which the agar was poured right after mixing with the sensor cells. When the agar had solidified the chips were cut out along precast indentations in the casting mold. An advantage of the open mold was the ability to simultaneously produce nine sensor chips while the surface tension of the liquid agar ensured a plane chip surface.<br />
<br />
{{Team:Aachen/Figure|Aachen_Final_chipform.jpg|title=Final chip mold.|subtitle=We found the above shown casting mold to be ideal for our purposes.|width=600px}}<br />
<br />
=== Induction ===<br />
For artificially induction of our molecular detection constructs we simluated the presence of ''P.&nbsp;aeruginosa'' by use of IPTG or 3-oxo-C12 HSL. <br />
A minimal pipetting volume was desired for induction, because initial experiments showed that diffusion of the inducers through the chip hindered formation of distinct spots on the chips. Due to the pipetts available the lowest volume we could pipett was limitted to 0.2 &nbsp;µL .<br />
Sensor cells based on ''E. coli'' BL21, which incorporated the [https://2014.igem.org/Team:Aachen/Parts#partsK1319042 K1319042] construct were able to detect IPTG concentrations down to 1&nbsp;mM (0.2&nbsp;µL), so were sensor cells based on ''E. coli'' BL21, which incorporated the REACh constructs.<br />
Sensor cells based on ''E. coli'' BL21, which incorporated the [http://parts.igem.org/Part:BBa_K131026 K131026] construct were able to detect HSL concentrations down to 500&nbsp;µg/mL (0.2&nbsp;µL). Further more, detection of growing ''Pseudomonas aeruginosa'' cells based on secreted HSLs was possible using the [http://parts.igem.org/Part:BBa_K131026 K131026] construct. A detailed description including pictures of the experiments leading to the just mentioned findings can be found in the [https://2014.igem.org/Team:Aachen/Project/2D_Biosensor#biosensorachievements Achievements] section.<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-15_Medal_Cellocks_iNB.png|right|150px]]<br />
<br />
==Achievements==<br />
<span class="anchor" id="biosensorachievements"></span><br />
<br />
We are able to detect IPTG, 3-oxo-C{{sub|12}} HSL and ''Pseudomonas aeruginosa''. To prove that the sensor constructs produce the flourescence signal and not the medium or ''E. coli'' in its own we have [http://parts.igem.org/Part:BBa_B0015 B0015] in NEB as a negativ control for IPTG, HSL and ''Pseudomonas aeruginosa'' induction.<br />
<br />
<br />
{{Team:Aachen/Figure|Aachen_B0015_IPTG_HSL_Pseudomonas.png|title=Negativ control |subtitle=B0015 in NEB as negativ control induced with A) 0.2&nbsp;µl of 100&nbsp;mM IPTG, image taken after 2.5&nbsp;h; B) 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12), image after 2.5&nbsp;h; C) with 5 spots of ''Pseudomonas aeruginosa'' on the left and one big spot on the right, image taken after 2&nbsp;h|width=900px}}<br />
<br />
=== Testing our Sensor Chips in a Plate Reader ===<br />
{{Team:Aachen/FigureFloat|Aachen_K1319042_Platereader.gif|title=Testing K1319042 in our sensor chips|subtitle=K1319042 in our sensor chip induced with 2&nbsp;µL IPTG and measured with a plate reader. Blue color indicates no fluorescence, red color indicates fluorescence. Top chip is not induced, bottom chip is induced with IPTG.|width=300px}}<br />
<br />
To establish a prove of principle we used our construct [http://parts.igem.org/Part:BBa_K1319042 K1319042] an IPTG inducible iLOV. They were introduced into our sensor chips and then fluorescence was measured every 15 minutes after an induction with 2&nbsp;µl 100&nbsp;mM IPTG.<br />
<br />
There is a clear difference in fluorescence between the not induced chip (top) and the induced chip (bottom). It is distinctively visible that the middle of the bottom chip start to exhibit fluorescence and then the fluorescence increases over time and spreads outward. The top chip also shows a slight increase in measured fluorescence but it is nowhere near the level of the induced chip and is primarily attributable to a leaky promoter and the background fluorescence. <br />
<br />
This demonstrates a general proof of principle of the sensor chip design. Therefore the next was testing the detection of 3-oxo-C{{sub|12}} HSL.<br />
<html></br></br></br></br></br></br></br></br></br></br></br></br></br></br></br></br></br></br></br></br><br />
</html><br />
<br />
=== Detecting 3-oxo-C{{sub|12}} HSL with Sensor Chips ===<br />
<br />
{{Team:Aachen/FigureFloatRight|Aachen_K131026_Platereader.gif|title=Testing K131026 in our sensor chips|subtitle=K131026 in our sensor chip induced with 0.2&nbsp;µL 3-oxo-C{{sub|12}} HSL and measured with a plate reader. Blue color indicates no fluorescence, red color indicates fluorescence. Top chip is not induced, bottom chip is induced with IPTG.|width=300px}}<br />
<br />
As a next step, we used [http://parts.igem.org/Part:BBa_K131026 K131026] from the 2008 iGEM Team Calgary in our sensor chips to detect 3-oxo-C{{sub|12}} HSL which is produced by ''Pseudomonas&nbsp;aeruginosa'' during quorum sensing. First, we tested them by direct induction with purified 3-oxo-C{{sub|12}} HSL (0.2&nbsp;µL, 500&nbsp;µg/mL). A fluorescence measurement was taken every 15&nbsp;min with an excitation wavelength of 496&nbsp;nm and an emission wavelength of 516&nbsp;nm (for GFP).<br />
<br />
The measured fluorescence again showed a distinct signal on the induced chip (bottom) compared to the uninduced chip (top). The fluorescence clearly starts in the middle of the chip (point of induction) and then extends outwards, still showing an ever increasing signal of fluorescence. The base level of fluorescence is attributed to leakiness of the promoter and general background fluorescence of growing ''E. coli'' cells. In the induced chip (bottom), the background fluorescence is a lot lower than in the uninduced chip (top) because the signal masks the noise. The difference between the induced and uninduced chips indicates a clear response to the HSL and a proof for the ability of our sensor chip design to detect the HSL produced by ''Pseudomonas&nbsp; aeruginosa''.<br />
<br />
<html></br></br></br></br></br></br></br></br></br></br></br></br></br></br></br></br></html><br />
<br />
=== Detecting IPTG with Sensor Chips ===<br />
{{Team:Aachen/FigureFloat|Aachen_I746909_slower_reduced.gif|title=IPTG inducible superfolder GFP (I746909) in sensor chips|subtitle=IPTG inducible superfolder GFP (I746909) is induced with IPTG (2 µl, 100mM) on the right chip with a non induced chip on the left|width=480px}}<br />
This video shows the construct [http://parts.igem.org/Part:BBa_I746909 I746909] from the 2007 iGEM Team Cambridge. This BioBrick is a producer of superfolder GFP under the control of a T7 promoter. It was introduced into BL21(DE3) cells making the expression IPTG inducible through the T7 RNA Polymerase encoded in the genome of BL21(DE3) under the control of a lacI promoter. <br />
<br />
The left chip does not show visible fluorescence and the right chip exhibits a strong fluorescence signal showing clearly the ability of the sensor chip technology to detect IPTG. On top of that, the fluorescence response is strong enough to be detected and analyzed by the measurement device WatsOn.<br />
<html></br></br></br></br></br></br></br></br></br></br></br></br></br><br />
</html><br />
<br />
===Detecting the 3-oxo-C{{sub|12}} HSL with K131026 in our Sensor Chips with WatsOn===<br />
<br />
{{Team:Aachen/FigureFloatRight|Aachen_K131026_HSLdetection_slow.gif|title=Detection of 3-oxo-C{{sub|12}} HSL with K131026|subtitle=0.2 µL of 3-oxo-C{{sub|12}} HSL was placed in the middle of the chip and then incubated at 37&nbsp;°C in WatsOn.|width=480px}}<br />
<br />
The next step towards the final goal to detect ''Pseudomonas&nbsp;aeruginosa'' was to replicate the detection of 3-oxo-C{{sub|12}} HSL, which was established in the plate reader, in our own [https://2014.igem.org/Team:Aachen/Project/Measurement_Device ''WatsOn''] device. Therefore, we again used K131026 as our construct in ''E. coli'' BL21(DE3) cells and induced with 0.2&nbsp;µL 3-oxo-C{{sub|12}} HSL with a concentration of 500&nbsp;µg/mL. The right chip was induced and - as a negative control - the left chip was not induced. Pictures were taken every 4&nbsp;min.<br />
<br />
The result was a clear replication of the success of the plate reader experiment. The induced chip shows a clear fluorescence response eminating from the center where the induction with HSL took place. This demonstrates the ability of not only our sensor chips but also our measurement device WatsOn to successfully detect 3-oxo-C{{sub|12}} HSL.<br />
<br />
<html></br></br></br></br></br></br></br></br><br />
</html><br />
<br />
===Detecting ''Pseudomonas&nbsp;aeruginosa'' with K131026 in our Sensor Chip with WatsOn===<br />
{{Team:Aachen/FigureFloat|Aachen_K131026_Pseudomonas_aeruginosa_detection.gif|title=Detection of ''Pseudomonas aeruginosa'' with K131026|subtitle=Direct detection of ''Pseudomonas aeruginosa'' on our sensor chips. Sensor cell used were K131026.|width=480px}}<br />
<br />
After establishing the successful detection of 3-oxo-C{{sub|12}} with our sensor chips the next step was the detection of ''Pseudomonas aeruginosa'' with our measurement device WatsOn. Therefore sensor chips with K131026 were again prepared and the right chip was induced with 0.2&nbsp;µl of a ''Pseudomonas aeruginosa'' culture while the left chip was not induced. <br />
<br />
The results clearly demonstrate our ability to detect ''Pseudomonas aeruginosa'' with our measurement device WatsOn. On the induced chip a definite fluorescence response is visible in response to ''Pseudomonas aeruginosa''. The fluorescence eminates outward from the induction point and shows a significant difference to the non induced chip. Therefore detection of ''Pseudomonas aeruginosa'' is possible with our sensor chip technology in our measurement device WatsOn!<br />
<br />
<html></br></br></br></br></br></br></br></br><br />
</html><br />
<br />
=== Comparing the REACh Construct with K731520 and I746909 ===<br />
<br />
More information about the kinetic differences between these construct in our sensor chips, look under <br />
[https://2014.igem.org/Team:Aachen/Project/FRET_Reporter The REACh Construct] Achievements.<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-16_Outlook_Cellocks_iNB.png|right|150px]]<br />
<br />
== Outlook ==<br />
<span class="anchor" id="biosensoroutlook"></span><br />
<br />
After successfully detecting ''P.&nbsp;aeruginosa'', the next step in developing our sensor chip platform further is an improvement of the sampling chip. The current technique of using a simple agarose chip is not sufficient to collect all microorganisms from the sampled surface. Therefore, the aim is to improve the sampling chip by trying different, more adhesive material. <br />
<br />
Furthermore, diffusion in the sensor chips will be reduced to limit the spread of the fluorescence signal. Currently, the fluorescence spot grows at lot beyond the point of detection and makes it difficult to successfully differentitate between multiple points of induction. By introducing different diffusion barriers into our chips, the growth of the fluorescence spots might be limited, thus enabling the detection of multiple sources of fluorescence lying close together. <br />
<br />
Additionally, the application of our sensor chips in combination with our ''WatsOn'' device is currently being evaluated for the detection of signals other than fluorescence. Detecting bio- and chemiluminescence is identified as an area of potential future application. <br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
==References==<br />
<br />
* Waters, C. M., & Bassler, B. L. (2005). QUORUM SENSING: Cell-to-Cell Communication In Bacteria. Annual Review of Cell and Developmental Biology, 21(1), 319-346. Available online at http://www.annualreviews.org/doi/full/10.1146/annurev.cellbio.21.012704.131001.<br />
<br />
* Jimenez, P. N., Koch, G., Thompson, J. A., Xavier, K. B., Cool, R. H., & Quax, W. J. (2012). The Multiple Signaling Systems Regulating Virulence in Pseudomonas aeruginosa. Microbiology and Molecular Biology Reviews, 76(1), 46-65. Available online at http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3294424/#B63.<br />
<br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Project/2D_BiosensorTeam:Aachen/Project/2D Biosensor2014-10-17T10:41:11Z<p>VeraA: /* Agar Concentration */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
= 2D Biosensor =<br />
<br />
With our 2D biosensor technology we are able to detect the pathogen ''Pseudomonas aeruginosa'' on solid surfaces. The sensor system is comprised of '''two distinct but inseparable modules''', a biological and a technical part:<br />
<br />
* Sensing chips containing '''''Cellocks''''', our '''engineered detective cells''' that fluoresce in the presence of the pathogen, make up the biological part of ''Cellock Holmes''.<br />
* Our '''measurement device ''WatsOn''''' and the complementary '''software ''Measurarty''''' complete our sensing technology on the technical side. <br />
<br />
<center><br />
<html><ul class="team-grid" style="width:1064px;"><br />
<!-- Overview --><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Project/2D_Biosensor#biosensorpoo" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<div class="menukachel">Principle of Operation</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/6/6e/Aachen_15-10-14_Principle_of_operation_2D_sensor_ipo.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Project/2D_Biosensor#biosensordevelopment" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<div class="menukachel">Development & Optimization</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/a/a7/Aachen_14-10-16_Iterative_Process_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Project/2D_Biosensor#biosensorachievements" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<div class="menukachel">Achievements</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/e/ef/Aachen_14-10-15_Medal_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Project/2D_Biosensor#biosensoroutlook" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<div class="menukachel">Outlook</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-16_Outlook_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_15-10-14_Principle_of_operation_2D_sensor_ipo.png|right|150px]]<br />
<br />
== Principle of Operation ==<br />
<span class="anchor" id="biosensorpoo"></span><br />
<br />
''Cellock Holmes'' is designed upon a SynBio approach comprising a '''two-dimensional biosensor and a measurement unit'''. The two-dimensional biosensor is designed to recognize quorum sensing molecules secreted by the pathogen cells and to generate a distinct fluorescence signal; while the measurement device recognizes and analyzes the produced signal. <br />
<br>On the molecular side, we use the '''[https://2014.igem.org/Team:Aachen/Project/FRET_Reporter REACh construct]''' to transform regular ''E. coli'' cells into ''Cellocks''.<br />
<br />
{{Team:Aachen/Figure|Aachen 17-10-14 The basics of quorum sensing ipo.png||title=The basics of quorum sensing.|subtitle=Some microorganisms can sense the presence of their own kind based on quorum sensing which is a form of chemical communication. Quorum sensing allows these cells to behave differently depending on their cell density, e.g. by activation or deactivation of certain gene expression (Waters and Bassler, 2005).|width=1000px}}<br />
<br />
Our '''sensor cells, ''Cellocks'', are immobilized in agar chips'''. To make the chips, we mix the ''Cellocks'' with liquid LB agar. <br />
In the course of our project, we designed a casting mold specifically for the production of our agar chips. When the agar has cooled down, the chips are cut out of the mold and are ready to use. Storage of the readily usable sensor chips is possible for up to 2 days at 4 °C when using LB medium or up to 5 days if TB medium is used. A detailed description of the sensor chip manufacturing can be found in our [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection Protocols] section.<br />
<br />
{{Team:Aachen/Figure|Aachen 14-10-14 Flowsheet OD-device part1 ipo.png|title=Assay to detect ''P.&nbsp;aeruginosa'' using ''Cellock Holmes''|subtitle=This flow sheet shows the procedure to sample and detect ''P.&nbsp;aeruginosa'': A sampling chip is briefly put onto the potentially contaminated surface, added onto one of our sensor chips and inserted into ''WatsOn''.|width=1000px}}<br />
<br />
Using ''Cellock Holmes'', we developed a simple assay to detect ''P.&nbsp;aeruginosa''. <br />
* First, a sampling chip is placed on a solid surface that is potentially contaminated with the pathogen. <br />
* Second, the sampling chip is removed from the surface and put onto one of our sensor chips. (Theorectically, the sensor chips could be directly used for sampling, however, this was avoided in our project to '''match [https://2014.igem.org/Team:Aachen/Safety biosafety regulations]''' and to prevent the spread of GMOs into the environment.) <br />
* Third, the two layered chip-stack is put into a petri dish which is inserted into our measurement device [https://2014.igem.org/Team:Aachen/Project/Measurement_Device ''WatsOn''] for evalutation.<br />
<br />
{{Team:Aachen/Figure|Aachen 14-10-14 Flowsheet OD-device part2 ipo.png|title=Mode of action inside ''WatsOn''.|subtitle=Chips are incubated at 37 °C to stimulate cell growth and then illuminated with blue light to excite fluorescence. A picture is taken and analyzed for fluorescence signals using the software ''Measurarty''.|width=1000px}}<br />
<br />
Inside ''WatsOn'', the chips are incubated at 37&nbsp;°C and the sampled populations of microorganisms attached on the sampling chip start to grow and multiply. During incubation the chips can be '''illuminated with blue light''' at any time, and a '''photo of the chips''' is taken. The '''software ''Measurarty''''' then analyzes any fluorescent signal. ''P.&nbsp;aeruginosa'' secrets an increasing number of quorum sensing molecules that are recognized by ''Cellocks'', thereby producing a fluorescence signal. For detection of ''P.&nbsp;aeruginosa'', we focused on a quorum sensing molecule called N-3-oxo-dodecanoyl-L-homoserine lactone (for short: 3-oxo-C<sub>12</sub>-HSL), which is involved in virulence regulation of ''P.&nbsp;aeruginosa'' (Jimenez, Koch, Thompson et al., 2012). The incorporation of the 3-oxo-C<sub>12</sub>-HSL detection system into the ''Cellocks'' is explained in detail in the [https://2014.igem.org/Team:Aachen/Project/FRET_Reporter REACh Construct] section.<br />
<br />
<br />
</center><br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
<!-- ==A Novel Molecular Approach==<br />
<span class="anchor" id="biosensormolecularapproach"></span><br />
<br />
For our biosensor, our team genetically modified ''E. coli'' cells to be able to elecit a '''fluorescent response to autoinducers''' produced by the pathogen ''Pseudomonas aeruginosa'' during quorum sensing. In the case of ''P.&nbsp;aeruginosa'', these autoinducers are N-3-oxo-dodecanoyl-L-homoserine lactone, or 3-oxo-C-12-HSL for short. The quorum sensing system of this pathogen contains the '''LasR activator''' which binds 3-oxo-C-12-HSL, and the '''LasI promoter''', which is activated by the LasR-HSL complex. Both LasR activator and LasI promoter are available as BioBricks [http://parts.igem.org/Part:BBa_C0179 C0179] and [http://parts.igem.org/Part:BBa_J64010 J64010].<br />
<br />
As a reporter gene, we use '''GFP'''. However, expression of GFP is not simply controlled through the LasI promoter activity in our approach. Instead, our sensor cells contain genes for a constitutively expressed fusion protein consisting of GFP and a dark quencher, and an '''HSL-inducible protease'''. We use the REACh protein as dark quencher for GFP and the TEV protease to cleave the complex; [https://2014.igem.org/Team:Aachen/Project/FRET_Reporter here] you can read more about the REACh construct and the TEV protease. <br />
<br />
{{Team:Aachen/Figure|align=center|Aachen_REACh_approach.png|title=Our novel biosensor approach|subtitle=Expression of the TEV protease is induced by HSL. The protease cleaves the GFP-REACh fusion protein to elecit a fluorescence response.|width=500px}}<br />
<br />
When ''P.&nbsp;aeruginosa cells'' are stuck on our agar chip and come close to our sensor cells, the latter take up the HSL molecules secreted by the pathogens. Inside the sensor cells, the autoinducer binds to the LasR gene product and activate the expression of the TEV protease. The protease then cleaves the GFP-REACh construct. When '''illuminated with light of 480&nbsp;nm''', the excitation wavelenght of GFP, our sensor cells in the vicinity of ''P.&nbsp;aeruginosa'' give a '''fluorescence signal'''. On the other hand, sensor cells that were not anywhere close to the pathogens do not express the protease. Therefore, the GFP will still be attached to the dark quencher in these cells, and no fluorescence is produced.<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}} --><br />
[[File:Aachen_14-10-16_Iterative_Process_iNB.png|right|150px]]<br />
<br />
== Development & Optimization ==<br />
<span class="anchor" id="biosensordevelopment"></span><br />
<br />
=== Medium ===<br />
Prior to using our own device for detection of fluorescence emitted by the sensor chips we used equipment readily available in the lab. A Molecular Imager&reg; Gel Doc<sup>TM</sup> XR+ from BIO-RAD was available which uses UV and white light illuminators. However, only two different filters were available for the excitation ligth wavelength, which resulted in very limitted possibilities for the excitation of fluorescent molecules. For example, it was possible to detect the expression of iLOV in our sensor chips but the detection of GFP was not possible. It was thus determined that the '''Gel Doc<sup>TM</sup> was not suitable for our project'''.<br />
<br />
{{Team:Aachen/Figure|Aachen_ILOV_GFP_HM_1,5h.png|title=iLOV and GFP in the Gel Doc<sup>TM</sup>|subtitle=Sensor cells producing iLOV (A) and GFP (B) 1.5&nbsp;h after induction.|width=900px}}<br />
<br />
Regarding the medium used for our sensor chips, LB medium showed a high background fluorescence when exposed to UV light in the Gel Doc. Surprisingly, the background fluorescence resulting from the LB medium was too high to detect a signal emitted by our sensor cells. Hence, minimal media (NA, M9, Hartman (HM)) was used to minimize background fluorescence, but this approach resulted in less to no growth of our sensor cells.<br />
<br />
{{Team:Aachen/Figure|Aachen_Chip_medium_geldoc.png|title=Differend medium in the Gel Doc<sup>TM</sup>|subtitle=complex media (LB) exhibited high background fluorescence while less background fluorescence was observed with the minimal media (HM, M9, NA).|width=900px}}<br />
{{Team:Aachen/FigureFloat|Aachen_5days_K131026_neb_tb_1,5h.jpg |title=Testing our chips' shelf-life.|subtitle= [http://parts.igem.org/Part:BBa_K131026 K131026] in NEB induced after 5 days of storage at 4&nbsp;°C. The right chip was induced with 0.2&nbsp;µL of 500&nbsp;µg/mL HSL, and the image was taken after 1.5&nbsp;h.|width=300px}}<br />
<br />
In our device ''WatsOn'', optimized wavelengths of 450&nbsp;nm and 480&nbsp;nm were used for excitation of iLOV and GFP, respectively. When exposed to either excitation wavelength TB medium, which is basically an improved LB medium and highly supports cell growth, showed strong background fluorescence in our own device. High background fluorescence was also observed for TB medum when using the Gel Doc. In contrast to the Gel Doc LB medium showed minimal fluorescence in our device ''WatsOn'' and no difficulties in cultivation of our ''Cellocks'' were observed. Because of the reduced fluorescence compared to TB medium when using ''Watson'' for sensor chip evaluation and because of sufficient cultivation conditions for our 'Cellocks'' LB medium was chosen over TB mediium for sensor chip manufacturing.<br />
<br />
Further experiments were conducted to test long-time storage of the sensor chips. Storage at -20 °C resulted in the loss of our sensor cells. Adding 5-10% (v/v) glycerol ensured survival of the sensor cells, but resulted in an expression stop of fluorescence proteins. Thus, the idea of long time storage of the sensor chips had to be passed on. However, it was possible to store ready-to-use sensor chips for 2 days at 4&nbsp;°C when using LB medium and storage for 5 days was possible with chips made from TB medium.<br />
<br />
=== Agar Concentration ===<br />
For the sensor chip manufacturing, a concentration of 1.5&nbsp;% agarose was found to be optimal. When agarose concentrations below 1.5% (w/v) were used the sensor chips were easily damaged and were not transportable. Agar concentrations over 1.5% (w/v) had to be avoided, because the agarose started to solidify before it could be poured into the chip casting mold.<br />
Agarose was chosen over agar, because of a more even linkage between molecules resulting in a better chip homogenity. In addition, agarose reduced diffusion of inducer molecules through the chip. A reduction in diffusion was desired in order to achieve distinct fluorescent spots on the sensor chips.<br />
<br />
=== Chip Form ===<br />
Various approaches were tried for production of sensor chips with reproducable quality. The first approach was to cast every sensor chip individually. In order to achieve a plain chip surface, which was required for high quality images, we tried to cast the sensor chips between four microscope slides. This approach had to be rejected, because the agar was too liquid. In a second try, we produced a closed mold into which liquid agar was injected using a pipette, but we encountered a high number of bubbles in the chips when using this method. Bubbles in the sensor chips resulted in problems during fluorescence evalutaion.<br />
<br />
{{Team:Aachen/Figure|Aachen_2_chipform.jpg|title=Chips made using the closed mold|subtitle=With this method we encounter problems due to frequent bubble formation.|width=600px}}<br />
<br />
Finally, we used an open mold into which the agar was poured right after mixing with the sensor cells. When the agar had solidified the chips were cut out along precast indentations in the casting mold. An advantage of the open mold was the ability to simultaneously produce nine sensor chips while the surface tension of the liquid agar ensured a plane chip surface.<br />
<br />
{{Team:Aachen/Figure|Aachen_Final_chipform.jpg|title=Final chip mold.|subtitle=We found the above shown casting mold to be ideal for our purposes.|width=600px}}<br />
<br />
=== Induction ===<br />
For artificially induction of our molecular detection constructs we simluated the presence of ''P.&nbsp;aeruginosa'' by use of IPTG or 3-oxo-C12 HSL. <br />
A minimal pipetting volume was desired for induction, because initial experiments showed that diffusion of the inducers through the chip hindered formation of distinct spots on the chips. Due to the pipetts available the lowest volume we could pipett was limitted to 0.2 &nbsp;µL .<br />
Sensor cells based on ''E. coli'' BL21, which incorporated the [https://2014.igem.org/Team:Aachen/Parts#partsK1319042 K1319042] construct were able to detect IPTG concentrations down to 1&nbsp;mM (0.2&nbsp;µL), so were sensor cells based on ''E. coli'' BL21, which incorporated the REACh constructs.<br />
Sensor cells based on ''E. coli'' BL21, which incorporated the [http://parts.igem.org/Part:BBa_K131026 K131026] construct were able to detect HSL concentrations down to 500&nbsp;µg/mL (0.2&nbsp;µL). Further more, detection of growing ''Pseudomonas aeruginosa'' cells based on secreted HSLs was possible using the [http://parts.igem.org/Part:BBa_K131026 K131026] construct. A detailed description including pictures of the experiments leading to the just mentioned findings can be found in the [https://2014.igem.org/Team:Aachen/Project/2D_Biosensor#biosensorachievements Achievements] section.<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-15_Medal_Cellocks_iNB.png|right|150px]]<br />
<br />
==Achievements==<br />
<span class="anchor" id="biosensorachievements"></span><br />
<br />
We are able to detect IPTG, 3-oxo-C{{sub|12}} HSL and ''Pseudomonas aeruginosa''. To prove that the sensor constructs produce the flourescence signal and not the medium or ''E. coli'' in its own we have [http://parts.igem.org/Part:BBa_B0015 B0015] in NEB as a negativ control for IPTG, HSL and ''Pseudomonas aeruginosa'' induction.<br />
<br />
<br />
{{Team:Aachen/Figure|Aachen_B0015_IPTG_HSL_Pseudomonas.png|title=Negativ control |subtitle=B0015 in NEB as negativ control induced with A) 0.2&nbsp;µl of 100&nbsp;mM IPTG, image taken after 2.5&nbsp;h; B) 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12), image after 2.5&nbsp;h; C) with 5 spots of ''Pseudomonas aeruginosa'' on the left and one big spot on the right, image taken after 2&nbsp;h|width=900px}}<br />
<br />
=== Testing our Sensor Chips in a Plate Reader ===<br />
{{Team:Aachen/FigureFloat|Aachen_K1319042_Platereader.gif|title=Testing K1319042 in our sensor chips|subtitle=K1319042 in our sensor chip induced with 2&nbsp;µL IPTG and measured with a plate reader. Blue color indicates no fluorescence, red color indicates fluorescence. Top chip is not induced, bottom chip is induced with IPTG.|width=300px}}<br />
<br />
To establish a prove of principle we used our construct [http://parts.igem.org/Part:BBa_K1319042 K1319042] an IPTG inducible iLOV. They were introduced into our sensor chips and then fluorescence was measured every 15 minutes after an induction with 2&nbsp;µl 100&nbsp;mM IPTG.<br />
<br />
There is a clear difference in fluorescence between the not induced chip (top) and the induced chip (bottom). It is distinctively visible that the middle of the bottom chip start to exhibit fluorescence and then the fluorescence increases over time and spreads outward. The top chip also shows a slight increase in measured fluorescence but it is nowhere near the level of the induced chip and is primarily attributable to a leaky promoter and the background fluorescence. <br />
<br />
This demonstrates a general proof of principle of the sensor chip design. Therefore the next was testing the detection of 3-oxo-C{{sub|12}} HSL.<br />
<html></br></br></br></br></br></br></br></br></br></br></br></br></br></br></br></br></br></br></br></br><br />
</html><br />
<br />
=== Detecting 3-oxo-C{{sub|12}} HSL with Sensor Chips ===<br />
<br />
{{Team:Aachen/FigureFloatRight|Aachen_K131026_Platereader.gif|title=Testing K131026 in our sensor chips|subtitle=K131026 in our sensor chip induced with 0.2&nbsp;µL 3-oxo-C{{sub|12}} HSL and measured with a plate reader. Blue color indicates no fluorescence, red color indicates fluorescence. Top chip is not induced, bottom chip is induced with IPTG.|width=300px}}<br />
<br />
As a next step, we used [http://parts.igem.org/Part:BBa_K131026 K131026] from the 2008 iGEM Team Calgary in our sensor chips to detect 3-oxo-C{{sub|12}} HSL which is produced by ''Pseudomonas&nbsp;aeruginosa'' during quorum sensing. First, we tested them by direct induction with purified 3-oxo-C{{sub|12}} HSL (0.2&nbsp;µL, 500&nbsp;µg/mL). A fluorescence measurement was taken every 15&nbsp;min with an excitation wavelength of 496&nbsp;nm and an emission wavelength of 516&nbsp;nm (for GFP).<br />
<br />
The measured fluorescence again showed a distinct signal on the induced chip (bottom) compared to the uninduced chip (top). The fluorescence clearly starts in the middle of the chip (point of induction) and then extends outwards, still showing an ever increasing signal of fluorescence. The base level of fluorescence is attributed to leakiness of the promoter and general background fluorescence of growing ''E. coli'' cells. In the induced chip (bottom), the background fluorescence is a lot lower than in the uninduced chip (top) because the signal masks the noise. The difference between the induced and uninduced chips indicates a clear response to the HSL and a proof for the ability of our sensor chip design to detect the HSL produced by ''Pseudomonas&nbsp; aeruginosa''.<br />
<br />
<html></br></br></br></br></br></br></br></br></br></br></br></br></br></br></br></br></html><br />
<br />
=== Detecting IPTG with Sensor Chips ===<br />
{{Team:Aachen/FigureFloat|Aachen_I746909_slower_reduced.gif|title=IPTG inducible superfolder GFP (I746909) in sensor chips|subtitle=IPTG inducible superfolder GFP (I746909) is induced with IPTG (2 µl, 100mM) on the right chip with a non induced chip on the left|width=480px}}<br />
This video shows the construct [http://parts.igem.org/Part:BBa_I746909 I746909] from the 2007 iGEM Team Cambridge. This BioBrick is a producer of superfolder GFP under the control of a T7 promoter. It was introduced into BL21(DE3) cells making the expression IPTG inducible through the T7 RNA Polymerase encoded in the genome of BL21(DE3) under the control of a lacI promoter. <br />
<br />
The left chip does not show visible fluorescence and the right chip exhibits a strong fluorescence signal showing clearly the ability of the sensor chip technology to detect IPTG. On top of that, the fluorescence response is strong enough to be detected and analyzed by the measurement device WatsOn.<br />
<html></br></br></br></br></br></br></br></br></br></br></br></br></br><br />
</html><br />
<br />
===Detecting the 3-oxo-C{{sub|12}} HSL with K131026 in our Sensor Chips with WatsOn===<br />
<br />
{{Team:Aachen/FigureFloatRight|Aachen_K131026_HSLdetection_slow.gif|title=Detection of 3-oxo-C{{sub|12}} HSL with K131026|subtitle=0.2 µL of 3-oxo-C{{sub|12}} HSL was placed in the middle of the chip and then incubated at 37&nbsp;°C in WatsOn.|width=480px}}<br />
<br />
The next step towards the final goal to detect ''Pseudomonas&nbsp;aeruginosa'' was to replicate the detection of 3-oxo-C{{sub|12}} HSL, which was established in the plate reader, in our own [https://2014.igem.org/Team:Aachen/Project/Measurement_Device ''WatsOn''] device. Therefore, we again used K131026 as our construct in ''E. coli'' BL21(DE3) cells and induced with 0.2&nbsp;µL 3-oxo-C{{sub|12}} HSL with a concentration of 500&nbsp;µg/mL. The right chip was induced and - as a negative control - the left chip was not induced. Pictures were taken every 4&nbsp;min.<br />
<br />
The result was a clear replication of the success of the plate reader experiment. The induced chip shows a clear fluorescence response eminating from the center where the induction with HSL took place. This demonstrates the ability of not only our sensor chips but also our measurement device WatsOn to successfully detect 3-oxo-C{{sub|12}} HSL.<br />
<br />
<html></br></br></br></br></br></br></br></br><br />
</html><br />
<br />
===Detecting ''Pseudomonas&nbsp;aeruginosa'' with K131026 in our Sensor Chip with WatsOn===<br />
{{Team:Aachen/FigureFloat|Aachen_K131026_Pseudomonas_aeruginosa_detection.gif|title=Detection of ''Pseudomonas aeruginosa'' with K131026|subtitle=Direct detection of ''Pseudomonas aeruginosa'' on our sensor chips. Sensor cell used were K131026.|width=480px}}<br />
<br />
After establishing the successful detection of 3-oxo-C{{sub|12}} with our sensor chips the next step was the detection of ''Pseudomonas aeruginosa'' with our measurement device WatsOn. Therefore sensor chips with K131026 were again prepared and the right chip was induced with 0.2&nbsp;µl of a ''Pseudomonas aeruginosa'' culture while the left chip was not induced. <br />
<br />
The results clearly demonstrate our ability to detect ''Pseudomonas aeruginosa'' with our measurement device WatsOn. On the induced chip a definite fluorescence response is visible in response to ''Pseudomonas aeruginosa''. The fluorescence eminates outward from the induction point and shows a significant difference to the non induced chip. Therefore detection of ''Pseudomonas aeruginosa'' is possible with our sensor chip technology in our measurement device WatsOn!<br />
<br />
<html></br></br></br></br></br></br></br></br><br />
</html><br />
<br />
=== Comparing the REACh Construct with K731520 and I746909 ===<br />
<br />
More information about the kinetic differences between these construct in our sensor chips, look under <br />
[https://2014.igem.org/Team:Aachen/Project/FRET_Reporter The REACh Construct] Achievements.<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-16_Outlook_Cellocks_iNB.png|right|150px]]<br />
<br />
== Outlook ==<br />
<span class="anchor" id="biosensoroutlook"></span><br />
<br />
After successfully detecting ''P.&nbsp;aeruginosa'', the next step in developing our sensor chip platform further is an improvement of the sampling chip. The current technique of using a simple agarose chip is not sufficient to collect all microorganisms from the sampled surface. Therefore, the aim is to improve the sampling chip by trying different, more adhesive material. <br />
<br />
Furthermore, diffusion in the sensor chips will be reduced to limit the spread of the fluorescence signal. Currently, the fluorescence spot grows at lot beyond the point of detection and makes it difficult to successfully differentitate between multiple points of induction. By introducing different diffusion barriers into our chips, the growth of the fluorescence spots might be limited, thus enabling the detection of multiple sources of fluorescence lying close together. <br />
<br />
Additionally, the application of our sensor chips in combination with our ''WatsOn'' device is currently being evaluated for the detection of signals other than fluorescence. Detecting bio- and chemiluminescence is identified as an area of potential future application. <br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
==References==<br />
<br />
* Waters, C. M., & Bassler, B. L. (2005). QUORUM SENSING: Cell-to-Cell Communication In Bacteria. Annual Review of Cell and Developmental Biology, 21(1), 319-346. Available online at http://www.annualreviews.org/doi/full/10.1146/annurev.cellbio.21.012704.131001.<br />
<br />
* Jimenez, P. N., Koch, G., Thompson, J. A., Xavier, K. B., Cool, R. H., & Quax, W. J. (2012). The Multiple Signaling Systems Regulating Virulence in Pseudomonas aeruginosa. Microbiology and Molecular Biology Reviews, 76(1), 46-65. Available online at http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3294424/#B63.<br />
<br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Project/FRET_ReporterTeam:Aachen/Project/FRET Reporter2014-10-17T10:40:37Z<p>VeraA: /* REACh Proteins - Dark Quenchers of GFP */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
=The REACh Construct=<br />
<br />
On this page, we present our biosensor on the molecular level. Explore the different parts of our genetic device:<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid" style="width:inherit;"><br />
<!-- Overview --><br />
<br />
<li style="width: 156px;margin-left: 8px;margin-right: 8px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Project/FRET_Reporter#fluorescence" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">A Faster Answer</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/0/0b/Aachen_14-10-13_GFP_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width: 156px;margin-left: 8px;margin-right: 8px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Project/FRET_Reporter#fret" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">The FRET System</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/5/54/Aachen_14-10-13_FRET_Arrows_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width: 156px;margin-left: 8px;margin-right: 8px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Project/FRET_Reporter#darkquencher" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">REACh Quenchers</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/65/Aachen_14-10-13_REACh_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width: 156px;margin-left: 8px;margin-right: 8px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Project/FRET_Reporter#gfp-reach" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">The Fusion Protein</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/0/02/Aachen_14-10-13_Fusion_Protein_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width: 156px;margin-left: 8px;margin-right: 8px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Project/FRET_Reporter#tevprotease" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">TEV Protease</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/dc/Aachen_14-10-13_TEV_Protease_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
<br />
<br/><br />
<br />
<li style="width: 156px;margin-left: 8px;margin-right: 8px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Project/FRET_Reporter#reachachievements" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">Achieve-<br/>ments</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/e/ef/Aachen_14-10-15_Medal_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width: 156px;margin-left: 8px;margin-right: 8px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Project/FRET_Reporter#reachoutlook" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">Outlook</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-16_Outlook_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-13_GFP_iNB.png|150px|right]]<br />
<br />
= A Fluorescence Answer Faster Than Expression =<br />
<span class="anchor" id="fluorescence"></span><br />
Biosensors often work with a system that is comprised of a reported gene under the control of a promoter directly induced by the chemical that the sensor is supposed to detect. In the case of our 2D biosensor for ''Pseudomonas&nbsp;aeruginosa'', the expression of our reporter gene, GFP, would be directly induced by the activity of the bacterium's quorum sensing molecules. However, transcription, translation, folding and post-translational modifications take their time. Since our goal is to detect the pathogen as fast as possible, we wanted to use a system that gives a fluorescent answer fast than just expressing the fluorescent protein.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_Traditional_biosensor.png|align=center|title=Approach of a traditional biosensor|subtitle=In this model, the expression of GFP is directly controlled by a promoter whose activator binds to a molecule secreted by the pathogen.|width=500px}}<br />
</center><br />
<br />
Instead of the traditional approach, we '''constitutively express our reporter gene in a quenched form'''. As GFP-REACh fusion protein, fluorescence is suppressed. Our biosensor gives a response when homoserine lactones of ''Pseudomonas&nbsp;aeruginosa'' are taken up by our sensor cells where the '''autoinducer activates the expression of the TEV protease''' by binding to the LasI promoter in front of the protease gene.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_REACh_approach.png|align=center|title=Our novel biosensor approach|subtitle=Expression of the TEV protease is induced by HSL. The protease cleaves the GFP-REACh fusion protein to elicit a fluorescence response.|width=900px}}<br />
</center><br />
<br />
This approach has two advantages:<br />
* When ''Pseudomonas&nbsp;aeruginosa'' is detected by our cells, the reporter protein has already been expressed and only waits to be cleaved off the REACh quencher. The cleavage reaction catalyzed by the TEV protease is a faster process than expression and correct folding of GFP. This way we hope for '''an earlier response''' by our sensor cells.<br />
<br />
* While a certain concentration of homoserine lactone will produce the same number of gene read-outs, one TEV protease can cleave many GFP-REACh constructs. Through the cleavage step, we introduce an '''amplification step''' into our system. With the TEV protease, we will be able to produce '''a much stronger signal''' in a short time interval.<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-13_FRET_Arrows_iNB.png|150px|right]]<br />
<br />
=The FRET (Förster Resonance Energy Transfer) System=<br />
<span class="anchor" id="fret"></span><br />
<br />
Förster resonance energy transfer (FRET), sometimes also called fluorescence resonance energy transfer, is a physical process of energy transfer. In FRET, the energy of a donor chromophore, whose electrons are in an excited state, is passed to a second chromophore, the acceptor. The '''energy is transferred without radiation''' and is therefore not exchanged via emission and absorption of photons. The acceptor then releases the energy received from the donor, for example, as light of a longer wavelength. <br />
<br />
In biochemistry and cell biology, fluorescent dyes, which interact via FRET, are applied as "optical nano metering rules", because the intensity of the transfer is dependent on the spacing between donor and acceptor, and can be observed over distances of up to 10&nbsp;nm. This way, protein-protein interactions and conformational changes of a variety of tagged biomolecules can be observed. For efficient FRET to occur, there must be a substantial overlap between the donor fluorescence emission spectrum and the acceptor fluorescence excitation (or absorption) spectrum ([http://www.nature.com/nprot/journal/v8/n2/full/nprot.2012.147.html Broussard et al., 2013]), as described in the figure below.<br />
<br />
{{Team:Aachen/Figure|Aachen_14-10-07_Jablonski_Diagram_and_Absorption_Spectra_iNB.png|align=center|title=FRET betweeen donor and acceptor|subtitle=On the left: Jablonski diagram showing the transfer of energy between donor and acceptor; on the right: For successful FRET, the emission spectrum of of the donor has to overlap with the absorption spectrum of the acceptor.|width=900px}}<br />
<br />
However, '''fluorescence is not an essential requirement for FRET'''. This type of energy transfer can also be observed between donors that are capable of other forms of radiation, such as phosphorescence, bioluminescence or chemiluminescence, and fit acceptors. Acceptor chromophores do not necessarily emit the energy in form of light, and can lead to quenching instead. Thus, this kind of acceptors are also referred to as '''dark quenchers'''. In our project, we use a FRET system with a dark quencher, namely our '''REACh construct'''.<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-13_REACh_iNB.png|150px|right]]<br />
<br />
=REACh Proteins - Dark Quenchers of GFP=<br />
<span class="anchor" id="darkquencher"></span><br />
<br />
<center><br />
{{Team:Aachen/FigureFloat|Aachen_K1319000.gif|align=center|title=Homology model of REACh.|subtitle=This homology model was created with SWISS-MODEL. We used Chimera to prepare and export a scene that was then rendered into an animation with POV-Ray.|width=256px}}<br />
</center><br />
<br />
In 2006, [http://www.pnas.org/content/103/11/4089.full Ganesan et al.] were the first to present a previously undescribed FRET acceptor, a non-fluorescent yellow fluorescent protein (YFP) mutant called '''REACh (for Resonance Energy-Accepting Chromoprotein)'''. YFP can be used as a FRET acceptor in combination with GFP as the donor in FRET microscopy and miscellaneous assays in molecular biology. The ideal FRET couple should possess a large spectral overlap between donor emission and acceptor absorption - as illustrated in previous section - but have separated emission spectra to allow their selective imaging.<br />
<br />
To optimize the spectral overlap of this FRET pair, the group obtained '''a genetically modified YFP acceptor'''. Mutations of amino acid residues that stabilize the excited state of the chromophore in enhanced YFP (EYFP) resulted in a non-fluorescent chromoprotein. Two mutations, H148V and Y145W, reduced the fluorescence emission by 82 and 98%, respectively. Ganesan et al. chose the Y145W mutant and the Y145W/H148V double mutant as FRET acceptors, and named them REACh1 and REACh2, respectively. '''Both REACh1 and REACh2 act as dark quenchers of GFP'''.<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-13_Fusion_Protein_iNB.png|150px|right]]<br />
<br />
=Producing a GFP-REACh Fusion Protein=<br />
<span class="anchor" id="gfp-reach"></span><br />
<br />
In our project, we reproduced the REACh1 and REACh2 proteins by subjecting an RFC-25 compatible version of the BioBrick [http://parts.igem.org/Part:BBa_E0030 E0030] (EYFP) to a '''QuikChange mutation''', creating the BioBricks [http://parts.igem.org/Part:BBa_K1319001 K1319001] and [http://parts.igem.org/Part:BBa_K1319002 K1319002]. Subsequently, we fused each REACh protein with '''GFP (mut3b)''' which is available as BioBrick [http://parts.igem.org/Part:BBa_E0040 E0040]. The protein complex was linked via a '''protease cleavage site''', [http://parts.igem.org/Part:BBa_K1319016 K1319016]. As constitutive promoter we use [http://parts.igem.org/Part:BBa_J23101 J232101]. When GFP is connected to either REACh quencher, GFP will absorb light but the energy will be transferred to REACh via FRET and is then emitted in the form of heat; the fluorescence is quenched. Our cells also constitutively express the '''[http://parts.igem.org/Part:BBa_C0179 LasR] activator'''. Together with the HSL molecules from ''P. aeruginosa'', LasR binds to the '''[http://parts.igem.org/Part:BBa_J64010 LasI] promoter''' that controls the expression of the TEV protease, which we make available as [http://parts.igem.org/Part:BBa_K1319004 K1319004]. When the fusion protein is cleaved by the TEV protease, REACh will be separated from GFP. The latter will then be able to absorb and emit light as usual.<br />
<br />
{{Team:Aachen/Figure|align=center|Aachen_14-10-08_REACh_approach_with_BioBricks_iNB.png|title= Composition of our biosensor|subtitle=For our biosensor, we use a mix of already available and self-constructed BioBricks.|width=900px}}<br />
<br />
The resulting fusion proteins were labelled as [http://parts.igem.org/Part:BBa_K1319013 K1319013] (GFP fused with REACh1) and [http://parts.igem.org/Part:BBa_K1319014 K1319014] (GFP fused with REACh 2) and the linker between the proteins is labelled as [http://parts.igem.org/Part:BBa_K1319013 K1319016].<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-13_TEV_Protease_iNB.png|150px|right]]<br />
<br />
=Cutting the Fusion Protein with the TEV Protease=<br />
<span class="anchor" id="tevprotease"></span><br />
<br />
To cut the GFP-REACh fusion protein off, we chose '''Tobacco Etch Virus (TEV) protease''', a highly sequence-specific cysteine protease, that is frequently used for the controlled cleavage of fusion proteins ''in vitro'' and ''in vivo''. The native protease also contains an internal self-cleavage site. This site is slowly cleaved to inactivate the enzyme. The physiological reason for the self-cleavage is unknown, however, undesired for our use. Therefore, our team uses a variant of the native TEV protease containing the mutation S219V which results in an alteration of the cleavage site so that self-inactivation is diminished.<br />
<br />
{{Team:Aachen/Figure|Aachen_TEV_Protease_Model.png|title=TEV protease with a bound peptide|subtitle=This picture shows the TEV protease with a peptide chain bound in the binding pocket ready to be cleaved. The bound peptide chain has the recognition sequence inside the binding pocket. It was rendered with POV-Ray.|width=800px}}<br />
<br />
Though quite popular in molecular biology, the TEV protease is not avaiable as a BioBrick yet. Hence, the Aachen team introduces a protease with anti-self cleavage mutation S219V and codon optimized for ''E. coli'' [http://parts.igem.org/Part:BBa_K1319004 '''to the Parts Registry this year.''']<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-15_Medal_Cellocks_iNB.png|right|150px]]<br />
<br />
== Achievements ==<br />
<span class="anchor" id="reachachievements"></span> <br />
<br />
===Characterization of GFP-REACh1 and GFP-REACh2 in Combination with an IPTG-inducible TEV Protease===<br />
<br />
The characterization of the TEV protease and the REACh1 and REACh2 dark quenchers was performed by introducing both simultaneously into ''E.&nbsp;coli''. The resulting double plasmid cells therefore contained [http://parts.igem.org/Part:BBa_K1319013 K1319013] (GFP-REACh1 fusion protein) or [http://parts.igem.org/Part:BBa_K1319014 K1319014] (GFP-REACh2 fusion protein) and [http://parts.igem.org/Part:BBa_K1319008 K1319008] (IPTG-inducible TEV protease). K1319013 and K1319014 were cloned into a pSB3K3 plasmid backbone and K1319008 into a pSB1C3 backbone, two standard plasmids with different ORIs allowing simultaneous use in one cell. <br />
<br />
[http://parts.igem.org/Part:BBa_I20260 I20260] was used as a positive control. I20260 contains the same promoter ([http://parts.igem.org/Part:BBa_J23101 J23101]), the same RBS ([http://parts.igem.org/Part:BBa_B0032 B0032]) and the same version of GFP ([http://parts.igem.org/Part:BBa_E0040 E0040]) and is located on the same plasmid backbone, pSB3K3. Therefore, it is expected that when all fusion proteins are successfully cut by the TEV protease, the fluorescence level of the double plasmid constructs reaches the same level as the positive control of I20260. As a negative control, we used [http://parts.igem.org/Part:BBa_B0015 B0015], a coding sequence of a terminator which should not show any sign of fluorescence.<br />
<br />
To better evaluate the fluorescence, we took the observed OD into account in order to achieve a fluorecence reading independent of the amount of cells present. This way, the reading represents of the amount of fluorescence per cell only. To characterize our REACh1/2 constructs in combination with the TEV protease, we carried out a growth experiment. We compared both of the REACh-TEV constructs, a constitutive expression of GFP (I20260) as positive control and B0015 as negative control. For each expression, we ran IPTG-induced and uninduced cultures in parallel. All measurements were done in a biological triplicate. <br />
<br />
{{Team:Aachen/Figure|Aachen 16-10-14 Graph2iFG.PNG|title=Comparison of K1319013 + K1319008, K1319014 + K1319008, I20260 (positive control) and B0015 (negative control)|subtitle=Fluorescence was normalized by dividing by the optical density.|width=700px}}<br />
<br />
The negative control B0015 did not exhibit any significant fluorescence, as expected. The positive control I20260 showed a steady increase in fluorescence for the first 5 hours. After that, the fluorescence stayed constant due to the end of the exponential growth phase. In this state, growth becomesstationary and the cells do not produce GFP anymore. As expected, the production is also independent of addition of IPTG. <br />
<br />
Both double plasmid constructs K1319013 + K1319008 and K1319014 + K1319008 did not exhibit a strong fluorescence before induction with IPTG. In the uninduced state, the fluorescence stays low and only increases slightly over time. It is significantly weaker than the fluorescence reached by the induced constructs or the positive control but was higher than the negative control. This shows that the promoter system used is not completely shut down without induction but significantly weaker compared to the induced state. The basal level of fluorescence might partly be due to an imperfect dark quenching of GFP by the REACh1 or REACh2.<br />
<br />
The induced double plasmid constructs exhibited a fast rise in fluorescence after induction. '''The signal strenght increased 10-fold over the uninduced constructs.''' K1319013 + K1319008 reached the the same level of fluorescence as I20260, indicating a complete cleavage of the fusion proteins by the TEV protease. K1319014 + K1319008 did not reach a level of fluorescence as high as K1319013 + K1319008, however, the nearly 10-fold increase in fluorescence after induction is a clear indicator for the TEV protease cutting the fusion protein K1319014. The weaker fluorescence was probably due to a lower expression level of K1319014 in the cells in general. <br />
<br />
====Summary====<br />
<br />
The double plasmid systems of K1319013 + K1319008 and K1319014 + K1319008 clearly demonstrate the quenching ability of the REACh1 and REACh2 proteins as well as the funcionality of the TEV protease. Both REACH1 and REACH2 show a significant quenching ability of GFP shown in the difference of fluorescence between the positive control I20260 and the uninduced double plasmid systems. This has also been comfirmed by the sharp increase in fluorescence after induction showing that the TEV protease is successfully able to cut the fusion proteins, and proves a proper expression of both fusion proteins. Combined, this characterization is a '''validation of the functionality of the REACh1 protein ([http://parts.igem.org/Part:BBa_K1319001 K1319001]), the REACh2 protein ([http://parts.igem.org/Part:BBa_K1319002 K1319002]) and the TEV protease ([http://parts.igem.org/Part:BBa_K1319004 K1319004])'''.<br />
<br />
===Comparing Kinetics of the GFP-REACh fusion proteins with a Standard lacI-inducible GFP Expression===<br />
<br />
To assess the kinetics of the fusion proteins K1319013 (GFP-REACh1) and K1319014 (GFP-REACh2), the double plasmid systems K1319013 + K1319008 and K1319014 + K1319008 were compared to a standard expression of GFP under the control of a lacI promoter in [http://parts.igem.org/Part:BBa_K731520 K731520], a BioBrick made by the iGEM Team TRENTO in 2012. This way, we investigated the prediction a faster fluorescence response with our construct compared to a normal expression.<br />
<br />
K731520 and the double plasmid constructs K1319013 + K1319008 and K1319014 + K1319008 were cultivated in ''E. coli'' BL21(DE3), and fluorescence and OD were measured. Once again, the fluorescence was adjusted for the OD to show a relative fluorescence on a per cell basis. Besides, we carefully compared the difference between the induced and uninduced state. This difference, the fluorescence quotient, serves as a better indicator for a system which is used as a sensor because the difference between an ''on'' and ''off'' state is more important for a clear and unmistakable signal than to the overall fluorescence. Hence, the OD-adjusted fluorescence quotient for both double plasmid constructs and K731520 was obtained and plotted in the following graph.<br />
<br />
{{Team:Aachen/Figure|Aachen_16-10-14_GraphQuotient_iFG.PNG|Comparison of K1319013 + K1319008, K1319014 + K1319008 and K731520|subtitle=Fluorescence was normalized by dividing by the optical density. The fluorescence of induced cells was additionally divided by the fluorescence of uninduced cells to obtain the fluorescence quotient.|width=700px}}<br />
<br />
The graph clearly shows the faster response of the cut GFP-REACh fusion protein compared to a standard GFP expression. Both fluorescence signals of the double plasmid constructs achieve a higher difference in fluorescence signal between induced and uninduced state as well as at a faster rate. This proves the hypothesis made earlier about the kinetics of the GFP-REACh fusion protein combined with the TEV protease.<br />
<br />
====Summary====<br />
<br />
The kinetics of the fusion protein combined with the TEV protease exhibits the exact characteristics as predicted. The response is clearly faster than normal expression by accumulating a reservoir of fusion proteins which are not fluorescing due to the dark quencher attached to them. This reservoir is then activated by the induction of the TEV protease expression. Production of the protease results in the cleavage of the fusion protein, releasing GFP from the dark quencher and disturbing the interaction between the FRET pair. This results in the observed faster fluorescence reaction due to the amplificating effect of the TEV protease in which every one TEV protease can account for many fluorescence proteins being activated.<br />
<br />
===Characterizing the GFP-REACh Constructs in our Sensor Chips===<br />
<br />
<div class="figure" style="float:{{{align|left}}}; margin: 0px 10px 10px 40px; border:{{{border|0px solid #aaa}}};width:{{{width|500px}}};padding:10px 10px 0px 0px;"><br />
{|<br />
|<html> <img src="https://static.igem.org/mediawiki/2014/6/6d/Aachen_K1319014%2B8_and_K1319013%2B8_pixelig_minus_bg.gif" width="500px"></html><br />
|-<br />
|'''{{{title|K1319013 + K1319008 and K1319014 + K1319008 uninduced (top) and induced (bottom) in sensor cells }}}'''<br />{{{subtitle|The induced double plasmid systems K1319013 + K1319008 and K1319014&nbsp;+&nbsp;K1319008 exhibit a clear fluorescence response in our sensor cells which in response to induction with 2 µl IPTG. }}}<br />
|}<br />
</div><br />
To further characterize the REACh construct, they were introduced into the sensor cells which were then induced with 2&nbsp;µL IPTG with a concentration of 100&nbsp;mM. Subsequently, we took fluorescence measurement read-outs (GFP, excitation 496&nbsp;±&nbsp;9&nbsp;nm, emission&nbsp;516&nbsp;±&nbsp;9&nbsp;nm) roughly every 10&nbsp;min in the plate reader. The results were plotted in the heatmap shown on the left. <br />
<br />
The heatmap shows an increase of fluorescence from blue (no fluorescence) to red (high fluorescence). It is clearly visible that the induced chips are exhibiting a significantly higher fluorescence than the uninduced chips. This again shows that the constructs work as intended: The TEV protease cuts the linker so that the fusion protein is separated into GFP and a dark quencher, disabling the quenching. GFP has a clear fluorescence emission after the fusion protein has been successfully cut into two pieces by the TEV protease. <br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-16_Outlook_Cellocks_iNB.png|right|150px]]<br />
<br />
== Outlook ==<br />
<span class="anchor" id="reachoutlook"></span><br />
<br />
The system of the GFP-REACh fusion proteins with an inducible TEV protease has been established and shows clearly the desired results of being faster than normal expression. The next step will be to engineer the TEV protease to be inducible by the HSL instead of IPTG and then to incorporate both the inducible TEV protease and the fusion protein on one plasmid backbone. This would also allow us to choose a high copy plasmid for both inserts, instead of a high copy plasmid for the TEV protease and a low to mid copy plasmid for the fusion protein which should yield an overall higher fluorescence readout.<br />
<br />
Afterwards we would then like to characterize this construct the same way we have done with the double plasmid system and explore option for other fluorescence proteins than GFP to incorporate into our system with different quenchers to be able to have multiple fluorescence responses readable at the same time while being fast than the normal expression. <br />
<br />
Also finding and testing different promoters to induce the TEV protease is planned to be able to detect not only ''Pseudomonas aeruginosa'' but also other pathogens or other relevant molecules in general so that we can establish a concept for faster recognition for a variety of uses.<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
= References =<br />
* Broussard, Joshua A, Benjamin Rappaz, Donna J Webb, and Claire M Brown. "Fluorescence resonance energy transfer microscopy as demonstrated by measuring the activation of the serine/threonine kinase Akt." Nature protocols 8.2 (2013): 265-281. doi:10.1038/nprot.2012.147. <br />
<br />
* Ganesan, Sundar, Simon M. Ameer-beg, Tony T. C. Ng, Borivoj Vojnovic, and Fred S. Wouters. " A dark yellow fluorescent protein (YFP)-based Resonance Energy-Accepting Chromoprotein (REACh) for Förster resonance energy transfer with GFP." Proceedings of the National Academy of Sciences of the United States of America 103.11 (2006): 4089–4094. doi: 10.1073/pnas.0509922103 <br />
<br />
'''SWISS-MODEL'''<br />
* Marco Biasini, Stefan Bienert, Andrew Waterhouse, Konstantin Arnold, Gabriel Studer, Tobias Schmidt, Florian Kiefer, Tiziano Gallo Cassarino, Martino Bertoni, Lorenza Bordoli, Torsten Schwede. (2014). SWISS-MODEL: modelling protein tertiary and quaternary structure using evolutionary information. Nucleic Acids Research; doi: 10.1093/nar/gku340. <br />
* Arnold K., Bordoli L., Kopp J., and Schwede T. (2006). The SWISS-MODEL Workspace: A web-based environment for protein structure homology modelling. Bioinformatics, 22,195-201. <br />
* Kiefer F, Arnold K, Künzli M, Bordoli L, Schwede T (2009). The SWISS-MODEL Repository and associated resources. Nucleic Acids Research. 37, D387-D392. <br />
* Guex, N., Peitsch, M.C., Schwede, T. (2009). Automated comparative protein structure modeling with SWISS-MODEL and Swiss-PdbViewer: A historical perspective. Electrophoresis, 30(S1), S162-S173. <br />
<br />
'''UCSF Chimera'''<br />
* Pettersen EF, Goddard TD, Huang CC, Couch GS, Greenblatt DM, Meng EC, Ferrin TE. UCSF Chimera--a visualization system for exploratory research and analysis. JComput Chem. 2004 Oct;25(13):1605-12. PubMed PMID: 15264254.<br />
<br />
'''POV-Ray'''<br />
* Persistence of Vision Pty. Ltd. (2004) Persistence of Vision Raytracer (Version 3.7) [Computer software]. Retrieved from http://www.povray.org/download/<br />
<br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Notebook/Protocols/Analytical_methodsTeam:Aachen/Notebook/Protocols/Analytical methods2014-10-17T10:39:30Z<p>VeraA: </p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">2D Detection of<br/>IPTG & HSL</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/22/Aachen_14-10-14_button_chip_manufacturing_ipo.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/Culture_medium_and_conditions" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">Culture Media</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/10/Aachen_14-10-13_Yellow_Flask_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/Molecular_biological_methods" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">Molecular biological methods</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/75/Aachen_14-10-14_Eppi_with_green_cells_panel_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/Analytical_methods" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">Analytical methods</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4d/Aachen_14-10-14_Lense_panel_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= Analytical Methods =<br />
To determine certain properties of proteins or contructed DNA fragments such as BioBricks, we have used different analytical methods. All used methods are listed below. <br />
== Agarose Gel Electrophoresis==<br />
The Agarose Gel Electrophoresis is used for separation of DNA or RNA fragments (e.g. after a PCR).<br />
<br />
# take 5&nbsp;µl of the PCR product<br />
# mix with 1&nbsp;µl loading dye<br />
# apply onto agarose gel together with a marker<br />
# run at 120&nbsp;mA for 40&nbsp;minutes for a full gel<br />
<br />
== Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) ==<br />
The SDS-PAGE was used to determine certain features of the cells' proteom such as the strength of expression of a desired protein.<br />
<br />
'''Cell Preparation'''<br />
* lysis of cell pellet in lysis buffer<br />
* centrifuge for 15&nbsp;min at 13.000 rpm<br />
* mix the supernatant with 2x lammli buffer with β-mercaptoethanol<br />
* denatured for 5&nbsp;min at 95°C<br />
* sample to the gel <br />
<br />
For some SDS-PAGEs, we used BioRad ready made gels.<br />
<br />
Self-made SDS gels were made as described below:<br />
<br />
'''1.5x Buffer'''<br />
* 1.5&nbsp;M Tris-Cl pH = 8.8<br />
* in 1&nbsp;L is 40&nbsp;ml 10% SDS<br />
<br />
'''Gels'''<br />
<center><br />
{| class="wikitable" style="text-align: right;"<br />
! <br />
!! style="border-left: 2px solid #404040;" colspan="3"|0.75&nbsp;mm 12% RUNNING Gel <br />
!! style="border-left: 2px solid #404040; background-color:#8ebae5;" colspan="3"|1&nbsp;mm 4% STACKING Gel<br />
|-<br />
| <br />
| style="border-left: 2px solid #404040;"| '''1x''' || '''2x''' || '''4x''' <br />
| style="border-left: 2px solid #404040;"| '''1x''' || '''2x''' || '''4x'''<br />
|-<br />
| '''H{{sub|2}}O''' <br />
| style="border-left: 2px solid #404040;"| 1.65&nbsp;ml || 3.3&nbsp;ml || 6.6&nbsp;ml <br />
| style="border-left: 2px solid #404040;"| 1.5&nbsp;ml || 3&nbsp;ml || 6&nbsp;ml<br />
|-<br />
| '''1.5x Gel Buffer''' <br />
| style="border-left: 2px solid #404040;"| 1.3&nbsp;ml || 2.6&nbsp;ml || 5.2&nbsp;ml <br />
| style="border-left: 2px solid #404040;"| 0.65&nbsp;ml || 1.3&nbsp;ml || 2.6&nbsp;ml<br />
|-<br />
| '''30% Acrylamide (37.5:1)''' <br />
| style="border-left: 2px solid #404040;"| 2&nbsp;ml || 4&nbsp;ml || 8&nbsp;ml<br />
| style="border-left: 2px solid #404040;"| 0.325&nbsp;ml || 0.65&nbsp;ml || 1.3&nbsp;ml<br />
|-<br />
| '''10% APS''' <br />
| style="border-left: 2px solid #404040;"| 50&nbsp;µl || 100&nbsp;µl || 200&nbsp;µl <br />
| style="border-left: 2px solid #404040;"| 25&nbsp;µl || 50&nbsp;µl || 100&nbsp;µl<br />
|-<br />
| '''TEMED''' <br />
| style="border-left: 2px solid #404040;"| 10&nbsp;µl || 20&nbsp;µl || 40&nbsp;µl <br />
| style="border-left: 2px solid #404040;"| 5&nbsp;µl || 10&nbsp;µl || 20&nbsp;µl<br />
|-<br />
|}<br />
</center><br />
<br />
'''Run Gel'''<br />
* apply the prepared samples together with a protein marker on the gel<br />
* run the gel for 10&nbsp;min at 60&nbsp;V and after that for ca. 60&nbsp;min at 120&nbsp;V<br />
<br />
== Bradford Assay ==<br />
This assay is used for the determination of the protein concentration in a sample. <br />
* mix the Bradford solution with ddH{{sub|2}}O in a ratio of 1:4<br />
* prepare about 10 solutions 1&nbsp;ml, each between 125–1,000&nbsp;μg/ml BSA for a standard curve<br />
* use pure Bradford solution as a blank<br />
* mix equal amounts of BSA and samples with unknown concentrations (1-3&nbsp;µl) with 1&nbsp;ml of 1x&nbsp;Bradford solution, vortex and incubate for 5&nbsp;min. at room temperature<br />
* measure the OD with a spectrophotometer at 595&nbsp;nm<br />
* build a standard curve within the linear range of the BSA data (concentration against OD) <br />
* derive the concentration of your samples from the calibration curve<br />
<br />
== Measurement of Fluorescence ==<br />
The measurement of fluorescence was performed using the Synergy Mx (BioTek) microplate reader and the Gen5 software.<br />
<br />
* volume of sample in each well: 100&nbsp;µl<br />
* measure GFP fluorescence at an excitation wavelength of 496&nbsp;±&nbsp;9&nbsp;nm and an emission wavelength at 516&nbsp;±&nbsp;9&nbsp;nm<br />
<br />
== Measurement of Optical Density ==<br />
Depending on the number of samples, two different devices were used for measurement of optical density, the Unico Spectrophotometer 1201 (Fisher Bioblock Scientific) and the Synergy Mx (BioTek) microplate reader.<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">2D Detection of<br/>IPTG & HSL</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/22/Aachen_14-10-14_button_chip_manufacturing_ipo.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/Culture_medium_and_conditions" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">Culture Media</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/10/Aachen_14-10-13_Yellow_Flask_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/Molecular_biological_methods" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">Molecular biological methods</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/75/Aachen_14-10-14_Eppi_with_green_cells_panel_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/Analytical_methods" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">Analytical methods</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4d/Aachen_14-10-14_Lense_panel_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Notebook/Protocols/Molecular_biological_methodsTeam:Aachen/Notebook/Protocols/Molecular biological methods2014-10-17T10:38:14Z<p>VeraA: </p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">2D Detection of<br/>IPTG & HSL</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/22/Aachen_14-10-14_button_chip_manufacturing_ipo.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/Culture_medium_and_conditions" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">Culture Media</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/10/Aachen_14-10-13_Yellow_Flask_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/Molecular_biological_methods" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">Molecular biological methods</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/75/Aachen_14-10-14_Eppi_with_green_cells_panel_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/Analytical_methods" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">Analytical methods</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4d/Aachen_14-10-14_Lense_panel_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= Molecular Biological Methods =<br />
We used different molecular biological methods in our project. All used methods are listed below. <br />
<br />
== Cloning ==<br />
=== Plasmid Preparation ===<br />
Plasmid preparation is a method for isolating plasmids from bacterial cell cultures. In this work the illustra™ plasmidPrep MIni Spin Kit (GE&nbsp;Healthcare) was used. After the cells are lysed, the lysate is applied to a mini column binding plasmid DNA to a silica membrane in the presence of chaotropic salts. Following a washing step, the DNA is eluted with bidest. water. Unless stated otherwise the plasmid preparation was performed following the manufacturer’s manual.<br />
<br />
=== DNA-Purification ===<br />
Some molecular biological methods require a purification of DNA after amplification or modification. In this work, the illustra™ GFX™ PCR DNA and Gel Band Purification Kit (GE&nbsp;Healthcare) was used. In the presence of chaotropic salts the nucleic acids are bound the glass fiber fleece in the Filter Tube while other substances are removed by the washing steps. Afterwards purified DNA fragments are be eluted with bidest. water. Unless stated otherwise the DNA purification was performed following the manufacturer’s manual.<br />
<br />
=== Restriction Digest ===<br />
Restriction endonucleases are used to cut double stranded DNA molecules at specific, usually<br />
palindromic base sequences. Unless stated otherwise the restriction digest was performed for 1&nbsp;h at 37°C. To prevent religation of digested plasmids the DNA was dephosphorylated by addition of<br />
alkaline phosphatase and another incubation for 30 min at 37°C.<br />
<br />
=== Ligation ===<br />
Ligation in the context of molecular biology is the enzymatic joining of previously restricted nucleic acid fragments by synthesis of new bonds with<br />
simultaneous breakdown of ATP. A linearized plasmid functions as a vector for DNA inserts and all fragments<br />
are connected via ligation resulting in a new circular plasmid carrying the insert DNA. A typical reaction setup consists of a ligase, ligase buffer and the DNA fragments while the molar ratio of vector to insert should approximately be 1:3. The mixture was filled up with nuclease free water. Unless stated otherwise the reaction is incubated for 60 min at room temperature and is then used for transformation.<br />
<br />
=== Gibson Assembly ===<br />
Gibson assembly is a technique that allows fast isothermal assembly of multiple DNA fragments, regardless of fragment length. These fragments only need to have overlapping ends of 15-30 bp which can be created via PCR. Unless stated otherwise the Gibson Assembly was perfomed using the Gibson Assembly Cloning Kit (NEB) according to the protocol published by [https://www.neb.com/protocols/2012/12/11/gibson-assembly-protocol-e5510 New England Biolabs]. To design the primers for the respective PCRs a webtool was used (http://nebuilder.neb.com/).<br />
<br />
# Set up the reaction according to the table below on ice (2-3 fragment assembly).<br />
# Incubate samples in a thermocycler at 50°C for 15 minutes when 2 or 3 fragments are being assembled or 60 minutes when 4-6 fragments are being assembled. Following incubation, store samples on ice or at –20°C for subsequent transformation.<br />
# Transform NEB 5-alpha Competent E. coli cells with 2 μl of the assembly reaction, following the transformation protocol.<br />
<br />
<center><br />
{| class="wikitable" style="text-align: right;"<br />
|-<br />
| '''Total Amount of Fragments''' || 0.02-0.5&nbsp;pmols<br />
|-<br />
| '''Gibson Assembly Master Mix (2X)''' || 10&nbsp;µl<br />
|-<br />
| '''Deionized H<sub>2</sub>O''' || 10-X&nbsp;µl<br />
|-<br />
| '''Total Volume''' || '''20&nbsp;µl'''<br />
|-<br />
|}<br />
</center><br />
<br />
== Transformation ==<br />
The induction of competence of bacterial cells as well as the uptake of exogenous genetic material by these cells from their surroundings was done by using two different methods: Heatshock transformation and electroporation. The respective methods are listed below:<br />
<br />
=== Heat Shock ===<br />
# thaw cells on ice<br />
# add 1&nbsp;µl of plasmid DNA<br />
# incubate on ice for 30 min<br />
# heat shock at 42°C for 60&nbsp;s<br />
# incubate on ice for 5&nbsp;min<br />
# add 200&nbsp;µl of SOC media<br />
# incubate at 37°C for 2&nbsp;h<br />
# plate 20&nbsp; and 200&nbsp;µl on plates supplemented with the appropiate antibiotic<br />
<br />
=== Electroporation ===<br />
# add 1&nbsp;μl plasmid to electrocompetent cells<br />
# put DNA/ cell suspension in electroporation cuvette<br />
# wipe dry the electroporator<br />
# use a small plastic pipette to place the cells<br />
# pulse: 2.5&nbsp;kV, 200-400&nbsp;Ω, 25&nbsp;μF (for ''E.coli'')<br />
# immediatly add 1&nbsp;ml LB and incubate for 2&nbsp;h at 37°C<br />
# plate 50&nbsp;μl on selective medium plate<br />
# centrifuge the rest (3000&nbsp;g, 20 min), discard supernatant, re-suspend the pellet in 50&nbsp;μl LB and plate it on selective medium plate<br />
<br />
== PCR ==<br />
We have used several different types of PCR throughout our project:<br />
<br />
* colony/check PCR<br />
* gradient PCR<br />
* SOE PCR<br />
* touchdown PCR<br />
* QuikChange(Ligation-During-Amplification)<br />
<br />
The scope of appplication as well as generell parameters are described below.<br />
<br />
=== Colony PCR /Check PCR ===<br />
''Does the cells contain the correct insert/plasmid and does the insert have the expected length?''<br />
<br />
'''With GoTaq Mast Mix'''<br />
* 12.5 µl GoTaq Master Mix<br />
* 1 µl primer_F<br />
* 1 µl primer_R<br />
* pick colony with tip and suspend in PCR tube<br />
* 9.5 µl ddH<sub>2</sub>O<br />
<br />
<center><br />
{| class="wikitable"<br />
! parameter !! duration !! temp [°C] !!<br />
|-<br />
| denature||5:00||95 ||<br />
|-<br />
| '''anneal'''||00:30||56 || rowspan="3" | 30 cycles<br />
|-<br />
| '''elongate'''||01:00 per kb||72<br />
|-<br />
| '''denature'''||00:30||95<br />
|-<br />
| elongate||05:00||72 || rowspan="2" |<br />
|-<br />
| store||forever||8<br />
|}<br />
</center><br />
<br />
=== Gradient PCR ===<br />
''Which are the optimal conditions for our primers to bind, the PCRs in generell?''<br />
<br />
=== Touchdown PCR ===<br />
''Avioding primer binding to non-specific sequences''<br />
<br />
=== SOE PCR ===<br />
''Method for side directed mutagenesis''<br />
<br />
=== QuikChange ===<br />
''Method for side directed mutagenesis''<br />
<br />
Conducted by Vera at the laboratories of the Schwaneberg Group. Supervision by Dr. rer. nat. Ljubica Vojcic.<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">2D Detection of<br/>IPTG & HSL</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/22/Aachen_14-10-14_button_chip_manufacturing_ipo.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/Culture_medium_and_conditions" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">Culture Media</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/10/Aachen_14-10-13_Yellow_Flask_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/Molecular_biological_methods" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">Molecular biological methods</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/75/Aachen_14-10-14_Eppi_with_green_cells_panel_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/Analytical_methods" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">Analytical methods</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4d/Aachen_14-10-14_Lense_panel_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Notebook/Protocols/Culture_medium_and_conditionsTeam:Aachen/Notebook/Protocols/Culture medium and conditions2014-10-17T10:36:29Z<p>VeraA: </p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">2D Detection of<br/>IPTG & HSL</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/22/Aachen_14-10-14_button_chip_manufacturing_ipo.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/Culture_medium_and_conditions" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">Culture Media</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/10/Aachen_14-10-13_Yellow_Flask_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/Molecular_biological_methods" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">Molecular biological methods</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/75/Aachen_14-10-14_Eppi_with_green_cells_panel_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/Analytical_methods" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">Analytical methods</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4d/Aachen_14-10-14_Lense_panel_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= Culture Media =<br />
In our project we used different kinds of media for cultivation, transformation and chip preparation. While complex media such as LB offered an easy way of cultivation, minimal media such as M9 or HM provide a low autofluorescence for fluorescence measurements. All used media are listed below.<br />
<br />
== Complex media ==<br />
=== Luria-Bertani Medium (LB)===<br />
# weight components<br />
#: '''5&nbsp;g/L NaCl'''<br />
#: '''10&nbsp;g/L tryptone'''<br />
#: '''5&nbsp;g/L yeast extract'''<br />
#: (15&nbsp;g/L agar for plates)<br />
# fill up to 1&nbsp;L with deionized water<br />
# '''mix well''' by shaking<br />
# autoclave<br />
## autoclaving tape, caps slightly unscrewed<br />
## base of the pot has to be covered with deionized water<br />
## close lid<br />
## heat '''level 3 until the pressure valve opens'''<br />
## reduce '''heat level to 1.5'''<br />
## set timer to '''20 minutes'''<br />
## turn heater off<br />
## '''wait until the pressure valve retracts''' (30-45 minutes)<br />
## open, close caps & shake<br />
# for plates, wait until you can touch the bottle ('''<60°C''', clean bench!)<br />
# add antibiotics (1&nbsp;µl/ml) and '''shake''' (gloves!)<br />
<br />
=== Terrific-Broth-Medium (TB) ===<br />
# components for 1&nbsp;:<br />
#: '''4&nbsp;ml/L glycerol'''<br />
#: '''12&nbsp;g/L tryptone'''<br />
#: '''24&nbsp;g/L yeast extract''' <br />
# fill up to 900&nbsp;ml with deionized water<br />
# '''mix well''' by shaking<br />
# autoclave<br />
# components 2:<br />
#: '''0.17&nbsp;M KH<sub>2</sub>PO<sub>4</sub>'''<br />
#: '''0.72&nbsp;M K<sub>2</sub>HPO<sub>4</sub>'''<br />
# dissolve in 100&nbsp;ml deionized water and sterilize it by passing it through a filter<br />
# after autoclaving and cooling down, add sterile phosphate solutions<br />
<br />
=== Nutrient Agar medium (NA) ===<br />
#Components for 1&nbsp;L<br />
#: '''Enzymatic Digest of Gelatin 5&nbsp;g'''<br />
#: '''Beef Extract 3&nbsp;g'''<br />
#: '''Agar 15&nbsp;g'''<br />
# Final pH: 6.8 ± 0.2 at 25°C<br />
# Suspend 23&nbsp;g of the medium in one liter of purified water.<br />
# Heat with frequent agitation and boil for one minute to completely dissolve the medium.<br />
# Autoclave at 121°C for 15&nbsp;min.<br />
<br />
== Minimal Media ==<br />
=== Hartmans Minimal Medium (HM) ===<br />
<br />
This mineral salts medium is based on (Hartmans et al., 1989).<br />
<br />
Three '''100x stock solutions''' are prepared according to the following recipe and stored at 4°C:<br />
<br />
* '''100x Buffer''',composed of 388&nbsp;g dipotassium phosphate, 212&nbsp;g monosodium phosphate dihydrate per Liter, adjusted to a pH of 7.0 and sterilized by autoclaving.<br />
* '''100x ammonium sulfate''' composed of 200&nbsp;g/l ammonium sulfate and sterilized by autoclaving.<br />
* '''100x MM salts'''<br />
# Add 1&nbsp;g EDTA to 25&nbsp;ml water.<br />
# Add drops of 10&nbsp;M sodium hydroxide until EDTA is completely dissolved.<br />
# Adjust pH back to 4.0 with concentrated hypochloric acid.<br />
# Fill up with water to 800&nbsp;ml and dissolve following components:<br />
## 10&nbsp;g magnesium chloride sexahydrate<br />
## 200&nbsp;mg zinc sulfate heptahydrate<br />
## 100&nbsp;mg calcium chloride dihydrate<br />
## 500&nbsp;mg iron(II) sulfate heptahydrate<br />
## 20&nbsp;mg sodium molybdate dihydrate<br />
## 20&nbsp;mg copper(II) sulfate quintahydrate<br />
## 40&nbsp;mg cobalt(II) chloride sexahydrate<br />
## 100&nbsp;mg manganese(II) chloride sexahydrate<br />
<br />
For 1x medium without carbon source, pool 10&nbsp;ml of each '''100x stock solution''' and fill up to 1000&nbsp;ml with sterile, deionized water and store at 4°C.<br />
<br />
=== M9 Minimal Medium (M9) ===<br />
<center><br />
{| class="wikitable centered"<br />
! '''Components for 1&nbsp;L''' !! '''Volume'''<br />
|-<br />
| bidest. water || style="text-align:right"| 778.667&nbsp;ml<br />
|-<br />
| 10x Salt solution || style="text-align:right"| 100&nbsp;ml <br />
|- <br />
| Magnesiumsulfatehaptahydrate (10&nbsp;mM) || style="text-align:right"| 100&nbsp;ml <br />
|- <br />
| Glucose 20% (w/v) || style="text-align:right"| 20&nbsp;ml<br />
|- <br />
| 1000x Trace elements || style="text-align:right"| 1&nbsp;ml <br />
|-<br />
| Thiamin (1&nbsp;mM) || style="text-align:right"| 0.333&nbsp;ml <br />
|}<br />
<br />
<br />
{| class="wikitable centered"<br />
| colspan="3"| '''10x Salt solution''' <br />
|-<br />
! '''Component''' !!''Final concentration''' !! '''Concentration in stock solution'''<br />
|-<br />
| BisTris || style="text-align:right"| 95&nbsp;mM || style="text-align:right"| 200,000&nbsp;mg/L<br />
|-<br />
| Ammmonium chloride || style="text-align:right"| 60&nbsp;mM || style="text-align:right"| 32,100&nbsp;mg/L <br />
|-<br />
| Sodium citrate || style="text-align:right"| 12.5&nbsp;mM || style="text-align:right"| 27,000&nbsp;mg/L<br />
|-<br />
| Monopotassium phosphate || style="text-align:right"| 3&nbsp;mM || style="text-align:right"| 4,170&nbsp;mg/L<br />
|-<br />
| Dipotassium phosphate || style="text-align:right"| 0.7&nbsp;mM || style="text-align:right"| 1,590&nbsp;mg/L <br />
|- <br />
|}<br />
<br />
{| class="wikitable centered"<br />
| colspan="3"| '''1000x Trace elements'''<br />
|-<br />
! '''Component'''!!'''Final concentration''' !!'''Concentration in stock solution'''<br />
|- <br />
| Iron(III) chloride || style="text-align:right"| 50&nbsp;mM || style="text-align:right"| 13,515&nbsp;mg/L <br />
|- <br />
| Calcium chloride || style="text-align:right"| 20&nbsp;mM || style="text-align:right"| 2,220&nbsp;mg/L <br />
|-<br />
| Manganese(II) chloride || style="text-align:right"| 10&nbsp;mM || style="text-align:right"| 1,258&nbsp;mg/L <br />
|- <br />
| Zinc sulfate || style="text-align:right"| 10&nbsp;mM || style="text-align:right"| 1,615&nbsp;mg/L <br />
|- <br />
| Cobalt(II) chloride || style="text-align:right"| 2&nbsp;mM || style="text-align:right"| 260&nbsp;mg/L <br />
|- <br />
| Copper(II) chloride || style="text-align:right"| 2&nbsp;mM || style="text-align:right"| 269&nbsp;mg/L <br />
|-<br />
| Nickel(II) chloride || style="text-align:right"| 2&nbsp;mM || style="text-align:right"| 259&nbsp;mg/L <br />
|- <br />
| Sodium molybdate || style="text-align:right"| 2&nbsp;mM || style="text-align:right"| 412&nbsp;mg/L <br />
|-<br />
| Sodium selenite || style="text-align:right"| 2&nbsp;mM || style="text-align:right"| 346&nbsp;mg/L <br />
|-<br />
| Boric acid || style="text-align:right"| 2&nbsp;mM || style="text-align:right"| 124&nbsp;mg/L <br />
|-<br />
| Hydrochloric acid || style="text-align:right"| 1&nbsp;mM || style="text-align:right"| 20&nbsp;ml <br />
|-<br />
|}<br />
</center><br />
<br />
== Transformation Medium ==<br />
=== Super Optimal broth with Catabolite repression medium (SOC) ===<br />
# components<br />
#: '''0,5% yeast extract'''<br />
#: '''2% tryptone'''<br />
#: '''10&nbsp;mM NaCl'''<br />
#: '''2.5&nbsp;mM KCl'''<br />
#: '''20&nbsp;mM MgSO<sub>4</sub> '''<br />
# fill up with deionized water<br />
# adjust to pH 7.5 with NaOH<br />
# after autoclaving, add 20&nbsp;mM sterile glucose solution (filter sterilization)<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">2D Detection of<br/>IPTG & HSL</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/22/Aachen_14-10-14_button_chip_manufacturing_ipo.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/Culture_medium_and_conditions" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">Culture Media</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/10/Aachen_14-10-13_Yellow_Flask_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/Molecular_biological_methods" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">Molecular biological methods</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/75/Aachen_14-10-14_Eppi_with_green_cells_panel_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/Analytical_methods" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">Analytical methods</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4d/Aachen_14-10-14_Lense_panel_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Notebook/Protocols/detectionTeam:Aachen/Notebook/Protocols/detection2014-10-17T10:34:36Z<p>VeraA: </p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">2D Detection of<br/>IPTG & HSL</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/22/Aachen_14-10-14_button_chip_manufacturing_ipo.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/Culture_medium_and_conditions" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">Culture Media</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/10/Aachen_14-10-13_Yellow_Flask_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/Molecular_biological_methods" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">Molecular biological methods</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/75/Aachen_14-10-14_Eppi_with_green_cells_panel_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/Analytical_methods" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">Analytical methods</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4d/Aachen_14-10-14_Lense_panel_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= 2D Detection of IPTG and HSL =<br />
<br />
The method of the chip production was developed by this year's iGEM Team Aachen with [https://2014.igem.org/User:Aschechtel Anna] as driving force and person in charge. A lot of parameters were tested and the final protocol for the production of the sensor chips the way there were used for detection in the project is published below.<br />
<br />
== Chip Production ==<br />
<br />
'''Cell Preparation'''<br />
<br />
# over night culture of sensor cells (50&nbsp;ml in a 250&nbsp;ml flask with) max. 16&nbsp;h<br />
# centrifuge all 50&nbsp;ml by 3000&nbsp;g for 10&nbsp;min at RT (21°C).<br />
# discard the supernatant<br />
# re-suspend the pellet in 1&nbsp;mL tempered (~21°C) LB-medium.<br />
<br />
<br />
'''Agar Preparation'''<br />
<br />
# autoclave 50&nbsp;ml medium with 1.5%(w/v) agarose (has to be multiplied with the number of chips prepared).<br />
# cool it down to 45°C in a water bath.<br />
<br />
<br />
'''Chip Preparation'''<br />
<br />
# mix the cooled medium with the cells by inverting gently.<br />
# pour it in the chip mold, avoiding bubble formation (!).<br />
# wait for approximately 20 min until the agar has solidified.<br />
# cut out the chips with a scalpel.<br />
# put two chips into a labeled petri dish and store additional 4 chips in labeled petri dishs in the refrigerator.<br />
# incubate two chips for 1&nbsp;h at 37°C prior to induction.<br />
<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen 14-10-09 flowsheet chip manufacturingV8 ipo.png|title=Sensor-chip manufacturing|subtitle=Scheme illustrating the work flow during chip production. For the production steps see above.|width=1000px}}<br />
</center><br />
<br />
== Measurement of Fluorescence ==<br />
<br />
For measurement of a fluorescence response in our sensor chips we used three different methods.<br />
<br />
'''First''', the '''Gel Doc™ XR+''' (BIO-RAD) was used, exciting with UV light for an exposure time of 1&nbsp;s.<br />
<br />
'''Second''', we used our own device [https://2014.igem.org/Team:Aachen/Project/Measurement_Device '''WatsOn'''] with blue light for excitation (450 or 480&nbsp;nm) and special filters infront of the camera for selecting the appropriate emission spectrum. You can read even more about building your own WatsOn [https://2014.igem.org/Team:Aachen/Notebook/Engineering/WatsOn here].<br />
<br />
'''Third''', we used the '''Synergy Mx microplate reader''' (BioTek), putting the sensor chips into the lid of a common clear well plate. GFP was measured with an excitation of 496&nbsp;±&nbsp;9&nbsp;nm and an emission of 516&nbsp;±&nbsp;9&nbsp;nm and iLOV with an excitation of 450&nbsp;±&nbsp;9&nbsp;nm and emission of 495&nbsp;±&nbsp;9&nbsp;nm.<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">2D Detection of<br/>IPTG & HSL</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/22/Aachen_14-10-14_button_chip_manufacturing_ipo.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/Culture_medium_and_conditions" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">Culture Media</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/10/Aachen_14-10-13_Yellow_Flask_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/Molecular_biological_methods" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">Molecular biological methods</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/75/Aachen_14-10-14_Eppi_with_green_cells_panel_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/Analytical_methods" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">Analytical methods</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4d/Aachen_14-10-14_Lense_panel_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/OctoberTeam:Aachen/Notebook/Wetlab/October2014-10-17T10:32:27Z<p>VeraA: </p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= October =<br />
== 1st ==<br />
* Prepartations for sensor-chip production the following day (2014-10-02) was done accoringly to the [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]:<br />
** At 18:30 we prepared over-night cultures from K1319042, B0015 and K131026 by inoculating 250&nbsp;ml Erlenmeyer flasks each containing 50&nbsp;ml LB medium . The flasks were incubated for ~12 hours at 37°C on a shaker.<br />
<br />
== 2nd ==<br />
<br />
* At 8:30, we did a plasmid prep of dublicate samples of K1319011 clone #1 and #6. We measured the DNA yield, and the higher concentrated sample of clone #1 and #6, respectively, were sent in for sequencing.<br />
* made precultures and a master plate of 6 colonies of K3139008 in psB1C3 in NEB10β cells that had been plated at 5:30 this morning.<br />
<br />
* Production of sensor-chips was done accordingly to [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]. Briefly:<br />
** At 10:00 we prepared 150&nbsp;ml 1.5%&nbsp;(w/v) LB+agarose solution. The LB+agarose solution was autoclaved and subsequently tempered to 45°C. Precultures (50&nbsp;ml each) of K1319042, B0015 and K131026 were spun down at 3000&nbsp;g for 10&nbsp;min at 21°C and re-suspended in 1&nbsp;ml pretempered (21°C) LB medium. The re-suspended cultures were mixed with 50&nbsp;ml LB+agarose and poured onto three sensor-chip-templates (one template per culture). Sensor chips were cut out from the template and incubated at 37°C for 1&nbsp;h.<br />
** K1319042 and B0015 were induced with 0.2&nbsp;µl IPTG (100&nbsp;mM) subsequently to incubation and K131026 was induced with 0.2&nbsp;µl homoserinlacton stock solution (500&nbsp;µg/ml) 30 minutes after induction of the K1319042 and B0015. The induced sensor-chips were read out every 30 minutes for 180 minutes in total. An additional readout was conducted 285 minutes post induction. The readout was done at 450&nbsp;nm and 480&nbsp;nm wavelength. <br />
<center><br />
{{Team:Aachen/Figure|Aachen_02_10_2014_B0015_serie.png|title=Sensor Chips with B0015 in NEB in LB (480&nbsp;nm): first try with final device|subtitle=Sensor chips with B0015 in NEB in LB medium with 1,5% agarose, right chip induced. A) befor induction with 0.2&nbsp;µl of 100&nbsp;mM IPTG B) 0.5&nbsp;h after induction C) 1&nbsp;h after induction D) 1.5&nbsp;h after induction E) 2&nbsp;h after induction F) 2.5&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
* Gibson assembly of K1319008<br />
** template Backbone: I746909, Insert: K1319004<br />
** transformation in ''E.coli'' NEB10β and BL21<br />
<br />
* PCRs for Gibson assembly of K1319010 and K1319015<br />
** template Backbone: I20260 for K1319010 and K1319015<br />
** template Insert: K1319000 for K1319010 and K1319015 (but different primer)<br />
<br />
* made precultures of K1319013 and K1319014 in pSB3K3<br />
<br />
* K1319011 in pSB1C3 prepped for sequencing<br />
<br />
* Gibson assembly of K1319017 (PCRs, Gibson assembly, restriction with DnpI, transformation into NEB10β)<br />
** template Backbone: B0015<br />
** template Insert 1: LasI synthesized gene<br />
** template Insert 2: K660004<br />
<br />
==3rd==<br />
<br />
* made master plates of K1319008 in NEB10β and BL21 and precultures<br />
<br />
* check PCR for K1319008 to validate the Gibson assembly check for potential I746909 residues<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-10-03_K1319008_insert_colonyPCR.png|title=Check PCR K1319008|subtitle=K1319008 was checked with the Primers K1319008_Check_R and I746909_Check_R (both with G00100 Alternative as froward primer) for presence of K1319008 or I746909. All tested clones were positive for K1319008 and negative for I746909.|width=800px}}<br />
</center><br />
<br />
* did a plasmid prep and made cryo stocks of K1319008 in NEB (clones #1, #2, #3) and BL21 (clones #1, #2)<br />
<br />
* plasmid prep of K1319013 and K1319014 in pSB3K3<br />
<br />
* Gibson assembly for K1319010 and transformation into NEB10β<br />
<br />
* made cryo stocks of K1319011 clone #6<br />
<br />
* restriction of K1319012, k1319013 and K1319014 with EcoRI and PstI. Restriction of linearized plasmid backbone pSB1C3 with EcoRI and PstI. Ligation of K1319012, K1319013 and K1319014 into pSB1C3. Transformation into NEB10β. <br />
<br />
* Gibson assembly of K1319015 and transformation into NEB10β<br />
<br />
* colony PCR of K1319017<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-10-03_colony_PCR_K1319017.png|title=colony PCR K1319017|subtitle=K1319017 was checked with a colony PCR for the right insert length. Clones #2 and #4 were correct and used forthwith.|width=800px}}<br />
</center><br />
<br />
* did plasmid prep and cryo of clones #2 and #4 of K1319017<br />
<br />
* new plasmid backbone of pSB1C3 was made using the [http://parts.igem.org/Help:Protocols/Linearized_Plasmid_Backbones|standard protocol].<br />
<br />
* transformation of K1319008 clone #1 (from BL21) and K1319013 into BL21 (two plasmids in one cell).<br />
<br />
* transformation of K1319008 clone #1 (from BL21) and k1319014 into BL21 (two plasmids in one cell).<br />
<br />
* OD measurements of three biological triplicates from ''E. coli'' BW21 113, ''P. putida'' and ''S. cerevisiae''. Measurement as an analytic triplicate in the spectrophotometer (absorbance and transmission) and our own OD/F device.<br />
<br />
* Gibson assembly of K1319021 <br />
** template Backbone: K1319008<br />
** template Insert: LasI gene synthesis<br />
<br />
* At 19:00 we measured OD (our OD-device), absorption (spectrophotometer) and transmission (spectrophotometer) for 19 diltuions in the range of 2.5-100% from yeast (''Saccharomyces cerevisiae'') and ''P. putida'' liquid cultures. Measurements were conducted in biological as well as technical triplicates. Aim of this experiment was the comparison of our OD-device to commonly used devices in terms of OD determination.<br />
<br />
* Prepartations for sensor-chip production the following day (2014-10-04) were done accordingly to the [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]: <br />
** At 22:00 we prepared over-night cultures from B0015, K1319017 and K131026 by inoculating 250&nbsp;mL Erlenmeyer flasks each containing 50&nbsp;mL LB medium for sensor-chip manufacturing the next day. The flasks were incubated for ~12 hours at 37°C on a shaker.<br />
<br />
* Our BioBrick K1319021 enables expression of the TEV protease inducible by the autoinducers of ''Pseumomonas aeruginosa''. In order to construct this BioBrick, a Gibson assembly of K1319008 (IPTG-inducible expression of TEV protease) and the synthezised composite HSL-promotor J23101.B0032.C0079.B0015.J64010.B0034 activated by the respective autoinducers (HomoSerineLactones) was perfomed. Prior to this, we used two PCRs to linearize pSB1C3-K1319008, serving as backbone for Gibson assembly, and cutting out J23101.B0032.C0079.B0015.J64010.B0034 as well as adding adequate overlapping sequences.<br />
<br />
<center><br />
{| class="wikitable"<br />
| <div style="text-align: center;">'''PCRs'''</div> || colspan="2" | <div style="text-align: center;">'''K1319008'''</div> || colspan="2"| <div style="text-align: center;">'''HSL-Promotor'''</div> ||<br />
|-<br />
! step !! time [mm:ss] !! temperature [°C] !! time [mm:ss] !! temperature [°C] !! <br />
|-<br />
| Initial denaturation || 05:00 || 98 || 05:00 || 98 ||<br />
|-<br />
| Denaturation || 00:30 || 98 || 00:30 || 98 || rowspan="3" | '''30 cycles'''<br />
|-<br />
| Annealing || 00:30 || 55 || 00:30 || 51 <br />
|-<br />
| Elongation || 01:35 || 72 || 00:37 || 72<br />
|-<br />
| Final elongation || 05:00 || 72 || 05:00 || 72 ||<br />
|}<br />
</center><br />
<br />
==4th ==<br />
<br />
* colony PCR of K1319015 and Check PCR of K1319010<br />
** K1319010: clone #1 was positive<br />
** K1319015: in all clones the inserts were too short. <br />
<br />
* new digestion of Gibson master mix of K1319015 with DnpI<br />
<br />
* transformation of new Gibson master mix into NEB 10β<br />
<br />
* restriction of K1319010, K1319012, K1319013 and K1319014 (all in pSB3K3) with EcoRI and PstI, cutting of pSB1C3 with EcoRI and PstI, and then ligation.<br />
<br />
* made master plates and precultures of the transformations of K1319008 in BL21, K1319013 + K1319008 in BL21 and K1319014 + K1319008 in BL21<br />
<br />
* colony PCR of the master plates with the double plasmid constructs K1319013 + K1319008 and K1319014 + K1319008<br />
<br />
* sent the first BioBricks to the iGEM headquarters:<br />
** K1319000: RFC25 version of E0030<br />
** K1319001: REACh1 (Quencher)<br />
** K1319002: REACh2 (Quencher)<br />
** K1319003: Galectin 3<br />
** K1319004: TEV protease<br />
** K1319008: IPTG inducible expression of TEV protease<br />
** K1319011: J23101.B0032.K1319001.B0015<br />
** K1319017: HSL inducible expression of iLOV<br />
** K1319020: B0034.K1319009.B0015 in pSBX1A3<br />
** K1319042: IPTG inducible expression of iLOV<br />
<br />
* shake flask experiments with K1319008 (clone #1), K1319013 + K1319008 (clone #2) and K1319014 + K1319008 (clone #2) in LB (2 flasks each); inoculation with 50&nbsp;µL preculture and inducing with iPTG at OD of 1.5.<br />
<br />
* Production of sensor-chips was done accordingly to the [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]: <br />
** At 13:30 we prepared sensor chips from pre-cultures of B0015, K1319017 and K131026.<br />
** Subsequently to 1&nbsp;h icubation at 37°C B0015, K1319017 and K131026 were induced with 0.2&nbsp;µL homoserinlacton stock solution (500&nbsp;µg/ml). The induced sensor-chips were read out every 30 minutes for 240 minutes in total. Readout was conducted at 450&nbsp;nm and 480&nbsp;nm wavelength. An additional readout was conducted after 12 hours.<br />
<br />
* At 17:00 we prepared 4 liquid cultures from the K1319010_pSB3K3 master plate (clone#1) in 5&nbsp;mL LB-medium, each. The liquid cultures were prepared in order to create cryo stocks from K1319010-pSB3K3. Kanamycin was added to the liquid cultures as antibiotic at an concentration of 1&nbsp;µL/mL.<br />
<br />
* At 18:00 we prepared a master plate (LB+C) and corresonding liquid cultures from 6 clones of ''E.coli'' NEB10B k1319021-psB1C3. Liquid cultures and master plate were incubated at 37°C.<br />
<br />
* At 23:30 we prepared liquid cultures from K1319015-pSB3K3 clones #7, #8 and #9 in 5&nbsp;mL LB-medium. Kanamycin was used as antibiotic and the cultures were incubated at 37°C. Purpose of the cultures was cryo stock preparation and plasmid prep.<br />
<br />
==5th ==<br />
<br />
* At 11:45 we prepared cryo stocks from NEB K1319010-pSB3k3 #1, K1319015-pSB3K3 #7, K1319015-pSB3K3 #8 and K1319015-pSB3K3 #9 by mixing 750&nbsp;µl lquid culture with 750&nbsp;µl 50%&nbsp;(v/v) Glycerol-solution in 2&nbsp;ml eppis.<br />
**Plasmid prep was also done for the cultures mentioned above.<br />
<br />
* At 12:00 we prepared liquid cultures from K139010-pSB3K3, K139011-pSB3K3, K139012-pSB3K3, K139013-pSB3K3, K139014-pSB3K3, K139015-pSB3K3 in 5&nbsp;ml LB-medium each. Kanamycin was used as antibiotic. Purpose for the cultures was the characterization of constituitive expression and an additional plasmid prep of K139013-pSB3K3 and K139014-pSB3K3.<br />
<br />
* Production of sensor-chips was done accordingly to the [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]:<br />
** At 13:00 we prepared sensor chips from shake flask pre-cultures of BL21 pSB1C3-K1319008+pSB3K3-K1319014, BL21 pSB1C3-K1319008+pSB3K3-K1319013 and NEB pSB1C3-B0015.<br />
**Subsequently to 1&nbsp;h incubation at 37°C, BL21 pSB1C3-K131900+pSB3K3-K1319014, BL21 pSB1C3-K1319008+pSB3K3-K1319013 and NEB pSB1C3-B0015 were induced with 0.2&nbsp;µL IPTG. The induced sensor-chips were read out every 30&nbsp;minutes for 360&nbsp;minutes in total. K1319013 was induced earlier and thus measurements were taken for 450&nbsp;min in total. Readout was conducted at 480&nbsp;nm wavelength. An additional readout was conducted next day at 11:00.<br />
<br />
* At 15:30 we prepared liquid cultures for the characterization of ITPG inducible expression:<br />
** I746909 in pSB1C3<br />
** I20260 in pSB3K3<br />
** K731520 in pSB1C3<br />
** K1319008 in pSB1C3<br />
** K1319013 in pSB3K3<br />
** K1319014 in pSB3K3<br />
** B0015 in pSB1C3<br />
** K1319013 in pSB3K3 + K1319008 in pSB1C3<br />
** B0015 in pSB1C3<br />
** K1319014 in pSB3K3 + K1319008 in pSB1C3<br />
<br />
* prepared a colony PCR from K1319014-pSB1C3 clones #3, #4, #5 and#6. H20 and K1319014-pSB3K3 were used as controls.<br />
<br />
* At 22:20 we prepared 1&nbsp;L LB+C plates (2.5&nbsp;g NaCl, 10&nbsp;g Agar, 2.5&nbsp;g yeast extract and 5&nbsp;g Trypton). N-Z-amine (peptone from casein) was used instead of tryptone, because the tryptone stock was depleted.<br />
<br />
* prepped multiple cultures K1319013 in pSB3K3 and K1319014 in pSB3K3. Now we have sufficient amount of both plasmids.<br />
<br />
* Plates were made for the following constructs:<br />
<br />
<center><br />
{| class="wikitable"<br />
! part in vector !! strain !! resistance<br />
|-<br />
| K1319008 in pSB1C3 || BL21(DE3) || C<br />
|-<br />
| K1319010 in pSB3K3 || NEB10β || K<br />
|-<br />
| K1319011 in pSB3K3 || NEB10β || K<br />
|-<br />
| K1319012 in pSB3K3 || NEB10β || K<br />
|-<br />
| K1319013 in pSB3K3 || NEB10β || K<br />
|-<br />
| K1319014 in pSB3K3 || NEB10β || K<br />
|-<br />
| K1319015 in pSB3K3 || NEB10β || K<br />
|-<br />
| K1319017 in pSB1C3 || NEB10β || C<br />
|-<br />
| K1319042 in pSB1C3 || BL21(DE3) || C<br />
|-<br />
| K1319008 in pSB1C3 + K1319013 in pSB3K3 || BL21(DE3) || C+K<br />
|-<br />
| K1319008 in pSB1C3 + K1319014 in pSB3K3 || BL21(DE3) || C+K<br />
|-<br />
| I746909 in pSB1C3 || BL21(DE3) || C<br />
|-<br />
| K731520 in pSB1C3 || DH5α || C<br />
|-<br />
| I20260 in pSB3K3 || NEB10β || K<br />
|-<br />
| B0015 in pSB1C3 || NEB10β || C<br />
|}<br />
</center><br />
<br />
* To determine whether the conducted Gibson assembly of K1319021 and subsequent transformation into ''E. coli'' NEB 10β were successful, a colony PCR on these cells was performed. Primers binding to each of the templates used for Gibson assembly were used: LasI_Insert_F binding in J23101.B0032.C0079.B0015.J64010.B0034 and K1319004_Check_R binding in pSB1C3-K1319008. Bands at 1341&nbsp;bp would indicate the successful construction and transformation of K1319021. <br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-10-05_Check_PCR_on_K1319021.png|title=Check PCR on K1319021|subtitle=(Homoserinlactone-inducible expression of the TEV protease)|width=800px}}<br />
</center><br />
<br />
Since Bands >2000&nbsp;bp were observed, another PCR was performed by using primers binding upstream and downstream of the insert in pSB1C3: G00100_alternative and G00101_alternative. Here, bands with a length of 2210&nbsp;bp would verify the correct length of K1319021.<br />
<br />
==6th ==<br />
<br />
* made a SDS page of K1319010-15 and J23101.E0240<br />
<br />
* made a master plate at 15:30 containing two clones of K1319015 plate from yesterday.<br />
<br />
* At 22:00 we inocculated two 500&nbsp;ml flasks containing 50 ml&nbsp;LB-medium with 1&nbsp;ml pre-culture of K1319017, which had been prepared from a master-plate earlier this day. Chloramphinicol was used as antibiotic. The flasks were incubated at 37°C. One culture (50&nbsp;ml) was induced with 25&nbsp;µg homoserinlacton after an OD of 0.6 was reached and the induced culture as well as the control were used for fluorescence characterization. Fluorescene and OD were monitored once per hour. The OD of the induced culture stagnated at ~0.7 while the non induced culture grew further.<br />
<br />
== 7th ==<br />
<br />
* Two conducted colony PCRs confirmed that our double plasmid systems of K1319008 and K13190013/14 contain nothing but the desired BioBricks, which were used as positive controls. <br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-10-07_colonyPCR_on_characterization_constructs.png|title=colony PCR cells harboring the double plasmid system pSB3K3-K1319008 pSB1C3-K1319013/14|subtitle=(IPTG-inducible expression of the TEV protease and constitutive expression of our GFP-Quencher-Constructs)|width=800px}}<br />
</center><br />
<br />
*Characterisation of the biobrick K1319008 together with the biobricks K1319014 and K1319013.<br />
<br />
*Therefore the following biobricks were cultivated in biological triplicates:<br />
<br />
<center><br />
{|class="wikitable"<br />
!biobrick !! strain !! plasmid !! induced with iPTG<br />
|-<br />
|K1319008 || BL21 || pSB1C3 || no<br />
|-<br />
|K1319008 || BL21 || pSB1C3 || yes<br />
|-<br />
|K1319013 + K1319008 || BL21 || pSB3K3 + pSB1C3 || no<br />
|-<br />
|K1319013 + K1319008 || BL21 || pSB3K3 + pSB1C3 || yes<br />
|-<br />
|K1319014 + K1319008 || BL21 || pSB3K3 + pSB1C3 || no<br />
|-<br />
|K1319014 + K1319008 || BL21 || pSB3K3 + pSB1C3 || yes<br />
|-<br />
|K731520 || BL21 || pSB1C3 || no<br />
|- <br />
|K731520 || BL21 || pSB1C3 || yes<br />
|-<br />
|I746909 || BL21 || pSB1C3 || no<br />
|-<br />
|I746909 || BL21 || pSB1C3 || yes<br />
|-<br />
|B0015 || NEB 10 Beta || pSB1C3 || no<br />
|-<br />
|I20260 || BL21 || pSB3K3 || no<br />
|-<br />
|}<br />
</center><br />
<br />
* overnight culture of K1319013 + K1319008 # 1 and # 2, K1319014 + K1319008 # 1 and # 2 for chip production ([https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]).<br />
<br />
== 8th ==<br />
* We prepared sensor-chips with K1319013 + K1319008 # 1 and # 2, K1319014 + K1319008 # 1 and # 2 and B0015 accordingly to the [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]. Images were made every 30 min with our own device.<br />
* made precultures with K1319013 + K1319008 # 1 and # 2, K1319014 + K1319008 # 1 and # 2 and K731520. <br />
* cutting K1319013, K1319014 ans a pSB1A3 vector backbone with EcoRI and SpeI and K1319008 with XbaI and PstI<br />
* Ligation of K1319013/K1319014 with K1319008 and then ligation into pSB1A3<br />
*Transformation of the ligation product into BL21<br />
<br />
== 9th ==<br />
* SOC medium was added to the transformation before the heat shock had occurred by mistake.<br />
* At 02:00 the precultures for the characterization experiment were transferred to 250&nbsp;ml shake flasks (3&nbsp;ml culture + 10&nbsp;ml LB+antibiotics).<br />
* new transformation of the ligation product was conducted into BL21 and Dh5 alpha<br />
* At 23:00 a 500&nbsp;ml flask containing 50&nbsp;ml LB-medium was inocculated from a K131026 BL21 cryo stock for sensor-chip manufacturing the following day.<br />
<br />
== 10th ==<br />
* made master plates of the new transformation of the ligation product and overnight cultures<br />
* made chips with K131026 in BL21. Images were taken automaticly every 5 min with our own device<br />
<br />
* For sensor-chip manufacturing the following day, we inocculated 500&nbsp;ml flasks containing 50&nbsp;ml LB-medium with NEB10β K1319017.pSB1C3 clone #2 and with BL21 K1319042.pSB1C3 clone 2# accordingly to the [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]. Inoccultion was done at 21:35.<br />
*In preparation for an additional main charcterization experiment we inocculated 200 ml flasks or 300 ml flasks as available containing 25 ml LB-medium with seven of our own constructs listd below. Inoccuaation was done at 22:00.<br />
**K1319010<br />
**K1319011<br />
**B0015<br />
**I20260<br />
**K1319015<br />
**K1319014<br />
**K1319012<br />
**k1319013<br />
<br />
==11th==<br />
<br />
*At 21:00 we inocculted two 500 ml flasks containing 50 ml LB-medium with BL21 K1319042.pSB1C3 (from plate) and DH5α K1319026.pSB1C3 (from cryo), respectively. Chloramphenicol was used as antibiotik. Both cultures were required for chip manufacturing the next day ([https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]). The chips´ fluorescence was meant to be measured with a plate reader starting ~11:00 the next day. The chips were meant to be measured in parallel.<br />
<br />
*At 20:30 eight cultures listed below were plated out for additional characterization experiments on monday.<br />
**B0015 in pSB1C3<br />
**I20260 in pSB3K3<br />
**K731520 pSB1C3 #2<br />
**I746909 in pSB1C3<br />
**K1319042 i pSB1C3 #2<br />
**K1319008 in pSB1C3 #1<br />
**K1319008/13 in pSB1C3/3K3 #1<br />
**K1319008/14 in pSB1C3/3K3 #2<br />
<br />
==12th==<br />
<br />
*At 9:00 sensor-chips were prepared from precultures of BL21 K1319042.pSB1C3 and DH5α K1319026pSB1C.pSB1C3 accordingly to the [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]. The cultures were induced at ~11:00 and fluorescence was measured using a plate-reader. K1319026 was additionally measured in our device for its fluorescence.<br />
* Media with different antibiotics for the experiment for collaboration with Heidelberg were prepared. Also media for Robolektor were made.<br />
* Cultures of I13507 in seven vectors listed below were solued in 0,9% NaCl for the OD measurment. Then all cultures and an additional positive control were inoculated in 96-wellsplate with resulted OD of 0,648. The cultures were required for calibration of the plate-reader used for fluorescence measurement, which was part of the Heidelberg chracaterization project. Inocculation was done at ~19:15.<br />
**pSBX1A3<br />
**pSBX4A5<br />
**pSBX1C3<br />
**pSBX4C5<br />
**pSBX1K3<br />
**pSBX4K5<br />
**pSBX1T3<br />
<br />
*At 22:15 a 300 ml flask containing 30 ml LB-medium was inocculated with I746909.pSB1C3. The culture was required for calibration of the robolector (Jülich FHZ). Cloramphenicol was used as antibiotic.<br />
<br />
==13th==<br />
* overnight culture of K131026 in BL21 for chips<br />
<br />
==14th==<br />
* made chips of K131026 in BL21 in LB. Images were taken nearly every 5 or 2&nbsp;min with our own device. Chips were induced with 2&nbsp;µl of ''Pseudomonas aeruginosa'' liquid culture or 500&nbsp;µg/ml HSL<br />
* overnight cultures of K1319013&nbsp;+&nbsp;8 and K1319014&nbsp;+&nbsp;8 in BL21 for chips<br />
<br />
== 15th ==<br />
* made chips of K1319013&nbsp;+&nbsp;8 and K1319014&nbsp;+&nbsp;8 (BL21) in LB. Images were taken every 2&nbsp;min with our own device and every 4&nbsp;min in the plate reader. Chips were induced with 2&nbsp;µl of IPTG (100&nbsp;mM).<br />
* made overnight cultures of K1319013&nbsp;+&nbsp;8, K1319014&nbsp;+&nbsp;8, K731520 and I746909 for chips<br />
<br />
== 16th ==<br />
* made chips of K1319013&nbsp;+&nbsp;8, K1319014&nbsp;+&nbsp;8, K731520 and I746909 in LB. Images were taken every 2&nbsp;min with our own device from K731520 and I746909 and every 4&nbsp;min from all strains in the plate reader. Chips were induced with 2&nbsp;µl of IPTG (100&nbsp;mM).<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/SeptemberTeam:Aachen/Notebook/Wetlab/September2014-10-17T10:29:12Z<p>VeraA: </p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= September =<br />
== 1st ==<br />
* 5&nbsp;ml cultures of K1319003 and K1319004<br />
* plasmid prep<br />
<center><br />
{| class="wikitable"<br />
|-<br />
! Plasmid !! DNA [ng/µl] <br />
|-<br />
| J23101.K516032 pSB1K3|| 23.5<br />
|-<br />
| J23115.K516032 pSB1K3|| 20.5<br />
|-<br />
| J04450 pSB1A3|| 57.5<br />
|-<br />
| J04450 pSB1K1|| 63.5<br />
|} </center><br />
* over night cultures of K131026 in DH5α and NEB<br />
<br />
== 2nd ==<br />
* made chips with K131026 in DH5α and NEB. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_02_09_2014_K131026_dh5a_serie.png|title=Sensor Chips with K131026 in DH5α in LB taken with the second version of our own device|subtitle=Sensor chips with K131026 in DH5α in LB medium with 1,5% agarose, right chip induced. A) befor induction with 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 0.5&nbsp;h after induction C) 1&nbsp;h after induction D) 1.5&nbsp;h after induction E) 2.5&nbsp;h after induction F) 3&nbsp;h after induction|width=900px}}<br />
</center><br />
* gel purification of vector backbones <br />
* sent to sequencing:<br />
** K1318003<br />
** K1319004<br />
** J23101.K516032 <br />
** J23115.K516032<br />
<br />
== 3rd ==<br />
* prepared 50&nbsp;mL LB+antibiotic overnight-cultures of pSBX-vectors that were sent in by team Heidelberg.<br />
<br />
== 4th ==<br />
* In the morning, at 10:15, we inoculated the precultures for the interlab study experiment.<br />
* prepared cryo stocks of the pSBX-carrying ''E.&nbsp;coli'' from the overnight cultures. He also purified each pSBX-vector, eluting with 15+30&nbsp;µL water, and resulting in the following DNA concentrations:<br />
<br />
<center><br />
{| class="wikitable"<br />
! vector !! concentration [ng/µL]<br />
|-<br />
| pSBX1A3 || 111<br />
|-<br />
| pSBX4A5 || 14.1<br />
|-<br />
| pSBX1C3 || 31<br />
|-<br />
| pSB4C5 || 98.5<br />
|-<br />
| pSBX1K3 || 18<br />
|-<br />
| pSBX4K5 || 30<br />
|-<br />
| pSBX1T3 || 39<br />
|-<br />
| constitutive expression plasmid || 73<br />
|}<br />
</center><br />
<br />
* PCRs for Gibson assembly of K1319003 into pET17. Duplicates of 25&nbsp;µL reaction volume (12.5&nbsp;µL Q5 2x Master Mix, 1.25&nbsp;µL per primer, 2&nbsp;µL template)<br />
<center><br />
{| class="wikitable"<br />
! PCR tube # !! components<br />
|-<br />
| 1 and 2 || pET17 + pET17_Gal3_Gib_F + pET17_Gal3_Gib_R<br />
|-<br />
| 3 and 4 || K1319003 + K1319003_Gib_F + K1319003_Gib_R<br />
|-<br />
|}<br />
</center><br />
<br />
The PCR conditions:<br />
<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
|-<br />
| denature || 98 || 30", 98°C for 10", 55°C for 30", 72°C for 2'15"<br />
|-<br />
| denature || 98 || 10"<br />
|-<br />
| anneal || 50 (insert) 55 (backbone) || 30"<br />
|-<br />
| elongate || 72 || 0'30" (insert) 2'15" (backbone)<br />
|-<br />
| elongate || 72 || 2"<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
<br />
* Finally, we did the Gibson assembly and a heat shock transformation into NEB10β cells.<br />
<br />
* At 10:15, we inoculated the primary cultures of the interlab study experiment and began with regular fluorescence measurements.<br />
<br />
== 5th ==<br />
* made master plates of yesterday's transformed cells.<br />
<br />
== 6th ==<br />
* made precultures of 3 clones from each prepared master palte and inoculated precultures for OD/F measurements as well as chip production on the 7th.<br />
<br />
== 7th ==<br />
* made cryos stocks of the precultures<br />
* made chips with K131026 in DH5α and NEB and B0015 in NEB. Images were taken every 30 min with our own device <br />
<center><br />
{{Team:Aachen/Figure|Aachen_07_09_2014_B0015_neb_serie.png|title=Sensor Chips with B0015 in NEB (negativ control) in TB taken with the second version of our own device|subtitle=Sensor chips with B0015 in NEB in TB medium with 1,5% agar, right chip induced. A) befor induction with 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 0&nbsp;h after induction C) 0.5&nbsp;h after induction D) 1&nbsp;h after induction E) 2&nbsp;h after induction F) 2.5&nbsp;h after induction|width=900px}}<br />
</center><br />
* purification of the following plasmids:<br />
<br />
<center><br />
{| class="wikitable"<br />
! plasmid !! strain !! resistance !! vector !! # of clone picked !! concentration [ng/µl]<br />
|-<br />
|K1319000 in I20260 || NEB10ß || K || pSB3K3 || 1 ||<br />
|-<br />
|K1319000 in I20260 || NEB10ß || K || pSB3K3 || 3 ||<br />
|-<br />
|K1319000 in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319001 in I20260 || NEB10ß || K || pSB3K3 || 1 ||<br />
|-<br />
|K1319001 in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319001 in I20260 || NEB10ß || K || pSB3K3 || 6 ||<br />
|-<br />
|K1319002 in I20260 || NEB10ß || K || pSB3K3 || 1 ||<br />
|-<br />
|K1319002 in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319002 in I20260 || NEB10ß || K || pSB3K3 || 6 ||<br />
|-<br />
|K1319001_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 4 ||<br />
|-<br />
|K1319001_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319001_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 6 ||<br />
|-<br />
|K1319002_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 3 ||<br />
|-<br />
|K1319002_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 4 ||<br />
|-<br />
|K1319002_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|His-SNAP-YFP-K1319003 || NEB10ß || A || pET17 || 3 ||<br />
|-<br />
|His-SNAP-YFP-K1319003 || NEB10ß || A || pET17 || 4 ||<br />
|-<br />
|His-SNAP-YFP-K1319003 || NEB10ß || A || pET17 || 6 ||<br />
|}<br />
</center><br />
<br />
Elution was performed twice with 15&nbsp;µL of nuclease free water each time.<br />
<br />
== 9th ==<br />
* made chips with K131026 in DH5α and NEB and without cells. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_09_09_2014_K131026_neb_agarose_serie.png|title=Sensor Chips with K131026 in DH5α in LB|subtitle=Sensor chips with K131026 in DH5α in LB medium with 1,5% agarose, right chip induced. A) befor induction with 1&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 1&nbsp;h after induction C) 1.5&nbsp;h after induction D) 2&nbsp;h after induction E) 2.5&nbsp;h after induction F) 3&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
== 10th ==<br />
* SDS page of REACh constructs after Gibson <br />
* plasmid prep of Gal3 YFP<br />
** #3: 20&nbsp;ng/µl<br />
** #4: 21.5&nbsp;ng/µl<br />
** #6: 15.9&nbsp;ng/µl<br />
<br />
== 15th ==<br />
analyze the sequencing data from the clones of GFP_Reach 1, GFP_Reach 2 and K1319008. <br />
<br />
GFP_Reach 2 clone #3 and #5 were fine, including the Leu to Ile mutation.<br />
GFP_Reach 1 clone #4 and #5 were fine and did not contain the Leu to Ile mutation. Clone #6 was fine but contained the Leu to Ile mutation from the Reach 1 quick change mutations. <br />
<br />
For future experiments, we will use the GFP_Reach 1 clone #4 and the GFP_Reach 2 clone #4.<br />
<br />
Transformation of GFP_Reach 1 clone #3 and GFP_Reach 2 clones #3 and #5 were performed together with the TEV protease to create two plasmid construct. <br />
<br />
The GFP_Reach 1 and GFP_Reach 2 constructs were also restricted and ligated into the pSB1C3 vector from the pSB3K3 vector.<br />
* over night cultures of K131026 in DH5α and NEB<br />
<br />
== 16th ==<br />
<br />
* made master plates of the transformation from the day before. <br />
* Also PCRs were made from pSBXA3, I20260 and K131900 for a Gibson assembly. The PCRs were checked with a gel electrophoresis.<br />
* made chips with K131026 in DH5α and NEB. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_16_09_2014_K131026_neb_serie.png|title=Sensor Chips with K131026 in NEB in LB|subtitle=Sensor chips with K131026 in NEB in LB medium with 1,5% agarose, right chip induced. A) 0.5&nbsp;h after induction with 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 1&nbsp;h after induction C) 1.5&nbsp;h after induction D) 2&nbsp;h after induction E) 2.5&nbsp;h after induction F) 3&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
== 17th ==<br />
<br />
* prepped and autoclaved 33 500&nbsp;mL shake flasks.<br />
<br />
== 18th ==<br />
* SDS page of REACh constructs with TEV and IPTG<br />
* over night cultures of K131026, B0015, K1319013, K1319014, K1319013 + K1319008 and K1319014 + K1319008 all in BL21<br />
* tested ''Pseudomonas fluoresence'' if they are suitable for a growth experiment that is planned for our collaboration with the NEAnderLab next week. Therefore, she filled 2 500&nbsp;mL flasks with 30&nbsp;mL LB Pseudomonas-F medium, and inoculated each one with 1&nbsp;mL culture medium of the overnight preculture. Flasks were inoculated at 30°C at 250&nbsp;rpm. However, after 5 hours no exponential growth could be shown (s. plot below). Thus, it was decided to use a ''E. coli'' K12 derivate strain in TB medium instead, and 30&nbsp;mL of TB medium in a 500&nbsp;mL flask were inoculated with ''E. coli'' DH5alpha cells and incubated at 37°C at 300 rpm over night. According to the [https://www.dsmz.de/catalogues/catalogue-microorganisms/groups-of-organisms-and-their-applications/strains-for-schools-and-universities.html DSMZ] ''E . coli'' K12 strain derivates, such as DH5alpha, are adequate for the kind of school experiment we are planning with the NEAnderLab.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-09-19_NEAnderLab_Test_Growth_Curves_of_Pf_in_LB_iNB.png|title=Growth Curves|subtitle=Unfortunately, ''P. fluorescens'' did not show a nice exponential growth curve over the observed 5 hours.|width=1000px}}<br />
</center><br />
<br />
== 19th ==<br />
* made flask cultures of K1319013, K1319013 + K1319008, K1319013 + K1319008 + iPTG, K1319014, K1319014 + K1319008, K1319014 + K1319008 + iPTG, B0015 (negative control) and I20260 (positive control). iPTG was added at an OD of ~0.5. Inoculation was done via precultures in 500 ml shake flasks (50 ml filling volume). Media was always LB. Cultivation was done at 37°C and 300&nbsp;rpm. The starting OD was aimed to be 0.1. Inoculation occured directly from the precultures. Samples were taken every hour and checked for OD and fluorescence using a spectrophotometer and plate reader, respectively.<br />
<br />
* did plasmid preparation from the cultures of the day before (K1319013, K1319013 + K1319008, K1319013 + K1319008 + iPTG, K1319014, K1319014 + K1319008, K1319014 + K1319008 + iPTG, B0015 and I20260). The plasmid were then be cut with EcoRI and PstI, and the results were be put on an agarose gel in order to perform a restriction test. Also plasmids of K1319013 and K1319014 will be cut with EcoRi and SpeI. K1319008 will be cut with XbaI and PstI. These will then be ligated together and then ligated into a pSB1A3 vector via the 3A assembly (vector cut with EcoRI and PstI). These constructs will be transformed into BL21 (and NEB as a backup). The created construts will be known as K1319018 (K1319013.K1319008) and K1319019 (K1319014.K1319008).<br />
<br />
* made precultures of the master plates from the day before (K1319008, K1319013, K1319015 and pSBX1A3 with Gal3).<br />
<br />
* also inoculated 4 cultures for the further testing of the OD/F device (the F part). The cultures are 2 shake flasks of I20260 and 2 shake flasks of B0015. <br />
<br />
* Furthermore, did a growth experiment with DH5alpha for the NEAnderLab school experiment. 3 500&nbsp;mL shake flasks were filled with 50&nbsp;mL TB medium, and inoculated to an OD of 1.5 with the overnight preculture. Samples were taken every 30 minutes and tested for OD using our own device as well as the spectrophotometer. The resulting growth curve is shown below. we concluded that the growth was fast enough for these growth conditions to be used for the school experiment on the 24th. <br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-09-19_NEAnderLab_Test_Growth_Curves_in_TB_iNB.png|title=Growth Curves|subtitle=Growth under these conditions was sufficient for the school experiment to be carried in 5 hours. And our device did a good job measuring, too!|width=1000px}}<br />
</center><br />
<br />
* made chips with K1319013 + K1319008, K1319014 + K1319008, K1319013, K1319014, B0015 and K131026. Images were taken every 30 minutes with our own device.<br />
<br />
* tested our OD/F device with a dilution test. Samples were checked with the spectrophotometer (OD), our OD/F device (fluorescence) and platereader (fluorescence).<br />
<br />
* made two SDS gels. <br />
<br />
* inoculated a culture of K1319008, B0015 as well as I20260 to check whether the results from our construct are from a wrongly done Gibson assembly with a still functioning superfolded GFP (the TEV protease was inserted in a backbone that formely contained superfolded GFP.)<br />
<br />
== 20th ==<br />
* SDS page of REACh constructs with TEV protease and induced by IPTG<br />
<br />
== 22nd ==<br />
<br />
* we poured several Pseudomonas-F agar plates with 0, 150 and 300&nbsp;µg/L for the NEAnderLab school experiment. She also autoclaved 12 500&nbsp;mL shake flasks, partly to be used for the school collaboration on Wednesday.<br />
<br />
== 26th ==<br />
* We did a check PCR on several cryo cultures. All samples with G00100_Alternative+K1319004_check_R combinations resulted in a strong band at ~2300&nbsp;bp that we cannot explain. All G00100_Alternative+K1319004_check_R combinations resulted in a strong band at 900&nbsp;bp that we cannot explain either. We concluded that the annealing temperatures were wrong and favored unspecific products. Therefore, we decided to do a gradient PCR to find out the optimal annealing temperatures for our new primers.<br />
<br />
* Gradient PCR to test new primer:<br />
did gradient PCR with these new primers:<br />
<br />
<center><br />
{| class="wikitable"<br />
! name !! sequence<br />
|-<br />
| G00100_Alternative || GTGCCACCTGACGTCTAAGAAACCATTATTATC<br />
|-<br />
| G00101_Alternative || ATTACCGCCTTTGAGTGAGCTGATACCGCTCG<br />
|-<br />
| K1319004_check_R || ACGGAATTTCAGTTTCTGCGGGAACGGCGG<br />
|-<br />
| I746909_check_R || ATCTTTAGACAGAACGCTTTGCGTGCTCAG<br />
|}<br />
</center><br />
<br />
Three PCRs with different primer combinations were run. In all of them the templates were K1319004&nbsp;in pSB1C3, K1319008&nbsp;in&nbsp;pSB1C3 and I746909&nbsp;in&nbsp;pSB1C3.<br />
<br />
The first gradient PCR tested the G00100_Alternative + G00101_Alternative combination:<br />
<br />
<center><br />
{| class="wikitable"<br />
! primer_F !! primer_R !! template !! expected length !! best annealing temperature<br />
|-<br />
| G00100_Alternative || G00101_Alternative || K1319004&nbsp;in pSB1C3 || 1057 || ???<br />
|-<br />
| G00100_Alternative || G00101_Alternative || K1319008&nbsp;in&nbsp;pSB1C3 || 1245 || ???<br />
|-<br />
| G00100_Alternative || G00101_Alternative || I746909&nbsp;in&nbsp;pSB1C3 || 1221 || ???<br />
|-<br />
| G00100_Alternative || G00101_Alternative || water || --- || ???<br />
|}<br />
{{Team:Aachen/Figure|Aachen_14-09-26_gradientPCR_1.png|title=Gradient PCR 1|subtitle=the primers were G00100_Alternative and G00101_Alternative and they worked well at all temperatures from 55-65°C.|width=800px}}<br />
</center><br />
<br />
The second gradient PCR tested the G00100_Alternative + I746916_check_R combination:<br />
<center><br />
{| class="wikitable"<br />
! primer_F !! primer_R !! template !! expected length !! best annealing temperature<br />
|-<br />
| G00100_Alternative || I746916_check_R || K1319004&nbsp;in pSB1C3 || none || ???<br />
|-<br />
| G00100_Alternative || I746916_check_R || K1319008&nbsp;in&nbsp;pSB1C3 || none || ???<br />
|-<br />
| G00100_Alternative || I746916_check_R || I746909&nbsp;in&nbsp;pSB1C3 || 820 || ???<br />
|-<br />
| G00100_Alternative || I746916_check_R || water || --- || ???<br />
|}<br />
{{Team:Aachen/Figure|Aachen_14-09-26_gradientPCR_2.png|title=Gradient PCR 2|subtitle=the primers were G00100_Alternative and I746916_check_R and they worked well at all temperatures from 55-65°C. Apparently the K1319008 template contained I746916.|width=800px}}<br />
</center><br />
<br />
The third gradient PCR tested the G00100_Alternative + K1319004_check_R combination:<br />
<center><br />
{| class="wikitable"<br />
! primer_F !! primer_R !! template !! expected length !! best annealing temperature<br />
|-<br />
| G00100_Alternative || K1319004_check_R || K1319004&nbsp;in pSB1C3 || 541 || ???<br />
|-<br />
| G00100_Alternative || K1319004_check_R || K1319008&nbsp;in&nbsp;pSB1C3 || 502 || ???<br />
|-<br />
| G00100_Alternative || K1319004_check_R || I746909&nbsp;in&nbsp;pSB1C3 || none || ???<br />
|-<br />
| G00100_Alternative || K1319004_check_R || water || --- || ???<br />
|}<br />
{{Team:Aachen/Figure|Aachen_14-09-26_gradientPCR_3.png|title=Gradient PCR 3|subtitle=The primers were G00100_Alternative and K1319004_check_R and they worked well at all temperatures from 60-68°C. To our disappointment, the K1319008 template did not contain K1319004. It is unclear why the 5 bands of K1319008 and I746916 look different.|width=800px}}<br />
</center><br />
<br />
The results of these three PCRs are:<br />
# KAPA2G Fast ReadyMix worked well<br />
# all three primers work well at >65°C annealing temperature<br />
# K1319008 template contained I746916 instead of the intended K1319004 ORF<br />
<br />
It was concluded that a similar check PCR with 65°C annealing temperature will be done on all plasmids and cryos of K1319008.<br />
<br />
== 27th ==<br />
* First we transformed K1319001, K1319002, K1319003 and K1319004 (all in pSB1C3) into NEB10β cells. He tested the PCR machine for semi-automated heat-shocking by splitting the 50&nbsp;µL cells with the plasmid into 2x 25&nbsp;µL. All 100&nbsp;µL were plated for all construct/machine combinations.<br />
<br />
* transformed several constructs into chemically competent BL21(DE3) cells.<br />
<br />
* we did colony-PCR on all plasmids, cryos and colonies that should contain the K1319004 sequence.<br />
<br />
* we also made check a PCR on galectin-constructs:<br />
<center><br />
{| class="wikitable"<br />
! label !! primer_F !! primer_R !! expected length !! result<br />
|-<br />
| Gal3 in pSBX1A3 #1 || G00100_Alternative || K1319003_R || 1684 || ???<br />
|-<br />
| Gal3 in pSBX1A3 #2 || G00100_Alternative || K1319003_R || 1684 || ???<br />
|-<br />
| Gal3 in pSBX1A3 #3 || G00100_Alternative || K1319003_R || 1684 || ???<br />
|-<br />
| Gal3 YFP #3 || pETGal3_seq_F || K1319003_R || 867 || ???<br />
|-<br />
| Gal3 YFP #3 || pETGal3_seq_F || K1319003_R || 867 || ???<br />
|-<br />
| Gal3 YFP pet17 AmpR || pETGal3_seq_F || K1319003_R || 867 or none || ???<br />
|-<br />
| pET17 Gal3 #1 || pETGal3_seq_F || K1319003_R || none || ???<br />
|-<br />
| K1319003 in pSB1C3 || G00100_Alternative || K1319003_R || 930 || ???<br />
|}<br />
</center><br />
<br />
== 28th ==<br />
* made a restriction of BioBrick K1319020 and vector pSB1C3 with restriction enzymes EcoRI and PstI. Then we ligated the restricted parts and made a transformation using ''E. coli'' NEB 10ß cells.<br />
<br />
== 29th ==<br />
<br />
* made cryo cultures and plasmid preparation of K1319010, K1319011, K1319012, K1319021 and K1319042. We determined the contentration of plasmids and made did a restriction digest of K1319010, K1319011, K1319012, pSB1C3, K1319021, K1319013 and K1319014, followed by a ligation in K1319010.pSB1C3, K1319011.pSB1C3, K1319012.pSB1C3, K1319021.K1319013.pSB1A3 and K1319021.K1319013.pSB1A3. All constructs were transformed into ''E. coli'' NEB 10ß.<br />
<br />
* prepared 3 500&nbsp;mL flasks with 30&nbsp;mL LB medium which were inoculated with a ''Pseudomonas putida'' strain. The cells were cultured over night at 28°C and ~300&nbsp;rpm. The cultures are supposed to be used to test our OD device.<br />
<br />
== 30th ==<br />
<br />
* Sequencing samples were sent in for K1319020 clone #2, 3 & 5 (in pSB1C3), K1319017 clone #1 (in pSB1C3), K1319010 clone #2 (in pSB3K3), K1319011 clone #1 (in pSB3K3), K1319012 clone #2 (in pSB3K3), K1319013 clone #1 (in pSB1C3), K1319014 clone #1 (in pSB1C3), K1319001 (in pSB1C3) and K1319002 (in pSB1C3). <br />
<br />
* A plasmid prep of K1319013 and K1319014 was run.<br />
<br />
* A Gibson assembly with the K1319015 from the I20260 backbone and the K1319000 insert, forming K3139015, was conducted. The product was subsequently transformed into NEB10β cells. <br />
<br />
* The pSB1C3 plasmid backbones were amplified via PCR and purified.<br />
<br />
* Colony-PCRs of K1319008 and K1319012 master plates were made to confirm the colony's identity. Subsequently, pre-cultures were inoculated. <br />
<br />
* A transformation of K1319010 and K1319010 in pSB1C3 was conducted.<br />
<br />
* Another plasmid prep of K1319010 clone #2, K1319011 clone #1, K1319012 clone #2 (all in pSB3K3), K1319013 clone #4, K1319014 #3, K139020 #2, 3, 5 (all in pSB1C3) was run.<br />
<br />
* The OD device was tested with a dilution series of a ''Pseudomonas putida'' culture.<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/AugustTeam:Aachen/Notebook/Wetlab/August2014-10-17T10:25:22Z<p>VeraA: </p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= August =<br />
== 1st ==<br />
* made electrocompetent ''E.coli'' rosetta cells.<br />
* prepared cultures of K1319042 and K131026<br />
<br />
== 2nd ==<br />
* tested the OD measurement device and compared it to the spectrophotometer and the plate reader. <br />
* tested K131026 and K1319042 for fluorescence in the plate reader<br />
* did a heat shock transformation of I746909 into NEB TOP 10 cells<br />
* did an electroshock transformation of pET17-Gal3 into ''E.coli'' rosetta<br />
<br />
== 3rd ==<br />
* OD measurements of the iGEM device in comparison to the spectrophotometer were taken. <br />
* cryo cultures of K131026 and K1319042 were prepared<br />
* master plates of Gal3 #1-#10 and I746909 #1-#4 and overnight cultures<br />
<br />
== 4th ==<br />
* made cryo stocks of K1319042 and K131026 in NEB/BL21/DH5alpha, I746909 in BL21 and pET17-His-SNAP-YFP-Gal3 in ''E.&nbsp;coli'' rosetta (DE3), respectively.<br />
* made plasmid prep, most of them using 1.5&nbsp;mL culture medium, and eluted with 1x 50&nbsp;µL of ddH{{sub|2}}O. The resulting DNA concentrations are shown below.<br />
<br />
<center><br />
{| class="wikitable"<br />
! combination !! concentration [ng/µl]<br />
|-<br />
| I746909 BL21 #1 || 73.5<br />
|-<br />
| I746909 BL21 #2 || 45<br />
|-<br />
| I746909 BL21 #3 || 49<br />
|-<br />
| K1319042 DH5alpha || 60<br />
|-<br />
| K131026 DH5alpha || 150<br />
|-<br />
| pET17-Gal3 #1 || 30.5<br />
|-<br />
| pET17-Gal3 #2 || 6.4<br />
|-<br />
| pET17-Gal3 #3 || 6.3<br />
|-<br />
| pET17-Gal3 #4 || 9.4<br />
|-<br />
| pET17-Gal3 #5 || 10.1<br />
|-<br />
| pET17-Gal3 #6 || 8.2<br />
|-<br />
| pET17-Gal3 #7 || 13.8<br />
|-<br />
| pET17-Gal3 #8 || 6.9<br />
|-<br />
| pET17-Gal3 #9 || 10.2<br />
|}<br />
</center><br />
<br />
To confirm the quality of pET17-Gal3 transformations, the purified plasmids were tested by carrying out a digest. Results are shown in the below picture and table.<br />
<br />
<center><br />
{{Team:Aachen/Figure|14-08-04_Test-Digest.png|title=Test digest|subtitle=clones were test-digested|width=400px}}<br />
<br />
{| class="wikitable"<br />
! combination !! cut products[bp]<br />
|-<br />
| I746909 BL21 #1 || 2029, 947<br />
|-<br />
| K1319042 DH5alpha || 2029, 1780<br />
|-<br />
| K131026 DH5alpha || 2029, 1848<br />
|-<br />
| pET17-Gal3 #1 || 3086, 923, 1262<br />
|}<br />
</center><br />
<br />
All pET17-Gal3 clones were positive and clone #1 was selected for further experiments.<br />
* prepared an over night cultur of K1319042 for chips<br />
<br />
== 5th ==<br />
* assembly of a V{{sub|R}}=2.5&nbsp;L bioreactor for cultivation of a 1&nbsp;L expression culture.<br />
* Two precultures of 20&nbsp;mL LB+A were inoculated at 19:00<br />
* transformation of K746909 into BL21 cells and K1319000 into NEB10β cells.<br />
* made Chips with K1319042 in HM. Images were taken every 30 min with the Geldoc<br />
* made alliquots of HM, 1&nbsp;L HM + glucose + supplements and 500&nbsp;ml LB<br />
<br />
* The Quickchange mutagenesis PCR with a tamplate K1319000 and following primers was made. The PCR was made in two steps. The first step is PCR with both primers separatly and the second step includes PCR with two PCR products mixed with each other.<br />
** forward primer EYFPtoREACh1_F: AGTACAACTGGAACAGCCACAACGTCTATATC<br />
** rewerse primer EYFPtoREACh1_R: GTTGTGGCTGTTCCAGTTGTACTCCAGCTTG<br />
** forward primer EYFPtoREACh2_F: AGTACAACTGGAACAGCCGCAACGTCTATATCATG<br />
** rewerse primer EYFPtoREACh2_R: ATAGACGTTGCGGCTGTTCCAGTTGTACTCCAGCTTG<br />
<br />
'''1. Step''' with 3 cycles<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| anneal || 55 || 30"<br />
|-<br />
| elongate || 72 || 30"<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
'''2. Step''' with 14 cycles<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| anneal || 55 || 60"<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-07-5_PCR_toREACh1%262.png|title=Agarose gel with PCR products after Quichchange from K1319000 to K1319001 and K1319002 |width=400px}}<br />
</center><br />
<br />
* REACh1 gets number K1319001 and REACh2 gets number K1319002.<br />
<br />
* PCR product was restricted with DpnI 60&nbsp;min at 37°C to destroy the methylated template. Then DpnI was deaktevated at 80°C during 20&nbsp;min.<br />
* PCR product was purifired and transformated in DH5α.<br />
<br />
== 6th ==<br />
* transformation of J04450 in pSB1K3 and pSB1A3 in NEB10β cells.<br />
* They also did a plasmid prep of J04450 in pSB1C3 and Flo's vectors.<br />
* made precultures of NEB10βand DH5 alpha cells<br />
* inoculation of the fermenter at 11:40, and induced the fermentation of pET17-Gal3. The fermentation is expected to run 24&nbsp;h.<br />
* as the first Quickchange PCR for REACh2 was not sucsessful, it was reapeted as a gradient PCR with annealing temperatire 55°C, 57°C and 60°C. Then the agarose gel with PCR product samples was made.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-08-06_to_REACh2.png|title=Agarose gel with PCR products after Quickchange from K1319000 to K1319002 |width=400px}}<br />
</center><br />
<br />
== 7th ==<br />
* made media for ''Pseudomonas flourescens''<br />
** Nutrient Broth<br />
** Pseudomonas-F<br />
** Pseudomonas-P<br />
* made 2&nbsp;L LB<br />
<br />
== 8th ==<br />
* prepared 2x 60&nbsp;ml (LB + cam + IPTG) with K1319042<br />
* prepared 5&nbsp;ml K131026 and C0179<br />
* made SDS page<br />
<br />
== 9th ==<br />
* made a plate reader experiment with K131026 in LB and LB + HM<br />
<br />
== 11th ==<br />
* plated on LB + antibiotics<br />
** K131026<br />
** I746909<br />
** K13190042<br />
** I04450 in pSB1C3<br />
** I04450 in pSB1A3<br />
** I04450 in pSB1K3<br />
** pSEVA construct (pSEVA 641_FP pSEVA 234-LasR)<br />
<br />
== 13th ==<br />
* Agarose chips were prepared:<br />
** ''E. coli'' DH5α K131026 and I746909 in LB and HM<br />
** K1319042 and the pSEVA two plasmid construct in HM<br />
* Images were taken every 30 min with the Geldoc<br />
<br />
==15th ==<br />
* A bioreactor containing 1&nbsp;L Medium was inoculated with pET17-His-SNAP-YFP-Gal3.<br />
<br />
== 16th ==<br />
* The above mentioned Bioreactor was stopped after 20&nbsp;h and all cells were lysed.<br />
<br />
== 18th ==<br />
* Overnight cultures of I746909 and K131026 in LB, TB, 2x HM+ were made<br />
* 3x J23101.E0240 was plated<br />
* pET17-His-SNAP-YFP-Gal3 was purified with Äkta via a histidine-tagged protein purification.<br />
<br />
== 19th ==<br />
* Chips with K131026 and I746909 in HM were made. Images were taken every 30 min with the Geldoc<br />
* A PCR of J23101.E0240, K1319000, K1319001, K1319002 was run and the product was separated on a 1,2% agarose gel<br />
* A SDS gel with samples of protein purification of pET17-His-SNAP-YFP-Gal3 was made to check if the purifired samples contain the target protein - YFP-Gal3. The purification or the gel resulted in two samples with a yellow color. For the SDS we also used the two samples before and the two samples after ones with the yellow color, 6&nbsp;mL. <br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-08-18_Gal3_purification_iVA.png|title=YFP-Gal3 protein purification|subtitle=|width=400px}}<br />
</center><br />
<br />
* Two samples with YFP-Gal3 were concentrated till 1&nbsp;mL <br />
* The concentration of YFP-Gal3 was calculated on Tecan. Calculation showed concentration 13,42&nbsp;mg/ml<br />
<br />
== 20th ==<br />
* repeat PCR for REACh1 and J23101.E0240 and run a gel<br />
* plasmid prep of pSEVA BfsB, pSEVA lasR and I746909<br />
<br />
== 24th ==<br />
* made 2.5&nbsp;L LB<br />
* made chips of K131026 in NEB , DH5α and BL21 in LB and additionally K131026 in DH5α in HM+. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_24_08_2014_K131026_bl21_serie.png|title=Sensor Chips with K131026 in BL21 in LB taken with first prototyp of our own device|subtitle=Sensor chips with K131026 in BL21 in LB medium with 1,5% agar, lower chip induced. A) befor induction with 2&nbsp;µl of 5000&nbsp;µg/ml HSL (3-oxo-C12) B) 0.5&nbsp;h after induction C) 1&nbsp;h after induction D) 1.5&nbsp;h after induction E) 2&nbsp;h after induction F) 2.5&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
== 25th ==<br />
* did a plasmid restriction of I20260 (EcoRI,PstI), J23115 (EcoRI, SpeI), K516032 (XbaI,PstI), and J23101 (EcoRI, SpeI)<br />
* tested the growth of ''Pseudomonas fluorescens'' in different liquid media for high OD and strong fluorescence. She tested Standard I medium, Cetrimide medium and Pseudomonas-F medium, and Pseudomonas-F medium supplemented with 300&nbsp;µL Fe3+ in 500&nbsp;mL flasks with a filling volume of 30&nbsp;mL. The flasks were inoculated with ''P. fluorescens'' cells on Standard I agar, and incubated at 30°C at 250&nbsp;rpm.<br />
* prepared over night cultures of K131026 in DH5α and NEB for chips<br />
* prepared 2x 5&nbsp;ml of pSB1C3, psB3K3 and pSB1A2 for plasmid prep<br />
<br />
== 26th ==<br />
* ligation of J23115 and K516032 to J23115.K516032, and J23101 and K516032 to J23101.K516032, respectively.<br />
* plasmid prep of I20260, K516032 and B0034<br />
* restriction of plasmids I20260, K516032, B0034 with EcoRI and PstI<br />
* gel with restricted the I20260, K516032 and B0034 was run<br />
* purification of vector backbones pSB1A2, pSB3K3 and pSB1C3<br />
* restriciton of synthesized TEV protease with EcoRI and PstI<br />
* qualitatively tested the ''Pseudomonas fluorescens'' that had grown over night for OD and fluorescence. She determined that Pseudomonas-F medium is the most adequate for the cultivation of the strain we use, since both OD and fluorescence were best in the flask containing the respective medium. Growth in the Pseudomonas-F medium supplemented with 300&nbsp;µg/L Fe3+ was weaker, however, fluorescence was also successfully suppressed.<br />
* made chips with K131026 in DH5α and NEB, in LB and LB + 10% glycerol. Images were taken with our own device every 10 min (illumination problems).<br />
<center><br />
{{Team:Aachen/Figure|Aachen_26_08_2014_K131026_neb_serie.png|title=Sensor Chips with K131026 in NEB in LB taken with first prototyp of our own device|subtitle=Sensor chips with K131026 in NEB in LB medium with 1,5% agar. Chip on the top induced with 0.5&nbsp;µl of 500&nbsp;µg/ml HSL and on the bottom with less than 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12). A) befor induction B) 1&nbsp;h after induction C) 1.5&nbsp;h after induction D) 2&nbsp;h after induction |width=600px}}<br />
</center><br />
* plasmid prep of the back bones, restriction and gel purification<br />
<br />
== 27th ==<br />
* transformation of some BioBricks<br />
* ligation of J23101.K516032 into pSB3K3 and J23115.K516032 into pSB3K3 and K1319004 into pSB1C3<br />
* transformation of K1319004 into pUC and pSB1C3, and J04450 into pSB1K3 and pSB1A3, respectively<br />
<br />
== 28th ==<br />
* transformation of some BioBricks<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/JulyTeam:Aachen/Notebook/Wetlab/July2014-10-17T10:22:31Z<p>VeraA: </p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= July =<br />
== 1st ==<br />
* transformation efficiency kit is broken<br />
&rarr; run an agarose gel with the kit plasmids to check for nuclease activity/ bands<br />
* inventory of the -80°C freezer was done<br />
<br />
== 2nd ==<br />
* overnight cultures (LB) of K731520 and K1319042 for chips were inoculated<br />
<br />
== 3rd ==<br />
* ODs of the overnight culture of <br />
** K731520: 2.3 <br />
** K1319042: 2.5<br />
* made chips with K1319042 and K731520 in NA and M9 medium. Images were taken every 30 min with the GelDoc<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-07-03_M9_iLOV_serie.png|title=Sensor Chips with K1319042 in M9 first try|subtitle=Sensor chips with K1319042 in M9 medium with 1,5% agar. A) befor induction with IPTG B) 1&nbsp;h after induction C) 4.5&nbsp;h after induction a) induced with 2x&nbsp;2&nbsp;µl 1&nbsp;mM IPTG b) induced with 2x&nbsp;2&nbsp;µl 10&nbsp;mM IPTG c) induced with 2x&nbsp;2&nbsp;µl 0.1&nbsp;mM IPTG d) induced with 2x&nbsp;2&nbsp;µl 100&nbsp;mM IPTG|width=900px}}<br />
</center><br />
* print K1319042 Chip on LB plate<br />
* overnight culture of E0030 for plasmid prep<br />
<br />
== 4th ==<br />
* plasmid prep of E0030: 159.5 ng/µl (concentration)<br />
* print of K1319042 Chip on LB plate made 1 and 7 colonies<br />
<br />
== 7th ==<br />
* 13 Biobricks were transformed<br />
* overnight culture of K103006 for a plasmid prep was inoculated<br />
* colony PCR master mix was prepared<br />
<br />
== 8th ==<br />
* overnight culture of K1319042 for chips was inoculated<br />
<br />
== 9th ==<br />
* made chips with K1319042 in M9, M9 + casamino acids, Hartman medium (HM). Images were taken every 30 min with the Geldoc<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-07-09_M9_iLOV_serie.png|title=Sensor Chips with K1319042 in M9 second try|subtitle=Sensor chips with K1319042 in M9 medium with 1,5% agar. A) befor induction with IPTG B) 1.5&nbsp;h after induction C) 3&nbsp;h after induction a) induced with 2x&nbsp;2&nbsp;µl 1&nbsp;mM IPTG b) induced with 2x&nbsp;2&nbsp;µl 10&nbsp;mM IPTG c) induced with 2x&nbsp;2&nbsp;µl 0.1&nbsp;mM IPTG d) induced with 2x&nbsp;2&nbsp;µl 100&nbsp;mM IPTG|width=900px}}<br />
</center><br />
* made OmpA-linker_iLOV 3A-Assambley<br />
* colony PCR<br />
* transformation for backbones<br />
<br />
== 10th ==<br />
* master plates of the strains for backbone isolation<br />
<br />
== 14th ==<br />
* built again J23115.E0240 for interlab study<br />
<br />
== 15th ==<br />
* made 500&nbsp;ml LB and LB plates<br />
* made the transformation of J23115.E0240<br />
* overnight culture of K1319042 for chips<br />
<br />
== 16th ==<br />
* did plasmid preps<br />
* transformation of different reporter strains<br />
** NEB <br />
***pSEVE641_BsFbFP<br />
***pSEVA234_LasR<br />
***pSEVE641_BsFbFP pSEVA234_LasR<br />
***pSEVE641_BsFbFP pSB1C3_C0179<br />
**BL21<br />
***pSEVE641_BsFbFP pSEVA234_LasR<br />
***pSEVE641_BsFbFP pSB1C3_C0179<br />
* made chips with K1319042 in Hartman, Hartman + 20% glycerol, M9 medium images were taken every 30 min with the Geldoc<br />
* The PCR of Biobrick E0030 in vector pSB1C3 with primers for RFC 25 was made. The expected length is <br />
** forward primer EYFP_RFC25_F: ACGTTGAATTCGCGGCCGCTTCTAGATGGCCGGCGTGAGCAAGGGCGAGGAG<br />
** rewerse primer EYFP_RFC25_R: ATCCTGCAGCGGCCGCTACTAGTATTAACCGGTGTACAGCTCGTCCATGC<br />
* PCR product gets number K1319000 <br />
<br />
<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
|-<br />
| denature || 94 || 60"<br />
|-<br />
| denature || 94 || 30"<br />
|-<br />
| anneal || 50/60,4/64,9 || 30"<br />
|-<br />
| elongate || 72 || 60"<br />
|-<br />
| elongate || 72 || 5'<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
<br />
* The agarose gel with PCR product was made. Expected length is 778 kb.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-09-17_E0030_with_RFC25.png|title=Agarose gel with PCR products after PCR from E0030 to K1319000 |width=400px}}<br />
</center><br />
* as it can be seen on the picture PCR worked with all annealing temperatures, all samples were used for a transformation in DH5α after the restriction with DpnI.<br />
<br />
== 17th ==<br />
* the PCR product was purificated and the concentration was measured.<br />
* Restriktion of PCR product for the insert and E0030 for the vector with ''Eco''RI and PstI with following purification from agarose gel was made.<br />
<br />
== 21st ==<br />
* the ligation of PCR product (K1319000) and the vector that was purified from agarose (from E0030) was made.<br />
* ligated product was tranformed in DH5α.<br />
<br />
== 22nd ==<br />
* made 100x stocks for Hartmans minimal medium.<br />
* made about 25 HM+C plates without glucose.<br />
* K1319042 was plated on a HM+C plate<br />
<br />
== 23rd ==<br />
* made 25 new HM+C plates with 1% agar and 4&nbsp;g/L glucose<br />
* added 170&nbsp;µL of the glucose stock (500&nbsp;g/L) to the glucose-free HM+C-plates<br />
* 1&nbsp;L of sterile HM+glucose was prepared<br />
* K1319042 was plated on HM+C+Glucose and HM+C+Glucose drops, 3x 5&nbsp;mL HM+C+Glucose precultures were inoculated (17:00)<br />
<br />
== 24th ==<br />
* K1319042 did not grow, neither on the plates, nor on in the liquid media. The most probable cause is that the ''E.&nbsp;coli'' is missing some vitamins<br />
* Based on the [http://openwetware.org/wiki/M9_medium/supplemented M9 recipes by the Knight and Endy labs on OpenWetWare], we made a 20&nbsp;mL supplement stock solution that can be added to 1x HM media<br />
<br />
<center><br />
{| class="wikitable"<br />
|-<br />
! Component !! supplement for 1x HM [g/L] !! final 1x concentration<br />
|-<br />
| Casamino acids || 2 || 2 g/L<br />
|-<br />
| Thiamine hydrochloride || 0.3 || 300 mg/L<br />
|-<br />
| MgSO{{sub|4}}/MgSO{{sub|4}}*7H{{sub|2}}O || 0.242 / 0.494 || 2 mmol/L<br />
|-<br />
| CaCl{{sub|2}} || 0.011 || 0.1 mmol/L<br />
|}<br />
</center><br />
<br />
The powders for 1&nbsp;L of 1x HM were dissolved in 20&nbsp;mL of a 10%&nbsp;w/v Casamino acid stock solution and filter-sterilized (.22&nbsp;µm PES). To make agar chips, we can add 1&nbsp;mL to the hot agar mixture, together with the three 500&nbsp;µL 100x stocks for the HM.<br />
<br />
We made 250&nbsp;mL of HM+C+Glucose+Supplements plates with 1.5% agar.<br />
<br />
Then we plated the following combinations:<br />
<br />
<center><br />
{| class="wikitable"<br />
|-<br />
! Construct !! HM+C+Glucose+Supplements !! LB+C<br />
|-<br />
| K1319042 || - || +<br />
|-<br />
| J23101.E0240 || + || +<br />
|}<br />
</center><br />
<br />
We also prepared a 150&nbsp;mL HM+C+Glucose+Supplements culture with K1319042 to hopefully make agar chips on Friday, July 25th.<br />
<br />
Six of last weeks J23115.E0240 clones were plated on LB+C, and 5&nbsp;mL LB+C precultures were inoculated for plasmid preparation.<br />
<br />
== 25th ==<br />
The K1319042 strain did not grow on the HM plate, while another strain with the J23101.E0240 construct did. Both have the pSB1C3 backbone. To confirm the plasmids and inserts, we set up a colony PCR:<br />
<br />
<center><br />
{| class="wikitable"<br />
|-<br />
! ID !! Template !! Product Length !! Result<br />
|-<br />
| 1 || J23101.E0240 #5 || 1233 ||<br />
|-<br />
| 2 || J23101.E0240 #6 || 1233 ||<br />
|-<br />
| 3 || J23101.E0240 #5 plasmid || 1233 ||<br />
|-<br />
| 4 || K1319042 LB colony || 2053 ||<br />
|-<br />
| 5 || K1319042 plasmid || 2053 ||<br />
|-<br />
| 6 || K731520 GFP plasmid || 2437 ||<br />
|-<br />
| 7 || water || none ||<br />
|}<br />
</center><br />
<br />
Reaction volume per tube was 15&nbsp;µL. GoTaq Green Mastermix and the VF2 and VR primers were used. You can find the durations and temperatures the table below:<br />
<br />
<center><br />
{| class="wikitable"<br />
! parameter !! duration !! temp [°C]<br />
|-<br />
| denature || 10:00 || 95<br />
|-<br />
| '''denature''' || 00:30 || 95<br />
|-<br />
| '''anneal''' || 00:30 || 49<br />
|-<br />
| '''elongate''' || 02:36 || 72<br />
|-<br />
| elongate || 05:00 || 72<br />
|-<br />
| store || forever|| 8<br />
|}<br />
</center><br />
<br />
We mini-prepped the 6 overnight cultures of J23115.E0240 clones. He used 3&nbsp;mL instead of 1.5&nbsp;mL culture medium and eluted twice with 25&nbsp;µL nuclease-free water. Everything else was according to the protocol of the [http://www.gelifesciences.com/webapp/wcs/stores/servlet/productById/de/GELifeSciences/28904269 illustra plasmidPrep Mini-Spin Kit].<br />
<br />
The resulting DNA concentrations are listed in this table:<br />
<br />
<center><br />
{| class="wikitable"<br />
! clone # !! concentration [ng/µl]<br />
|-<br />
| 1 || 73.5<br />
|-<br />
| 2 || 94.5<br />
|-<br />
| 3 || 100.5<br />
|-<br />
| 4 || 53<br />
|-<br />
| 5 || 82<br />
|-<br />
| 6 || 138<br />
|}<br />
</center><br />
<br />
In the evening, we plated some strains on the different media to investigate why the K3139042 did not grow on the HM+suppl. plate. (Note: In the morning, we re-inoculated the HM+C+suppl. shake flask with cells from the LB-plate and by afternoon the culture ''did'' grow to a high cell density.)<br />
<br />
<center><br />
{| class="wikitable"<br />
! Construct !! Host strain !! LB+C !! HM+C+Glucose !! HM+C+Glucose+supplements<br />
|-<br />
| J23101.E0240 || NEB10β || ++ || - || ++<br />
|-<br />
| K1319042 || DH5alpha || ++ || - || (+)<br />
|-<br />
| K131026 || NEB10β || ++ || - || -<br />
|-<br />
| K131026 || DH5alpha || ++ || - || +<br />
|}<br />
</center><br />
<br />
We inoculated J23101.E0240 in LB and HM+C+Glucose+supplements.<br />
<br />
<!-- == 28th ==<br />
IMPORTANT: Look for customs documents and write ZHV lady!!!! --><br />
<br />
== 29th ==<br />
* inoculate 2x 150&nbsp;ml cultures HM+Glucose+C<br />
* prepared 200&nbsp;ml 1.5% agar<br />
* pre-cool centrifuge<br />
* centrifuge 1x 50, 1x 100 and 1x 150&nbsp;ml<br />
* make 3 kinds of chips - OOx1, ODx2, ODx3<br />
* pre cultures of K1319042 and K131026 in LB<br />
<br />
== 30th ==<br />
* made chips with K1319042 and K131026 in HM medium images were taken every 30 min with the Geldoc<br />
* print chips on LB and LB + Cam , count 2-10 colonies<br />
<br />
== 31th ==<br />
* transformation of K1319042 and K131026 in DH5α, BL21 and NEB<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/JuneTeam:Aachen/Notebook/Wetlab/June2014-10-17T10:20:06Z<p>VeraA: /* 4th */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= June =<br />
== 3rd ==<br />
* 34 BioBricks were transformed<br />
<br />
== 4th ==<br />
<br />
* Preparation of consumables: <br />
** fresh 50% glycerol<br />
** new LB plates with cam and with kanamycin (kan)<br />
** 60 glas tubes<br />
** 2&nbsp;L LB<sup>-</sup><br />
** 100&nbsp;mL steril glas beads for plating<br />
<br />
* Master plates (6 clones per BioBrick) were made<br />
<br />
== 5th ==<br />
* Colony PCRs on all transformed BioBricks were conducted<br />
*: &rarr; 2 clones from each master plate were picked<br />
* Overnight cultures in freshly prepared 5&nbsp;mL LB + cam were inoculated<br />
*: &rarr; 1 culture per BioBrick<br />
<br />
== 6th ==<br />
* 2 glycerol stocks of each BioBrick were made<br />
<br />
== 14th ==<br />
'''PCR of E0030 to K1319000'''<br />
* Q5 and Phusion polymerase were used<br />
<center><br />
{| class="wikitable"<br />
! Parameter !! Duration !! Temp [°C]<br />
|-<br />
| Denature||5:00||98<br />
|-<br />
| '''Denature'''||00:30||98<br />
|-<br />
| '''Anneal'''||00:30||55<br />
|-<br />
| '''Elongate'''||00:50||72<br />
|-<br />
| Elongate||05:00||72<br />
|}<br />
</center><br />
&rarr; 30 cycles<br />
<br />
== 17th ==<br />
* Colony PCR on following constructs:<br />
<center><br />
{| class="wikitable"<br />
|-<br />
! ID !! Colony !! Product Length <br />
|-<br />
| 1, 2 || K1319000 || 1041<br />
|-<br />
| 3, 4 || J23115.E0240 || 1233<br />
|-<br />
| 5, 6|| C0062 || 2937<br />
|-<br />
| 7, 8 || K516032 || 1219<br />
|-<br />
| 9, 10 || J23101.E0240 || 1233<br />
|-<br />
| 11 || negativ control || -<br />
|}<br />
</center><br />
&rarr; Anneling: 50°C<br />
<br />
&rarr; Elongation: 02:57<br />
<br />
== 20th ==<br />
* Colony PCR of K325108, K325218, C0062<br />
<br />
<center><br />
{| class="wikitable"<br />
! Parameter !! Duration !! Temp [°C]<br />
|-<br />
| Denature||5:00||95<br />
|-<br />
| '''Denature'''||00:30||95<br />
|-<br />
| '''Anneal'''||00:30||49<br />
|-<br />
| '''Elongate'''||03:15||72<br />
|-<br />
| Elongate||05:00||72<br />
|}<br />
</center><br />
&rarr; 30 cycles<br />
* PAGE: 30 min on 1.2&nbsp;% agarose gel at 110&nbsp;V<br />
&rarr; weak bands for K325108 a & b at 4.5&nbsp;kb and 9&nbsp;kb respectively<br />
<br />
== 23rd ==<br />
* Yesterdays colony PCR was repeated<br />
* Precultures for plasmid preps were inoculated<br />
** K1319000 &rarr; sequencing<br />
** K592100 &rarr; BFP<br />
** S01022 &rarr; CFP<br />
** J23101.E0240 &rarr; sequencing<br />
** J23115.E0240 &rarr; sequencing<br />
* K516132 and J23101.E0240 were plated on LB + cam plates<br />
<br />
== 24th ==<br />
* 8 plasmid preps were conducted<br />
* Overnight cultures of K516132 and J23101.E0240 were inoculated<br />
<br />
== 25th ==<br />
* Preculture for competent NEB10β cells was set up<br />
* Samples for sequencing were submitted<br />
* Master plates of transformed BioBricks were made<br />
* Overnight expression cultures of J23101.E0240 and K516132 were centrifuged and frozen<br />
* Fresh 50% glycerol was prepared<br />
<br />
== 26th ==<br />
* Competent NEB10β cells were made, however, several things went wrong. (For future reference: pre-cool centrifuge, always check if it is indeed spinning, frequently check OD of the culture)<br />
* Colony PCR on the transformed clones looked awful; there were too many cells in the 10&nbsp;µL reaction volume. Some tubes were not fully sealed during the PCR. Basically, ''only'' primers and smear, except for the positive control, which contained a plasmid template instead of cells.<br />
* 2x 500&nbsp;mL of fresh LB and three sterile flasks were prepared and autoclaved.<br />
<br />
== 27th ==<br />
* Plasmid preps<br />
<center><br />
{| class="wikitable"<br />
|-<br />
! Plasmid !! DNA [ng/µl] <br />
|-<br />
| J23115.E0240 #1 || 99<br />
|-<br />
| J23115.E0240 #2 || 226<br />
|-<br />
| K1319000 #6 || 78<br />
|-<br />
| K1319000 #1 || 221<br />
|-<br />
| K592100 || 240.5<br />
|-<br />
| S01022 || 160<br />
|-<br />
| J23101.E0240 #5 || 347<br />
|-<br />
| J23101.E0240 #6 || 229.5<br />
|}<br />
</center><br />
* Two cryos stocks of each were prepared<br />
<br />
== 28th ==<br />
* Sequencing<br />
* Transformation of 17 BioBricks<br />
<br />
== 30th ==<br />
* Master plates<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/MayTeam:Aachen/Notebook/Wetlab/May2014-10-17T10:18:39Z<p>VeraA: </p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= May =<br />
== 1st ==<br />
* A gel with M - full -full - REACh1 SOE3.2 - REACH2 SOE3.2 - M was run<br />
*: &rarr; 120&nbsp;V, 30 min<br />
*: &rarr; cut out the bands<br />
<br />
== 5th ==<br />
<br />
* Chemical competent DH5α and BL21 cells were made<br />
<br />
== 8th ==<br />
* The efficiency of our competent cells was tested<br />
*: &rarr; BL21: 6.6 x 10<sup>4</sup> clones/µg DNA<br />
*: &rarr; DH5α: 2.59 x 10<sup>7</sup> clones/µg DNA<br />
* SOE-PCR step 2 like on 30.04. with the template of SOE1 from 30.04. was re-done<br />
* The SOE2 product was run on a gel for checking (5&nbsp;µL)<br />
*: &rarr; restriction, (dephosphorylation of vector)<br />
*: &rarr; purification on a gel with high pure kit<br />
<br />
== 14th ==<br />
* LB agar plates with chloramphenicol and some with ampicillin were made<br />
* REACh2 was purified on 1.2% agarose gel<br />
* A subsequent purification of the 778 bp fragment with High Pure PCR Product Purification Kit was done<br />
<br />
== 19th ==<br />
* K131026 (AHL inducible GFP) was transformed into DH5α and NEB<br />
* K731520 (IPTG inducible GFPmut3b) was transformed into DH5α<br />
<br />
== 20th ==<br />
* Master plates on chloramphenicol (cam) &rarr; at least 6 clones on each plate<br />
* 2x 5&nbsp;mL LB + cam were prepared<br />
* Sterile 50% glycerol was made<br />
<br />
== 21th ==<br />
* Cryo stocks of clones 1 & 2 of each BioBrick/ host were prepared<br />
* 15&nbsp;mL cultures in 250&nbsp;mL flasks, inoculated with 1.5&nbsp;mL preculture (3 cultures A B C from clones 1; 1 + 2; 2)<br />
* 250&nbsp;µl Chloramphilicol from a 35&nbsp;mg/mL stock was added<br />
* The cultures were grown until OD<sub>600</sub>= 0.6, then one was induced with IPTG<br />
<center><br />
{| class="wikitable"<br />
! time !! colspan="3" | info/ OD<br />
|-<br />
| '''11:10'''||A: inoculated ||B: inoculated ||C: inoculated <br />
|-<br />
| '''11:38'''||A: 0.482 ||B: 0.464 ||C: 0.466<br />
|-<br />
| '''12:28'''||A: 0.586; induced with 0.1&nbsp;mM IPTG ||B: 0.576 ||C: 0.568<br />
|-<br />
| '''14:11'''||A: 0.93 ||B: 0.91 ||C: 0.942<br />
|}<br />
</center><br />
&rarr; A negative control without plasmid was left out<br />
<br />
== 23rd ==<br />
* Some BioBricks were transformed<br />
* Colony PCR (s. picture below)<br />
*: &rarr; K131026: 1807&nbsp;bp<br />
*: &rarr; K731520: 2123&nbsp;bp<br />
*: &rarr; full length EYFP: 778&nbsp;bp<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-05-23_COLONY-PCR.jpg|title=Colony PCR |subtitle=todo|width=300px}}<br />
</center><br />
{{Team:Aachen/JumpUp}}<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/AprilTeam:Aachen/Notebook/Wetlab/April2014-10-17T10:16:49Z<p>VeraA: </p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= April =<br />
== 1st ==<br />
'''Organization'''<br />
<br />
where to get:<br />
* key cards and keys for the lab<br />
* cooled centifuge<br />
* space in -80°C<br />
* bottles for 70% ethanol<br />
* ... (problems of a first year team ^^)<br />
<br />
== 12th ==<br />
* Chemically competent NEB Top10, DH5α and BL21 were made<br />
<br />
== 15th ==<br />
* 800&nbsp;ml LB for plates with 1.5% agar and kanamycin (50&nbsp;µg/L) were prepared<br />
* The efficiency of our competent cells was tested<br />
** Colonies on the agar plates were counted after transformation with 1&nbsp;µl DNA (147&nbsp;ng/µl)<br />
** Cells had been incubated in SOC or LB medium<br />
<br />
<center><br />
{| class="wikitable"<br />
! Dilution !! 200&nbsp;µl (stock) !! 100&nbsp;µl (stock) !! 1:5 !! 1:10 !! 1:100<br />
|-<br />
| '''DH5α''' || SOC: 30 LB: 10 ||SOC: 7 LB: 1 || SOC: 1 LB: 2 || SOC: 2 LB: 1 ||<br />
|-<br />
| '''NEB 10β''' || SOC: 170 LB: 135 ||SOC: 100 LB: 79 || SOC: 25 LB: 22 || SOC: 9 LB: 9 || SOC: 1 LB:0<br />
|-<br />
|}<br />
</center><br />
* BL21 cells were centrifuged and plated; only 128 colonies grew in total indicating a very bad efficiency (~482.11).<br />
<br />
Following formula was used to calculate the efficiency:<br />
: Efficiency = (CFU /µg DNA) / Dilution <br />
* for DH5α: medial efficiency in SOC: 1864.36, and in LB: 440.68<br />
* for NEB: medial efficiency in SOC: 6779.66, and in LB: 4698.30<br />
*:'''Higher efficiency when using SOC!'''<br />
<br />
== 22th ==<br />
<br />
'''Pcq lab PCR''' advanced primus 25, 96 <br />
<center><br />
{| class="wikitable"<br />
! !! Lenght [bp] !! % GC !! T<sub>m</sub> !! T<sub>A</sub><br />
|-<br />
| '''EYFP_RFC25''' || 778 || 61 || 84 || 56<br />
|-<br />
| '''REACh1_C''' || 481 || 62 || 84 || 57 <br />
|-<br />
| '''REACh1_N''' || 320 || 59 || 82 || 54 <br />
|-<br />
| '''REACh2_C''' || 487 || 62 || 83 || 57 <br />
|-<br />
| '''REACh2_N''' || 320 || 59 || 82 || 54 <br />
|-<br />
|}<br />
</center><br />
<br />
Program name IGEM.cyc<br />
<br />
<center><br />
{| class="wikitable"<br />
! Parameter !! Duration !! Temp [°C]<br />
|-<br />
| Denature||10:00||98<br />
|-<br />
| '''Denature'''||00:30||98<br />
|-<br />
| '''Anneal'''||00:30||52<br />
|-<br />
| '''Elongate'''||02:36||72<br />
|-<br />
| Elongate||05:00||72<br />
|-<br />
| Store||forever||8<br />
|}<br />
</center><br />
<br />
# RFC25_F RFC25_R<br />
# RFC25_F REACh1_R<br />
# REACh1_F RFC25_R<br />
# RFC25_F REACh2_R<br />
# REACh2_F RFC25_R<br />
<br />
== 23th ==<br />
* 5&nbsp;µl of the PCR products were run on a 1,5% agarose gel<br />
* DNA bands were purified from gel with the High Pure Product Purification Kit. Full length products were contaminated with REACh1<br />
<br />
<br />
*'''SOE'''<br />
* ca. 30&nbsp;ng/µL<br />
<br />
<center><br />
{| class="wikitable"<br />
! !! 20x !! -> 20&nbsp;µL thereof: 30x<br />
|-<br />
| '''HF'''||10||10<br />
|-<br />
| '''dNTP'''||4||4<br />
|-<br />
| '''Template'''||2x 1||10<br />
|-<br />
| '''Phusion'''||0.5||0.5<br />
|-<br />
| '''Primer'''||-||2x 2.5<br />
|-<br />
| '''Water'''||33.5||21.5<br />
|}<br />
</center><br />
<br />
'''Anneling''': 52°C<br />
<br />
'''Elongation''': 20 sec<br />
<br />
<br />
*'''PCR with Phusion polymerase'''<br />
<center><br />
{| class="wikitable"<br />
! !!Volume [µL]<br />
|-<br />
| '''HF'''||10<br />
|-<br />
| '''dNTP'''||4<br />
|-<br />
| '''Template'''||1<br />
|-<br />
| '''Phusion'''||0.5<br />
|-<br />
| '''Primer'''||2x 2.5<br />
|-<br />
| '''Water'''||29.5<br />
|-<br />
| '''Total'''||50<br />
|}<br />
</center><br />
<br />
*'''Digestion for restriction with NEB enzymes'''<br />
<center><br />
{| class="wikitable"<br />
! !!Volume<br />
|-<br />
| '''Destination Vector'''||500&nbsp;ng<br />
|-<br />
| '''EcoRI-HF'''||1&nbsp;µL<br />
|-<br />
| '''PstI'''||1&nbsp;µL<br />
|-<br />
| '''10x NEB Buffer 2.1'''||5&nbsp;µL<br />
|-<br />
| '''Water'''||???&nbsp;µL<br />
|-<br />
| '''Total'''||???&nbsp;µL<br />
|}<br />
</center><br />
<br />
* ligation with NEB Kit<br />
<br />
== 28th ==<br />
* The DNA concentration of the SOE2 products were measured after purification<br />
* 1: 57&nbsp;ng/µL<br />
* 2: 69.5&nbsp;ng/µL<br />
<br />
== 29th ==<br />
*'''PCR SOE1 and SOE2'''<br />
<br />
== 30th ==<br />
* A PAGE of the SOE2 products was run on agarose gel for checking<br />
*: &rarr; no positive results; only full length products were amplified<br />
<br />
<br />
<br />
* SOE PCRs were run again<br />
*: &rarr; more template<br />
*: &rarr; hot start<br />
*: &rarr; faster<br />
*: &rarr; elongation: 15 min<br />
*: &rarr; 20 cycles<br />
<br />
* '''SOE1'''<br />
Template A+B &rarr; 20&nbsp;µL &rarr; <u>13.8 + 6.2</u> <u>5.3 + 14.7</u><br />
<br />
<center><br />
{| class="wikitable"<br />
! !!volume [µL]<br />
|-<br />
| '''HF'''||10<br />
|-<br />
| '''dNTP'''||4<br />
|-<br />
| '''Template'''||20<br />
|-<br />
| '''Phusion'''||0.5<br />
|-<br />
| '''Water'''||13.5<br />
|}<br />
</center><br />
<br />
* '''SOE2'''<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/AprilTeam:Aachen/Notebook/Wetlab/April2014-10-17T10:15:30Z<p>VeraA: </p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= April =<br />
== 1st ==<br />
'''Organization'''<br />
<br />
where to get:<br />
* key cards and keys for the lab<br />
* cooled centifuge<br />
* space in -80°C<br />
* bottles for 70% ethanol<br />
* ... (problems of a first year team ^^)<br />
<br />
== 12th ==<br />
* Chemically competent NEB Top10, DH5α and BL21 were made<br />
<br />
== 15th ==<br />
* 800&nbsp;ml LB for plates with 1.5% agar and kanamycin (50&nbsp;µg/L) were prepared<br />
* The efficiency of our competent cells was tested<br />
** Colonies on the agar plates were counted after transformation with 1&nbsp;µl DNA (147&nbsp;ng/µl)<br />
** Cells had been incubated in SOC or LB medium<br />
<br />
<center><br />
{| class="wikitable"<br />
! Dilution !! 200&nbsp;µl (stock) !! 100&nbsp;µl (stock) !! 1:5 !! 1:10 !! 1:100<br />
|-<br />
| '''DH5α''' || SOC: 30 LB: 10 ||SOC: 7 LB: 1 || SOC: 1 LB: 2 || SOC: 2 LB: 1 ||<br />
|-<br />
| '''NEB 10β''' || SOC: 170 LB: 135 ||SOC: 100 LB: 79 || SOC: 25 LB: 22 || SOC: 9 LB: 9 || SOC: 1 LB:0<br />
|-<br />
|}<br />
</center><br />
* BL21 cells were centrifuged and plated; only 128 colonies grew in total indicating a very bad efficiency (~482.11).<br />
<br />
Following formula was used to calculate the efficiency:<br />
: Efficiency = (CFU /µg DNA) / Dilution <br />
* for DH5α: medial efficiency in SOC: 1864.36, and in LB: 440.68<br />
* for NEB: medial efficiency in SOC: 6779.66, and in LB: 4698.30<br />
*:'''Higher efficiency when using SOC!'''<br />
<br />
== 22th ==<br />
<br />
'''Pcq lab PCR''' advanced primus 25, 96 <br />
<center><br />
{| class="wikitable"<br />
! !! Lenght [bp] !! % GC !! T<sub>m</sub> !! T<sub>A</sub><br />
|-<br />
| '''EYFP_RFC25''' || 778 || 61 || 84 || 56<br />
|-<br />
| '''REACh1_C''' || 481 || 62 || 84 || 57 <br />
|-<br />
| '''REACh1_N''' || 320 || 59 || 82 || 54 <br />
|-<br />
| '''REACh2_C''' || 487 || 62 || 83 || 57 <br />
|-<br />
| '''REACh2_N''' || 320 || 59 || 82 || 54 <br />
|-<br />
|}<br />
</center><br />
<br />
Program name IGEM.cyc<br />
<br />
<center><br />
{| class="wikitable"<br />
! Parameter !! Duration !! Temp [°C]<br />
|-<br />
| Denature||10:00||98<br />
|-<br />
| '''Denature'''||00:30||98<br />
|-<br />
| '''Anneal'''||00:30||52<br />
|-<br />
| '''Elongate'''||02:36||72<br />
|-<br />
| Elongate||05:00||72<br />
|-<br />
| Store||forever||8<br />
|}<br />
</center><br />
<br />
# RFC25_F RFC25_R<br />
# RFC25_F REACh1_R<br />
# REACh1_F RFC25_R<br />
# RFC25_F REACh2_R<br />
# REACh2_F RFC25_R<br />
<br />
== 23th ==<br />
* 5&nbsp;µl of the PCR products were run on a 1,5% agarose gel<br />
* DNA bands were purified from gel with the High Pure Product Purification Kit. Full length products were contaminated with REACh1<br />
<br />
<br />
*'''SOE'''<br />
* ca. 30&nbsp;ng/µL<br />
<br />
<center><br />
{| class="wikitable"<br />
! !! 20x !! -> 20&nbsp;µL thereof: 30x<br />
|-<br />
| '''HF'''||10||10<br />
|-<br />
| '''dNTP'''||4||4<br />
|-<br />
| '''Template'''||2x 1||10<br />
|-<br />
| '''Phusion'''||0.5||0.5<br />
|-<br />
| '''Primer'''||-||2x 2.5<br />
|-<br />
| '''Water'''||33.5||21.5<br />
|}<br />
</center><br />
<br />
'''Anneling''': 52&nbsp;°C<br />
<br />
'''Elongation''': 20 sec<br />
<br />
<br />
*'''PCR with Phusion polymerase'''<br />
<center><br />
{| class="wikitable"<br />
! !!Volume [µL]<br />
|-<br />
| '''HF'''||10<br />
|-<br />
| '''dNTP'''||4<br />
|-<br />
| '''Template'''||1<br />
|-<br />
| '''Phusion'''||0.5<br />
|-<br />
| '''Primer'''||2x 2.5<br />
|-<br />
| '''Water'''||29.5<br />
|-<br />
| '''Total'''||50<br />
|}<br />
</center><br />
<br />
*'''Digestion for restriction with NEB enzymes'''<br />
<center><br />
{| class="wikitable"<br />
! !!Volume<br />
|-<br />
| '''Destination Vector'''||500&nbsp;ng<br />
|-<br />
| '''EcoRI-HF'''||1&nbsp;µL<br />
|-<br />
| '''PstI'''||1&nbsp;µL<br />
|-<br />
| '''10x NEB Buffer 2.1'''||5&nbsp;µL<br />
|-<br />
| '''Water'''||???&nbsp;µL<br />
|-<br />
| '''Total'''||???&nbsp;µL<br />
|}<br />
</center><br />
<br />
* ligation with NEB Kit<br />
<br />
== 28th ==<br />
* The DNA concentration of the SOE2 products were measured after purification<br />
* 1: 57&nbsp;ng/µL<br />
* 2: 69.5&nbsp;ng/µL<br />
<br />
== 29th ==<br />
*'''PCR SOE1 and SOE2'''<br />
<br />
== 30th ==<br />
* A PAGE of the SOE2 products was run on agarose gel for checking<br />
*: &rarr; no positive results; only full length products were amplified<br />
<br />
<br />
<br />
* SOE PCRs were run again<br />
*: &rarr; more template<br />
*: &rarr; hot start<br />
*: &rarr; faster<br />
*: &rarr; elongation: 15 min<br />
*: &rarr; 20 cycles<br />
<br />
* '''SOE1'''<br />
Template A+B &rarr; 20&nbsp;µL &rarr; <u>13.8 + 6.2</u> <u>5.3 + 14.7</u><br />
<br />
<center><br />
{| class="wikitable"<br />
! !!volume [µL]<br />
|-<br />
| '''HF'''||10<br />
|-<br />
| '''dNTP'''||4<br />
|-<br />
| '''Template'''||20<br />
|-<br />
| '''Phusion'''||0.5<br />
|-<br />
| '''Water'''||13.5<br />
|}<br />
</center><br />
<br />
* '''SOE2'''<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/AugustTeam:Aachen/Notebook/Wetlab/August2014-10-17T09:15:52Z<p>VeraA: /* 5th */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= August =<br />
== 1st ==<br />
* made electrocompetent ''E.coli'' rosetta cells.<br />
* prepared cultures of K1319042 and K131026<br />
<br />
== 2nd ==<br />
* tested the OD measurement device and compared it to the spectrophotometer and the plate reader. <br />
* tested K131026 and K1319042 for fluorescence in the plate reader<br />
* did a heat shock transformation of I746909 into NEB TOP 10 cells<br />
* did an electroshock transformation of pET17-Gal3 into ''E.coli'' rosetta<br />
<br />
== 3rd ==<br />
* OD measurements of the iGEM device in comparison to the spectrophotometer were taken. <br />
* cryo cultures of K131026 and K1319042 were prepared<br />
* master plates of Gal3 #1-#10 and I746909 #1-#4 and overnight cultures<br />
<br />
== 4th ==<br />
* made cryo stocks of K1319042 and K131026 in NEB/BL21/DH5alpha, I746909 in BL21 and pET17-His-SNAP-YFP-Gal3 in ''E.&nbsp;coli'' rosetta (DE3), respectively.<br />
* made plasmid prep, most of them using 1.5&nbsp;mL culture medium, and eluted with 1x 50&nbsp;µL of ddH{{sub|2}}O. The resulting DNA concentrations are shown below.<br />
<br />
<center><br />
{| class="wikitable"<br />
! combination !! concentration [ng/µl]<br />
|-<br />
| I746909 BL21 #1 || 73.5<br />
|-<br />
| I746909 BL21 #2 || 45<br />
|-<br />
| I746909 BL21 #3 || 49<br />
|-<br />
| K1319042 DH5alpha || 60<br />
|-<br />
| K131026 DH5alpha || 150<br />
|-<br />
| pET17-Gal3 #1 || 30.5<br />
|-<br />
| pET17-Gal3 #2 || 6.4<br />
|-<br />
| pET17-Gal3 #3 || 6.3<br />
|-<br />
| pET17-Gal3 #4 || 9.4<br />
|-<br />
| pET17-Gal3 #5 || 10.1<br />
|-<br />
| pET17-Gal3 #6 || 8.2<br />
|-<br />
| pET17-Gal3 #7 || 13.8<br />
|-<br />
| pET17-Gal3 #8 || 6.9<br />
|-<br />
| pET17-Gal3 #9 || 10.2<br />
|}<br />
</center><br />
<br />
To confirm the quality of pET17-Gal3 transformations, the purified plasmids were tested by carrying out a digest. Results are shown in the below picture and table.<br />
<br />
<center><br />
{{Team:Aachen/Figure|14-08-04_Test-Digest.png|title=Test digest|subtitle=clones were test-digested|width=400px}}<br />
<br />
{| class="wikitable"<br />
! combination !! cut products[bp]<br />
|-<br />
| I746909 BL21 #1 || 2029, 947<br />
|-<br />
| K1319042 DH5alpha || 2029, 1780<br />
|-<br />
| K131026 DH5alpha || 2029, 1848<br />
|-<br />
| pET17-Gal3 #1 || 3086, 923, 1262<br />
|}<br />
</center><br />
<br />
All pET17-Gal3 clones were positive and clone #1 was selected for further experiments.<br />
* prepared an over night cultur of K1319042 for chips<br />
<br />
== 5th ==<br />
* assembly of a V{{sub|R}}=2.5&nbsp;L bioreactor for cultivation of a 1&nbsp;L expression culture.<br />
* Two precultures of 20&nbsp;mL LB+A were inoculated at 19:00<br />
* transformation of K746909 into BL21 cells and K1319000 into NEB10β cells.<br />
* made Chips with K1319042 in HM. Images were taken every 30 min with the Geldoc<br />
* made alliquots of HM, 1&nbsp;L HM + glucose + supplements and 500&nbsp;ml LB<br />
<br />
* The Quickchange mutagenesis PCR with a tamplate K1319000 and following primers was made. The PCR was made in two steps. The first step is PCR with both primers separatly and the second step includes PCR with two PCR products mixed with each other.<br />
** forward primer EYFPtoREACh1_F: AGTACAACTGGAACAGCCACAACGTCTATATC<br />
** rewerse primer EYFPtoREACh1_R: GTTGTGGCTGTTCCAGTTGTACTCCAGCTTG<br />
** forward primer EYFPtoREACh2_F: AGTACAACTGGAACAGCCGCAACGTCTATATCATG<br />
** rewerse primer EYFPtoREACh2_R: ATAGACGTTGCGGCTGTTCCAGTTGTACTCCAGCTTG<br />
<br />
'''1. Step''' with 3 cycles<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| anneal || 55 || 30"<br />
|-<br />
| elongate || 72 || 30"<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
'''2. Step''' with 14 cycles<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| anneal || 55 || 60"<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-07-5_PCR_toREACh1%262.png|title=Agarose gel with PCR products after Quichchange from K1319000 to K1319001 and K1319002 |width=400px}}<br />
</center><br />
<br />
* REACh1 gets number K1319001 and REACh2 gets number K1319002.<br />
<br />
* PCR product was restricted with DpnI 60&nbsp;min at 37&nbsp;°C to destroy the methylated template. Then DpnI was deaktevated at 80&nbsp;°C during 20&nbsp;min.<br />
* PCR product was purifired and transformated in DH5α.<br />
<br />
== 6th ==<br />
* transformation of J04450 in pSB1K3 and pSB1A3 in NEB10β cells.<br />
* They also did a plasmid prep of J04450 in pSB1C3 and Flo's vectors.<br />
* made precultures of NEB10βand DH5 alpha cells<br />
* inoculation of the fermenter at 11:40, and induced the fermentation of pET17-Gal3. The fermentation is expected to run 24&nbsp;h.<br />
* as the first Quickchange PCR for REACh2 was not sucsessful, it was reapeted as a gradient PCR with annealing temperatire 55&nbsp;°C, 57&nbsp;°C and 60&nbsp;°C. Then the agarose gel with PCR product samples was made.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-08-06_to_REACh2.png|title=Agarose gel with PCR products after Quickchange from K1319000 to K1319002 |width=400px}}<br />
</center><br />
<br />
== 7th ==<br />
* made media for ''Pseudomonas flourescens''<br />
** Nutrient Broth<br />
** Pseudomonas-F<br />
** Pseudomonas-P<br />
* made 2&nbsp;L LB<br />
<br />
== 8th ==<br />
* prepared 2x 60&nbsp;ml (LB + cam + IPTG) with K1319042<br />
* prepared 5&nbsp;ml K131026 and C0179<br />
* made SDS page<br />
<br />
== 9th ==<br />
* made a plate reader experiment with K131026 in LB and LB + HM<br />
<br />
== 11th ==<br />
* plated on LB + antibiotics<br />
** K131026<br />
** I746909<br />
** K13190042<br />
** I04450 in pSB1C3<br />
** I04450 in pSB1A3<br />
** I04450 in pSB1K3<br />
** pSEVA construct (pSEVA 641_FP pSEVA 234-LasR)<br />
<br />
== 13th ==<br />
* Agarose chips were prepared:<br />
** ''E. coli'' DH5α K131026 and I746909 in LB and HM<br />
** K1319042 and the pSEVA two plasmid construct in HM<br />
* Images were taken every 30 min with the Geldoc<br />
<br />
==15th ==<br />
* A bioreactor containing 1&nbsp;L Medium was inoculated with pET17-His-SNAP-YFP-Gal3.<br />
<br />
== 16th ==<br />
* The above mentioned Bioreactor was stopped after 20&nbsp;h and all cells were lysed.<br />
<br />
== 18th ==<br />
* Overnight cultures of I746909 and K131026 in LB, TB, 2x HM+ were made<br />
* 3x J23101.E0240 was plated<br />
* pET17-His-SNAP-YFP-Gal3 was purified with Äkta via a histidine-tagged protein purification.<br />
<br />
== 19th ==<br />
* Chips with K131026 and I746909 in HM were made. Images were taken every 30 min with the Geldoc<br />
* A PCR of J23101.E0240, K1319000, K1319001, K1319002 was run and the product was separated on a 1,2&nbsp;% agarose gel<br />
* A SDS gel with samples of protein purification of pET17-His-SNAP-YFP-Gal3 was made to check if the purifired samples contain the target protein - YFP-Gal3. The purification or the gel resulted in two samples with a yellow color. For the SDS we also used the two samples before and the two samples after ones with the yellow color, 6&nbsp;mL. <br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-08-18_Gal3_purification_iVA.png|title=YFP-Gal3 protein purification|subtitle=|width=400px}}<br />
</center><br />
<br />
* Two samples with YFP-Gal3 were concentrated till 1&nbsp;mL <br />
* The concentration of YFP-Gal3 was calculated on Tecan. Calculation showed concentration 13,42&nbsp;mg/ml<br />
<br />
== 20th ==<br />
* repeat PCR for REACh1 and J23101.E0240 and run a gel<br />
* plasmid prep of pSEVA BfsB, pSEVA lasR and I746909<br />
<br />
== 24th ==<br />
* made 2.5&nbsp;L LB<br />
* made chips of K131026 in NEB , DH5α and BL21 in LB and additionally K131026 in DH5α in HM+. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_24_08_2014_K131026_bl21_serie.png|title=Sensor Chips with K131026 in BL21 in LB taken with first prototyp of our own device|subtitle=Sensor chips with K131026 in BL21 in LB medium with 1,5&nbsp;% agar, lower chip induced. A) befor induction with 2&nbsp;µl of 5000&nbsp;µg/ml HSL (3-oxo-C12) B) 0.5&nbsp;h after induction C) 1&nbsp;h after induction D) 1.5&nbsp;h after induction E) 2&nbsp;h after induction F) 2.5&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
== 25th ==<br />
* did a plasmid restriction of I20260 (EcoRI,PstI), J23115 (EcoRI, SpeI), K516032 (XbaI,PstI), and J23101 (EcoRI, SpeI)<br />
* tested the growth of ''Pseudomonas fluorescens'' in different liquid media for high OD and strong fluorescence. She tested Standard I medium, Cetrimide medium and Pseudomonas-F medium, and Pseudomonas-F medium supplemented with 300&nbsp;µL Fe3+ in 500&nbsp;mL flasks with a filling volume of 30&nbsp;mL. The flasks were inoculated with ''P. fluorescens'' cells on Standard I agar, and incubated at 30&nbsp;°C at 250&nbsp;rpm.<br />
* prepared over night cultures of K131026 in DH5α and NEB for chips<br />
* prepared 2x 5&nbsp;ml of pSB1C3, psB3K3 and pSB1A2 for plasmid prep<br />
<br />
== 26th ==<br />
* ligation of J23115 and K516032 to J23115.K516032, and J23101 and K516032 to J23101.K516032, respectively.<br />
* plasmid prep of I20260, K516032 and B0034<br />
* restriction of plasmids I20260, K516032, B0034 with EcoRI and PstI<br />
* gel with restricted the I20260, K516032 and B0034 was run<br />
* purification of vector backbones pSB1A2, pSB3K3 and pSB1C3<br />
* restriciton of synthesized TEV protease with EcoRI and PstI<br />
* qualitatively tested the ''Pseudomonas fluorescens'' that had grown over night for OD and fluorescence. She determined that Pseudomonas-F medium is the most adequate for the cultivation of the strain we use, since both OD and fluorescence were best in the flask containing the respective medium. Growth in the Pseudomonas-F medium supplemented with 300&nbsp;µg/L Fe3+ was weaker, however, fluorescence was also successfully suppressed.<br />
* made chips with K131026 in DH5α and NEB, in LB and LB + 10&nbsp;% glycerol. Images were taken with our own device every 10 min (illumination problems).<br />
<center><br />
{{Team:Aachen/Figure|Aachen_26_08_2014_K131026_neb_serie.png|title=Sensor Chips with K131026 in NEB in LB taken with first prototyp of our own device|subtitle=Sensor chips with K131026 in NEB in LB medium with 1,5&nbsp;% agar. Chip on the top induced with 0.5&nbsp;µl of 500&nbsp;µg/ml HSL and on the bottom with less than 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12). A) befor induction B) 1&nbsp;h after induction C) 1.5&nbsp;h after induction D) 2&nbsp;h after induction |width=600px}}<br />
</center><br />
* plasmid prep of the back bones, restriction and gel purification<br />
<br />
== 27th ==<br />
* transformation of some BioBricks<br />
* ligation of J23101.K516032 into pSB3K3 and J23115.K516032 into pSB3K3 and K1319004 into pSB1C3<br />
* transformation of K1319004 into pUC and pSB1C3, and J04450 into pSB1K3 and pSB1A3, respectively<br />
<br />
== 28th ==<br />
* transformation of some BioBricks<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/JulyTeam:Aachen/Notebook/Wetlab/July2014-10-17T09:14:45Z<p>VeraA: /* 16th */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= July =<br />
== 1st ==<br />
* transformation efficiency kit is broken<br />
&rarr; run an agarose gel with the kit plasmids to check for nuclease activity/ bands<br />
* inventory of the -80°C freezer was done<br />
<br />
== 2nd ==<br />
* overnight cultures (LB) of K731520 and K1319042 for chips were inoculated<br />
<br />
== 3rd ==<br />
* ODs of the overnight culture of <br />
** K731520: 2.3 <br />
** K1319042: 2.5<br />
* made chips with K1319042 and K731520 in NA and M9 medium. Images were taken every 30 min with the GelDoc<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-07-03_M9_iLOV_serie.png|title=Sensor Chips with K1319042 in M9 first try|subtitle=Sensor chips with K1319042 in M9 medium with 1,5&nbsp;% agar. A) befor induction with IPTG B) 1&nbsp;h after induction C) 4.5&nbsp;h after induction a) induced with 2x&nbsp;2&nbsp;µl 1&nbsp;mM IPTG b) induced with 2x&nbsp;2&nbsp;µl 10&nbsp;mM IPTG c) induced with 2x&nbsp;2&nbsp;µl 0.1&nbsp;mM IPTG d) induced with 2x&nbsp;2&nbsp;µl 100&nbsp;mM IPTG|width=900px}}<br />
</center><br />
* print K1319042 Chip on LB plate<br />
* overnight culture of E0030 for plasmid prep<br />
<br />
== 4th ==<br />
* plasmid prep of E0030: 159.5 ng/µl (concentration)<br />
* print of K1319042 Chip on LB plate made 1 and 7 colonies<br />
<br />
== 7th ==<br />
* 13 Biobricks were transformed<br />
* overnight culture of K103006 for a plasmid prep was inoculated<br />
* colony PCR master mix was prepared<br />
<br />
== 8th ==<br />
* overnight culture of K1319042 for chips was inoculated<br />
<br />
== 9th ==<br />
* made chips with K1319042 in M9, M9 + casamino acids, Hartman medium (HM). Images were taken every 30 min with the Geldoc<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-07-09_M9_iLOV_serie.png|title=Sensor Chips with K1319042 in M9 second try|subtitle=Sensor chips with K1319042 in M9 medium with 1,5&nbsp;% agar. A) befor induction with IPTG B) 1.5&nbsp;h after induction C) 3&nbsp;h after induction a) induced with 2x&nbsp;2&nbsp;µl 1&nbsp;mM IPTG b) induced with 2x&nbsp;2&nbsp;µl 10&nbsp;mM IPTG c) induced with 2x&nbsp;2&nbsp;µl 0.1&nbsp;mM IPTG d) induced with 2x&nbsp;2&nbsp;µl 100&nbsp;mM IPTG|width=900px}}<br />
</center><br />
* made OmpA-linker_iLOV 3A-Assambley<br />
* colony PCR<br />
* transformation for backbones<br />
<br />
== 10th ==<br />
* master plates of the strains for backbone isolation<br />
<br />
== 14th ==<br />
* built again J23115.E0240 for interlab study<br />
<br />
== 15th ==<br />
* made 500&nbsp;ml LB and LB plates<br />
* made the transformation of J23115.E0240<br />
* overnight culture of K1319042 for chips<br />
<br />
== 16th ==<br />
* did plasmid preps<br />
* transformation of different reporter strains<br />
** NEB <br />
***pSEVE641_BsFbFP<br />
***pSEVA234_LasR<br />
***pSEVE641_BsFbFP pSEVA234_LasR<br />
***pSEVE641_BsFbFP pSB1C3_C0179<br />
**BL21<br />
***pSEVE641_BsFbFP pSEVA234_LasR<br />
***pSEVE641_BsFbFP pSB1C3_C0179<br />
* made chips with K1319042 in Hartman, Hartman + 20&nbsp;% glycerol, M9 medium images were taken every 30 min with the Geldoc<br />
* The PCR of Biobrick E0030 in vector pSB1C3 with primers for RFC 25 was made. The expected length is <br />
** forward primer EYFP_RFC25_F: ACGTTGAATTCGCGGCCGCTTCTAGATGGCCGGCGTGAGCAAGGGCGAGGAG<br />
** rewerse primer EYFP_RFC25_R: ATCCTGCAGCGGCCGCTACTAGTATTAACCGGTGTACAGCTCGTCCATGC<br />
* PCR product gets number K1319000 <br />
<br />
<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
|-<br />
| denature || 94 || 60"<br />
|-<br />
| denature || 94 || 30"<br />
|-<br />
| anneal || 50/60,4/64,9 || 30"<br />
|-<br />
| elongate || 72 || 60"<br />
|-<br />
| elongate || 72 || 5'<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
<br />
* The agarose gel with PCR product was made. Expected length is 778 kb.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-09-17_E0030_with_RFC25.png|title=Agarose gel with PCR products after PCR from E0030 to K1319000 |width=400px}}<br />
</center><br />
* as it can be seen on the picture PCR worked with all annealing temperatures, all samples were used for a transformation in DH5α after the restriction with DpnI.<br />
<br />
== 17th ==<br />
* the PCR product was purificated and the concentration was measured.<br />
* Restriktion of PCR product for the insert and E0030 for the vector with ''Eco''RI and PstI with following purification from agarose gel was made.<br />
<br />
== 21st ==<br />
* the ligation of PCR product (K1319000) and the vector that was purified from agarose (from E0030) was made.<br />
* ligated product was tranformed in DH5α.<br />
<br />
== 22nd ==<br />
* made 100x stocks for Hartmans minimal medium.<br />
* made about 25 HM+C plates without glucose.<br />
* K1319042 was plated on a HM+C plate<br />
<br />
== 23rd ==<br />
* made 25 new HM+C plates with 1&nbsp;% agar and 4&nbsp;g/L glucose<br />
* added 170&nbsp;µL of the glucose stock (500&nbsp;g/L) to the glucose-free HM+C-plates<br />
* 1&nbsp;L of sterile HM+glucose was prepared<br />
* K1319042 was plated on HM+C+Glucose and HM+C+Glucose drops, 3x 5&nbsp;mL HM+C+Glucose precultures were inoculated (17:00)<br />
<br />
== 24th ==<br />
* K1319042 did not grow, neither on the plates, nor on in the liquid media. The most probable cause is that the ''E.&nbsp;coli'' is missing some vitamins<br />
* Based on the [http://openwetware.org/wiki/M9_medium/supplemented M9 recipes by the Knight and Endy labs on OpenWetWare], we made a 20&nbsp;mL supplement stock solution that can be added to 1x HM media<br />
<br />
<center><br />
{| class="wikitable"<br />
|-<br />
! Component !! supplement for 1x HM [g/L] !! final 1x concentration<br />
|-<br />
| Casamino acids || 2 || 2 g/L<br />
|-<br />
| Thiamine hydrochloride || 0.3 || 300 mg/L<br />
|-<br />
| MgSO{{sub|4}}/MgSO{{sub|4}}*7H{{sub|2}}O || 0.242 / 0.494 || 2 mmol/L<br />
|-<br />
| CaCl{{sub|2}} || 0.011 || 0.1 mmol/L<br />
|}<br />
</center><br />
<br />
The powders for 1&nbsp;L of 1x HM were dissolved in 20&nbsp;mL of a 10&nbsp;%&nbsp;w/v Casamino acid stock solution and filter-sterilized (.22&nbsp;µm PES). To make agar chips, we can add 1&nbsp;mL to the hot agar mixture, together with the three 500&nbsp;µL 100x stocks for the HM.<br />
<br />
We made 250&nbsp;mL of HM+C+Glucose+Supplements plates with 1.5&nbsp;% agar.<br />
<br />
Then we plated the following combinations:<br />
<br />
<center><br />
{| class="wikitable"<br />
|-<br />
! Construct !! HM+C+Glucose+Supplements !! LB+C<br />
|-<br />
| K1319042 || - || +<br />
|-<br />
| J23101.E0240 || + || +<br />
|}<br />
</center><br />
<br />
We also prepared a 150&nbsp;mL HM+C+Glucose+Supplements culture with K1319042 to hopefully make agar chips on Friday, July 25th.<br />
<br />
Six of last weeks J23115.E0240 clones were plated on LB+C, and 5&nbsp;mL LB+C precultures were inoculated for plasmid preparation.<br />
<br />
== 25th ==<br />
The K1319042 strain did not grow on the HM plate, while another strain with the J23101.E0240 construct did. Both have the pSB1C3 backbone. To confirm the plasmids and inserts, we set up a colony PCR:<br />
<br />
<center><br />
{| class="wikitable"<br />
|-<br />
! ID !! Template !! Product Length !! Result<br />
|-<br />
| 1 || J23101.E0240 #5 || 1233 ||<br />
|-<br />
| 2 || J23101.E0240 #6 || 1233 ||<br />
|-<br />
| 3 || J23101.E0240 #5 plasmid || 1233 ||<br />
|-<br />
| 4 || K1319042 LB colony || 2053 ||<br />
|-<br />
| 5 || K1319042 plasmid || 2053 ||<br />
|-<br />
| 6 || K731520 GFP plasmid || 2437 ||<br />
|-<br />
| 7 || water || none ||<br />
|}<br />
</center><br />
<br />
Reaction volume per tube was 15&nbsp;µL. GoTaq Green Mastermix and the VF2 and VR primers were used. You can find the durations and temperatures the table below:<br />
<br />
<center><br />
{| class="wikitable"<br />
! parameter !! duration !! temp [°C]<br />
|-<br />
| denature || 10:00 || 95<br />
|-<br />
| '''denature''' || 00:30 || 95<br />
|-<br />
| '''anneal''' || 00:30 || 49<br />
|-<br />
| '''elongate''' || 02:36 || 72<br />
|-<br />
| elongate || 05:00 || 72<br />
|-<br />
| store || forever|| 8<br />
|}<br />
</center><br />
<br />
We mini-prepped the 6 overnight cultures of J23115.E0240 clones. He used 3&nbsp;mL instead of 1.5&nbsp;mL culture medium and eluted twice with 25&nbsp;µL nuclease-free water. Everything else was according to the protocol of the [http://www.gelifesciences.com/webapp/wcs/stores/servlet/productById/de/GELifeSciences/28904269 illustra plasmidPrep Mini-Spin Kit].<br />
<br />
The resulting DNA concentrations are listed in this table:<br />
<br />
<center><br />
{| class="wikitable"<br />
! clone # !! concentration [ng/µl]<br />
|-<br />
| 1 || 73.5<br />
|-<br />
| 2 || 94.5<br />
|-<br />
| 3 || 100.5<br />
|-<br />
| 4 || 53<br />
|-<br />
| 5 || 82<br />
|-<br />
| 6 || 138<br />
|}<br />
</center><br />
<br />
In the evening, we plated some strains on the different media to investigate why the K3139042 did not grow on the HM+suppl. plate. (Note: In the morning, we re-inoculated the HM+C+suppl. shake flask with cells from the LB-plate and by afternoon the culture ''did'' grow to a high cell density.)<br />
<br />
<center><br />
{| class="wikitable"<br />
! Construct !! Host strain !! LB+C !! HM+C+Glucose !! HM+C+Glucose+supplements<br />
|-<br />
| J23101.E0240 || NEB10β || ++ || - || ++<br />
|-<br />
| K1319042 || DH5alpha || ++ || - || (+)<br />
|-<br />
| K131026 || NEB10β || ++ || - || -<br />
|-<br />
| K131026 || DH5alpha || ++ || - || +<br />
|}<br />
</center><br />
<br />
We inoculated J23101.E0240 in LB and HM+C+Glucose+supplements.<br />
<br />
<!-- == 28th ==<br />
IMPORTANT: Look for customs documents and write ZHV lady!!!! --><br />
<br />
== 29th ==<br />
* inoculate 2x 150&nbsp;ml cultures HM+Glucose+C<br />
* prepared 200&nbsp;ml 1.5&nbsp;% agar<br />
* pre-cool centrifuge<br />
* centrifuge 1x 50, 1x 100 and 1x 150&nbsp;ml<br />
* make 3 kinds of chips - OOx1, ODx2, ODx3<br />
* pre cultures of K1319042 and K131026 in LB<br />
<br />
== 30th ==<br />
* made chips with K1319042 and K131026 in HM medium images were taken every 30 min with the Geldoc<br />
* print chips on LB and LB + Cam , count 2-10 colonies<br />
<br />
== 31th ==<br />
* transformation of K1319042 and K131026 in DH5α, BL21 and NEB<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/JulyTeam:Aachen/Notebook/Wetlab/July2014-10-17T09:04:04Z<p>VeraA: /* 21st */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= July =<br />
== 1st ==<br />
* transformation efficiency kit is broken<br />
&rarr; run an agarose gel with the kit plasmids to check for nuclease activity/ bands<br />
* inventory of the -80°C freezer was done<br />
<br />
== 2nd ==<br />
* overnight cultures (LB) of K731520 and K1319042 for chips were inoculated<br />
<br />
== 3rd ==<br />
* ODs of the overnight culture of <br />
** K731520: 2.3 <br />
** K1319042: 2.5<br />
* made chips with K1319042 and K731520 in NA and M9 medium. Images were taken every 30 min with the GelDoc<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-07-03_M9_iLOV_serie.png|title=Sensor Chips with K1319042 in M9 first try|subtitle=Sensor chips with K1319042 in M9 medium with 1,5&nbsp;% agar. A) befor induction with IPTG B) 1&nbsp;h after induction C) 4.5&nbsp;h after induction a) induced with 2x&nbsp;2&nbsp;µl 1&nbsp;mM IPTG b) induced with 2x&nbsp;2&nbsp;µl 10&nbsp;mM IPTG c) induced with 2x&nbsp;2&nbsp;µl 0.1&nbsp;mM IPTG d) induced with 2x&nbsp;2&nbsp;µl 100&nbsp;mM IPTG|width=900px}}<br />
</center><br />
* print K1319042 Chip on LB plate<br />
* overnight culture of E0030 for plasmid prep<br />
<br />
== 4th ==<br />
* plasmid prep of E0030: 159.5 ng/µl (concentration)<br />
* print of K1319042 Chip on LB plate made 1 and 7 colonies<br />
<br />
== 7th ==<br />
* 13 Biobricks were transformed<br />
* overnight culture of K103006 for a plasmid prep was inoculated<br />
* colony PCR master mix was prepared<br />
<br />
== 8th ==<br />
* overnight culture of K1319042 for chips was inoculated<br />
<br />
== 9th ==<br />
* made chips with K1319042 in M9, M9 + casamino acids, Hartman medium (HM). Images were taken every 30 min with the Geldoc<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-07-09_M9_iLOV_serie.png|title=Sensor Chips with K1319042 in M9 second try|subtitle=Sensor chips with K1319042 in M9 medium with 1,5&nbsp;% agar. A) befor induction with IPTG B) 1.5&nbsp;h after induction C) 3&nbsp;h after induction a) induced with 2x&nbsp;2&nbsp;µl 1&nbsp;mM IPTG b) induced with 2x&nbsp;2&nbsp;µl 10&nbsp;mM IPTG c) induced with 2x&nbsp;2&nbsp;µl 0.1&nbsp;mM IPTG d) induced with 2x&nbsp;2&nbsp;µl 100&nbsp;mM IPTG|width=900px}}<br />
</center><br />
* made OmpA-linker_iLOV 3A-Assambley<br />
* colony PCR<br />
* transformation for backbones<br />
<br />
== 10th ==<br />
* master plates of the strains for backbone isolation<br />
<br />
== 14th ==<br />
* built again J23115.E0240 for interlab study<br />
<br />
== 15th ==<br />
* made 500&nbsp;ml LB and LB plates<br />
* made the transformation of J23115.E0240<br />
* overnight culture of K1319042 for chips<br />
<br />
== 16th ==<br />
* did plasmid preps<br />
* transformation of different reporter strains<br />
** NEB <br />
***pSEVE641_BsFbFP<br />
***pSEVA234_LasR<br />
***pSEVE641_BsFbFP pSEVA234_LasR<br />
***pSEVE641_BsFbFP pSB1C3_C0179<br />
**BL21<br />
***pSEVE641_BsFbFP pSEVA234_LasR<br />
***pSEVE641_BsFbFP pSB1C3_C0179<br />
* made chips with K1319042 in Hartman, Hartman + 20&nbsp;% glycerol, M9 medium images were taken every 30 min with the Geldoc<br />
* The PCR of Biobrick E0030 in vector pSB1C3 with primers for RFC 25 was made. The expected length is <br />
** forward primer EYFP_RFC25_F: ACGTTGAATTCGCGGCCGCTTCTAGATGGCCGGCGTGAGCAAGGGCGAGGAG<br />
** rewerse primer EYFP_RFC25_R: ATCCTGCAGCGGCCGCTACTAGTATTAACCGGTGTACAGCTCGTCCATGC<br />
* PCR product gets number K1319000 <br />
<br />
<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
|-<br />
| denature || 94 || 60"<br />
|-<br />
| denature || 94 || 30"<br />
|-<br />
| anneal || 50/60,4/64,9 || 30"<br />
|-<br />
| elongate || 72 || 60"<br />
|-<br />
| elongate || 72 || 5'<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
<br />
The agarose gel with PCR product was made.Expected length is 778 kb.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-09-17_E0030_with_RFC25.png|title=Agarose gel with PCR products after PCR from E0030 to K1319000 |width=400px}}<br />
</center><br />
as it can be seen on the picture PCR worked with all annealing temperatures, all samples were used for a transformation in DH5α.<br />
<br />
== 17th ==<br />
* the PCR product was purificated and the concentration was measured.<br />
* Restriktion of PCR product for the insert and E0030 for the vector with ''Eco''RI and PstI with following purification from agarose gel was made.<br />
<br />
== 21st ==<br />
* the ligation of PCR product (K1319000) and the vector that was purified from agarose (from E0030) was made.<br />
* ligated product was tranformed in DH5α.<br />
<br />
== 22nd ==<br />
* made 100x stocks for Hartmans minimal medium.<br />
* made about 25 HM+C plates without glucose.<br />
* K1319042 was plated on a HM+C plate<br />
<br />
== 23rd ==<br />
* made 25 new HM+C plates with 1&nbsp;% agar and 4&nbsp;g/L glucose<br />
* added 170&nbsp;µL of the glucose stock (500&nbsp;g/L) to the glucose-free HM+C-plates<br />
* 1&nbsp;L of sterile HM+glucose was prepared<br />
* K1319042 was plated on HM+C+Glucose and HM+C+Glucose drops, 3x 5&nbsp;mL HM+C+Glucose precultures were inoculated (17:00)<br />
<br />
== 24th ==<br />
* K1319042 did not grow, neither on the plates, nor on in the liquid media. The most probable cause is that the ''E.&nbsp;coli'' is missing some vitamins<br />
* Based on the [http://openwetware.org/wiki/M9_medium/supplemented M9 recipes by the Knight and Endy labs on OpenWetWare], we made a 20&nbsp;mL supplement stock solution that can be added to 1x HM media<br />
<br />
<center><br />
{| class="wikitable"<br />
|-<br />
! Component !! supplement for 1x HM [g/L] !! final 1x concentration<br />
|-<br />
| Casamino acids || 2 || 2 g/L<br />
|-<br />
| Thiamine hydrochloride || 0.3 || 300 mg/L<br />
|-<br />
| MgSO{{sub|4}}/MgSO{{sub|4}}*7H{{sub|2}}O || 0.242 / 0.494 || 2 mmol/L<br />
|-<br />
| CaCl{{sub|2}} || 0.011 || 0.1 mmol/L<br />
|}<br />
</center><br />
<br />
The powders for 1&nbsp;L of 1x HM were dissolved in 20&nbsp;mL of a 10&nbsp;%&nbsp;w/v Casamino acid stock solution and filter-sterilized (.22&nbsp;µm PES). To make agar chips, we can add 1&nbsp;mL to the hot agar mixture, together with the three 500&nbsp;µL 100x stocks for the HM.<br />
<br />
We made 250&nbsp;mL of HM+C+Glucose+Supplements plates with 1.5&nbsp;% agar.<br />
<br />
Then we plated the following combinations:<br />
<br />
<center><br />
{| class="wikitable"<br />
|-<br />
! Construct !! HM+C+Glucose+Supplements !! LB+C<br />
|-<br />
| K1319042 || - || +<br />
|-<br />
| J23101.E0240 || + || +<br />
|}<br />
</center><br />
<br />
We also prepared a 150&nbsp;mL HM+C+Glucose+Supplements culture with K1319042 to hopefully make agar chips on Friday, July 25th.<br />
<br />
Six of last weeks J23115.E0240 clones were plated on LB+C, and 5&nbsp;mL LB+C precultures were inoculated for plasmid preparation.<br />
<br />
== 25th ==<br />
The K1319042 strain did not grow on the HM plate, while another strain with the J23101.E0240 construct did. Both have the pSB1C3 backbone. To confirm the plasmids and inserts, we set up a colony PCR:<br />
<br />
<center><br />
{| class="wikitable"<br />
|-<br />
! ID !! Template !! Product Length !! Result<br />
|-<br />
| 1 || J23101.E0240 #5 || 1233 ||<br />
|-<br />
| 2 || J23101.E0240 #6 || 1233 ||<br />
|-<br />
| 3 || J23101.E0240 #5 plasmid || 1233 ||<br />
|-<br />
| 4 || K1319042 LB colony || 2053 ||<br />
|-<br />
| 5 || K1319042 plasmid || 2053 ||<br />
|-<br />
| 6 || K731520 GFP plasmid || 2437 ||<br />
|-<br />
| 7 || water || none ||<br />
|}<br />
</center><br />
<br />
Reaction volume per tube was 15&nbsp;µL. GoTaq Green Mastermix and the VF2 and VR primers were used. You can find the durations and temperatures the table below:<br />
<br />
<center><br />
{| class="wikitable"<br />
! parameter !! duration !! temp [°C]<br />
|-<br />
| denature || 10:00 || 95<br />
|-<br />
| '''denature''' || 00:30 || 95<br />
|-<br />
| '''anneal''' || 00:30 || 49<br />
|-<br />
| '''elongate''' || 02:36 || 72<br />
|-<br />
| elongate || 05:00 || 72<br />
|-<br />
| store || forever|| 8<br />
|}<br />
</center><br />
<br />
We mini-prepped the 6 overnight cultures of J23115.E0240 clones. He used 3&nbsp;mL instead of 1.5&nbsp;mL culture medium and eluted twice with 25&nbsp;µL nuclease-free water. Everything else was according to the protocol of the [http://www.gelifesciences.com/webapp/wcs/stores/servlet/productById/de/GELifeSciences/28904269 illustra plasmidPrep Mini-Spin Kit].<br />
<br />
The resulting DNA concentrations are listed in this table:<br />
<br />
<center><br />
{| class="wikitable"<br />
! clone # !! concentration [ng/µl]<br />
|-<br />
| 1 || 73.5<br />
|-<br />
| 2 || 94.5<br />
|-<br />
| 3 || 100.5<br />
|-<br />
| 4 || 53<br />
|-<br />
| 5 || 82<br />
|-<br />
| 6 || 138<br />
|}<br />
</center><br />
<br />
In the evening, we plated some strains on the different media to investigate why the K3139042 did not grow on the HM+suppl. plate. (Note: In the morning, we re-inoculated the HM+C+suppl. shake flask with cells from the LB-plate and by afternoon the culture ''did'' grow to a high cell density.)<br />
<br />
<center><br />
{| class="wikitable"<br />
! Construct !! Host strain !! LB+C !! HM+C+Glucose !! HM+C+Glucose+supplements<br />
|-<br />
| J23101.E0240 || NEB10β || ++ || - || ++<br />
|-<br />
| K1319042 || DH5alpha || ++ || - || (+)<br />
|-<br />
| K131026 || NEB10β || ++ || - || -<br />
|-<br />
| K131026 || DH5alpha || ++ || - || +<br />
|}<br />
</center><br />
<br />
We inoculated J23101.E0240 in LB and HM+C+Glucose+supplements.<br />
<br />
<!-- == 28th ==<br />
IMPORTANT: Look for customs documents and write ZHV lady!!!! --><br />
<br />
== 29th ==<br />
* inoculate 2x 150&nbsp;ml cultures HM+Glucose+C<br />
* prepared 200&nbsp;ml 1.5&nbsp;% agar<br />
* pre-cool centrifuge<br />
* centrifuge 1x 50, 1x 100 and 1x 150&nbsp;ml<br />
* make 3 kinds of chips - OOx1, ODx2, ODx3<br />
* pre cultures of K1319042 and K131026 in LB<br />
<br />
== 30th ==<br />
* made chips with K1319042 and K131026 in HM medium images were taken every 30 min with the Geldoc<br />
* print chips on LB and LB + Cam , count 2-10 colonies<br />
<br />
== 31th ==<br />
* transformation of K1319042 and K131026 in DH5α, BL21 and NEB<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/AugustTeam:Aachen/Notebook/Wetlab/August2014-10-17T09:00:52Z<p>VeraA: /* 5th */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= August =<br />
== 1st ==<br />
* made electrocompetent ''E.coli'' rosetta cells.<br />
* prepared cultures of K1319042 and K131026<br />
<br />
== 2nd ==<br />
* tested the OD measurement device and compared it to the spectrophotometer and the plate reader. <br />
* tested K131026 and K1319042 for fluorescence in the plate reader<br />
* did a heat shock transformation of I746909 into NEB TOP 10 cells<br />
* did an electroshock transformation of pET17-Gal3 into ''E.coli'' rosetta<br />
<br />
== 3rd ==<br />
* OD measurements of the iGEM device in comparison to the spectrophotometer were taken. <br />
* cryo cultures of K131026 and K1319042 were prepared<br />
* master plates of Gal3 #1-#10 and I746909 #1-#4 and overnight cultures<br />
<br />
== 4th ==<br />
* made cryo stocks of K1319042 and K131026 in NEB/BL21/DH5alpha, I746909 in BL21 and pET17-His-SNAP-YFP-Gal3 in ''E.&nbsp;coli'' rosetta (DE3), respectively.<br />
* made plasmid prep, most of them using 1.5&nbsp;mL culture medium, and eluted with 1x 50&nbsp;µL of ddH{{sub|2}}O. The resulting DNA concentrations are shown below.<br />
<br />
<center><br />
{| class="wikitable"<br />
! combination !! concentration [ng/µl]<br />
|-<br />
| I746909 BL21 #1 || 73.5<br />
|-<br />
| I746909 BL21 #2 || 45<br />
|-<br />
| I746909 BL21 #3 || 49<br />
|-<br />
| K1319042 DH5alpha || 60<br />
|-<br />
| K131026 DH5alpha || 150<br />
|-<br />
| pET17-Gal3 #1 || 30.5<br />
|-<br />
| pET17-Gal3 #2 || 6.4<br />
|-<br />
| pET17-Gal3 #3 || 6.3<br />
|-<br />
| pET17-Gal3 #4 || 9.4<br />
|-<br />
| pET17-Gal3 #5 || 10.1<br />
|-<br />
| pET17-Gal3 #6 || 8.2<br />
|-<br />
| pET17-Gal3 #7 || 13.8<br />
|-<br />
| pET17-Gal3 #8 || 6.9<br />
|-<br />
| pET17-Gal3 #9 || 10.2<br />
|}<br />
</center><br />
<br />
To confirm the quality of pET17-Gal3 transformations, the purified plasmids were tested by carrying out a digest. Results are shown in the below picture and table.<br />
<br />
<center><br />
{{Team:Aachen/Figure|14-08-04_Test-Digest.png|title=Test digest|subtitle=clones were test-digested|width=400px}}<br />
<br />
{| class="wikitable"<br />
! combination !! cut products[bp]<br />
|-<br />
| I746909 BL21 #1 || 2029, 947<br />
|-<br />
| K1319042 DH5alpha || 2029, 1780<br />
|-<br />
| K131026 DH5alpha || 2029, 1848<br />
|-<br />
| pET17-Gal3 #1 || 3086, 923, 1262<br />
|}<br />
</center><br />
<br />
All pET17-Gal3 clones were positive and clone #1 was selected for further experiments.<br />
* prepared an over night cultur of K1319042 for chips<br />
<br />
== 5th ==<br />
* assembly of a V{{sub|R}}=2.5&nbsp;L bioreactor for cultivation of a 1&nbsp;L expression culture.<br />
* Two precultures of 20&nbsp;mL LB+A were inoculated at 19:00<br />
* transformation of K746909 into BL21 cells and K1319000 into NEB10β cells.<br />
* made Chips with K1319042 in HM. Images were taken every 30 min with the Geldoc<br />
* made alliquots of HM, 1&nbsp;L HM + glucose + supplements and 500&nbsp;ml LB<br />
<br />
* The Quickchange mutagenesis PCR with a tamplate K1319000 and following primers was made. The PCR was made in two steps. The first step is PCR with both primers separatly and the second step includes PCR with two PCR products mixed with each other.<br />
** forward primer EYFPtoREACh1_F: AGTACAACTGGAACAGCCACAACGTCTATATC<br />
** rewerse primer EYFPtoREACh1_R: GTTGTGGCTGTTCCAGTTGTACTCCAGCTTG<br />
** forward primer EYFPtoREACh2_F: AGTACAACTGGAACAGCCGCAACGTCTATATCATG<br />
** rewerse primer EYFPtoREACh2_R: ATAGACGTTGCGGCTGTTCCAGTTGTACTCCAGCTTG<br />
<br />
'''1. Step''' with 3 cycles<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| anneal || 55 || 30"<br />
|-<br />
| elongate || 72 || 30"<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
'''2. Step''' with 14 cycles<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| anneal || 55 || 60"<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-07-5_PCR_toREACh1%262.png|title=Agarose gel with PCR products after Quichchange from K1319000 to K1319001 and K1319002 |width=400px}}<br />
</center><br />
<br />
* REACh1 gets number K1319001 and REACh2 gets number K1319002.<br />
<br />
* PCR product was restricted with DpnI 20&nbsp;min at 37&nbsp;°C to destroy the methylated template. Then DpnI was deaktevated at 80&nbsp;°C during 20&nbsp;min.<br />
* PCR product was purifired and transformated in DH5α.<br />
<br />
== 6th ==<br />
* transformation of J04450 in pSB1K3 and pSB1A3 in NEB10β cells.<br />
* They also did a plasmid prep of J04450 in pSB1C3 and Flo's vectors.<br />
* made precultures of NEB10βand DH5 alpha cells<br />
* inoculation of the fermenter at 11:40, and induced the fermentation of pET17-Gal3. The fermentation is expected to run 24&nbsp;h.<br />
* as the first Quickchange PCR for REACh2 was not sucsessful, it was reapeted as a gradient PCR with annealing temperatire 55&nbsp;°C, 57&nbsp;°C and 60&nbsp;°C. Then the agarose gel with PCR product samples was made.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-08-06_to_REACh2.png|title=Agarose gel with PCR products after Quickchange from K1319000 to K1319002 |width=400px}}<br />
</center><br />
<br />
== 7th ==<br />
* made media for ''Pseudomonas flourescens''<br />
** Nutrient Broth<br />
** Pseudomonas-F<br />
** Pseudomonas-P<br />
* made 2&nbsp;L LB<br />
<br />
== 8th ==<br />
* prepared 2x 60&nbsp;ml (LB + cam + IPTG) with K1319042<br />
* prepared 5&nbsp;ml K131026 and C0179<br />
* made SDS page<br />
<br />
== 9th ==<br />
* made a plate reader experiment with K131026 in LB and LB + HM<br />
<br />
== 11th ==<br />
* plated on LB + antibiotics<br />
** K131026<br />
** I746909<br />
** K13190042<br />
** I04450 in pSB1C3<br />
** I04450 in pSB1A3<br />
** I04450 in pSB1K3<br />
** pSEVA construct (pSEVA 641_FP pSEVA 234-LasR)<br />
<br />
== 13th ==<br />
* Agarose chips were prepared:<br />
** ''E. coli'' DH5α K131026 and I746909 in LB and HM<br />
** K1319042 and the pSEVA two plasmid construct in HM<br />
* Images were taken every 30 min with the Geldoc<br />
<br />
==15th ==<br />
* A bioreactor containing 1&nbsp;L Medium was inoculated with pET17-His-SNAP-YFP-Gal3.<br />
<br />
== 16th ==<br />
* The above mentioned Bioreactor was stopped after 20&nbsp;h and all cells were lysed.<br />
<br />
== 18th ==<br />
* Overnight cultures of I746909 and K131026 in LB, TB, 2x HM+ were made<br />
* 3x J23101.E0240 was plated<br />
* pET17-His-SNAP-YFP-Gal3 was purified with Äkta via a histidine-tagged protein purification.<br />
<br />
== 19th ==<br />
* Chips with K131026 and I746909 in HM were made. Images were taken every 30 min with the Geldoc<br />
* A PCR of J23101.E0240, K1319000, K1319001, K1319002 was run and the product was separated on a 1,2&nbsp;% agarose gel<br />
* A SDS gel with samples of protein purification of pET17-His-SNAP-YFP-Gal3 was made to check if the purifired samples contain the target protein - YFP-Gal3. The purification or the gel resulted in two samples with a yellow color. For the SDS we also used the two samples before and the two samples after ones with the yellow color, 6&nbsp;mL. <br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-08-18_Gal3_purification_iVA.png|title=YFP-Gal3 protein purification|subtitle=|width=400px}}<br />
</center><br />
<br />
* Two samples with YFP-Gal3 were concentrated till 1&nbsp;mL <br />
* The concentration of YFP-Gal3 was calculated on Tecan. Calculation showed concentration 13,42&nbsp;mg/ml<br />
<br />
== 20th ==<br />
* repeat PCR for REACh1 and J23101.E0240 and run a gel<br />
* plasmid prep of pSEVA BfsB, pSEVA lasR and I746909<br />
<br />
== 24th ==<br />
* made 2.5&nbsp;L LB<br />
* made chips of K131026 in NEB , DH5α and BL21 in LB and additionally K131026 in DH5α in HM+. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_24_08_2014_K131026_bl21_serie.png|title=Sensor Chips with K131026 in BL21 in LB taken with first prototyp of our own device|subtitle=Sensor chips with K131026 in BL21 in LB medium with 1,5&nbsp;% agar, lower chip induced. A) befor induction with 2&nbsp;µl of 5000&nbsp;µg/ml HSL (3-oxo-C12) B) 0.5&nbsp;h after induction C) 1&nbsp;h after induction D) 1.5&nbsp;h after induction E) 2&nbsp;h after induction F) 2.5&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
== 25th ==<br />
* did a plasmid restriction of I20260 (EcoRI,PstI), J23115 (EcoRI, SpeI), K516032 (XbaI,PstI), and J23101 (EcoRI, SpeI)<br />
* tested the growth of ''Pseudomonas fluorescens'' in different liquid media for high OD and strong fluorescence. She tested Standard I medium, Cetrimide medium and Pseudomonas-F medium, and Pseudomonas-F medium supplemented with 300&nbsp;µL Fe3+ in 500&nbsp;mL flasks with a filling volume of 30&nbsp;mL. The flasks were inoculated with ''P. fluorescens'' cells on Standard I agar, and incubated at 30&nbsp;°C at 250&nbsp;rpm.<br />
* prepared over night cultures of K131026 in DH5α and NEB for chips<br />
* prepared 2x 5&nbsp;ml of pSB1C3, psB3K3 and pSB1A2 for plasmid prep<br />
<br />
== 26th ==<br />
* ligation of J23115 and K516032 to J23115.K516032, and J23101 and K516032 to J23101.K516032, respectively.<br />
* plasmid prep of I20260, K516032 and B0034<br />
* restriction of plasmids I20260, K516032, B0034 with EcoRI and PstI<br />
* gel with restricted the I20260, K516032 and B0034 was run<br />
* purification of vector backbones pSB1A2, pSB3K3 and pSB1C3<br />
* restriciton of synthesized TEV protease with EcoRI and PstI<br />
* qualitatively tested the ''Pseudomonas fluorescens'' that had grown over night for OD and fluorescence. She determined that Pseudomonas-F medium is the most adequate for the cultivation of the strain we use, since both OD and fluorescence were best in the flask containing the respective medium. Growth in the Pseudomonas-F medium supplemented with 300&nbsp;µg/L Fe3+ was weaker, however, fluorescence was also successfully suppressed.<br />
* made chips with K131026 in DH5α and NEB, in LB and LB + 10&nbsp;% glycerol. Images were taken with our own device every 10 min (illumination problems).<br />
<center><br />
{{Team:Aachen/Figure|Aachen_26_08_2014_K131026_neb_serie.png|title=Sensor Chips with K131026 in NEB in LB taken with first prototyp of our own device|subtitle=Sensor chips with K131026 in NEB in LB medium with 1,5&nbsp;% agar. Chip on the top induced with 0.5&nbsp;µl of 500&nbsp;µg/ml HSL and on the bottom with less than 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12). A) befor induction B) 1&nbsp;h after induction C) 1.5&nbsp;h after induction D) 2&nbsp;h after induction |width=600px}}<br />
</center><br />
* plasmid prep of the back bones, restriction and gel purification<br />
<br />
== 27th ==<br />
* transformation of some BioBricks<br />
* ligation of J23101.K516032 into pSB3K3 and J23115.K516032 into pSB3K3 and K1319004 into pSB1C3<br />
* transformation of K1319004 into pUC and pSB1C3, and J04450 into pSB1K3 and pSB1A3, respectively<br />
<br />
== 28th ==<br />
* transformation of some BioBricks<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/AugustTeam:Aachen/Notebook/Wetlab/August2014-10-17T08:57:58Z<p>VeraA: /* 5th */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= August =<br />
== 1st ==<br />
* made electrocompetent ''E.coli'' rosetta cells.<br />
* prepared cultures of K1319042 and K131026<br />
<br />
== 2nd ==<br />
* tested the OD measurement device and compared it to the spectrophotometer and the plate reader. <br />
* tested K131026 and K1319042 for fluorescence in the plate reader<br />
* did a heat shock transformation of I746909 into NEB TOP 10 cells<br />
* did an electroshock transformation of pET17-Gal3 into ''E.coli'' rosetta<br />
<br />
== 3rd ==<br />
* OD measurements of the iGEM device in comparison to the spectrophotometer were taken. <br />
* cryo cultures of K131026 and K1319042 were prepared<br />
* master plates of Gal3 #1-#10 and I746909 #1-#4 and overnight cultures<br />
<br />
== 4th ==<br />
* made cryo stocks of K1319042 and K131026 in NEB/BL21/DH5alpha, I746909 in BL21 and pET17-His-SNAP-YFP-Gal3 in ''E.&nbsp;coli'' rosetta (DE3), respectively.<br />
* made plasmid prep, most of them using 1.5&nbsp;mL culture medium, and eluted with 1x 50&nbsp;µL of ddH{{sub|2}}O. The resulting DNA concentrations are shown below.<br />
<br />
<center><br />
{| class="wikitable"<br />
! combination !! concentration [ng/µl]<br />
|-<br />
| I746909 BL21 #1 || 73.5<br />
|-<br />
| I746909 BL21 #2 || 45<br />
|-<br />
| I746909 BL21 #3 || 49<br />
|-<br />
| K1319042 DH5alpha || 60<br />
|-<br />
| K131026 DH5alpha || 150<br />
|-<br />
| pET17-Gal3 #1 || 30.5<br />
|-<br />
| pET17-Gal3 #2 || 6.4<br />
|-<br />
| pET17-Gal3 #3 || 6.3<br />
|-<br />
| pET17-Gal3 #4 || 9.4<br />
|-<br />
| pET17-Gal3 #5 || 10.1<br />
|-<br />
| pET17-Gal3 #6 || 8.2<br />
|-<br />
| pET17-Gal3 #7 || 13.8<br />
|-<br />
| pET17-Gal3 #8 || 6.9<br />
|-<br />
| pET17-Gal3 #9 || 10.2<br />
|}<br />
</center><br />
<br />
To confirm the quality of pET17-Gal3 transformations, the purified plasmids were tested by carrying out a digest. Results are shown in the below picture and table.<br />
<br />
<center><br />
{{Team:Aachen/Figure|14-08-04_Test-Digest.png|title=Test digest|subtitle=clones were test-digested|width=400px}}<br />
<br />
{| class="wikitable"<br />
! combination !! cut products[bp]<br />
|-<br />
| I746909 BL21 #1 || 2029, 947<br />
|-<br />
| K1319042 DH5alpha || 2029, 1780<br />
|-<br />
| K131026 DH5alpha || 2029, 1848<br />
|-<br />
| pET17-Gal3 #1 || 3086, 923, 1262<br />
|}<br />
</center><br />
<br />
All pET17-Gal3 clones were positive and clone #1 was selected for further experiments.<br />
* prepared an over night cultur of K1319042 for chips<br />
<br />
== 5th ==<br />
* assembly of a V{{sub|R}}=2.5&nbsp;L bioreactor for cultivation of a 1&nbsp;L expression culture.<br />
* Two precultures of 20&nbsp;mL LB+A were inoculated at 19:00<br />
* transformation of K746909 into BL21 cells and K1319000 into NEB10β cells.<br />
* made Chips with K1319042 in HM. Images were taken every 30 min with the Geldoc<br />
* made alliquots of HM, 1&nbsp;L HM + glucose + supplements and 500&nbsp;ml LB<br />
<br />
* The Quickchange mutagenesis PCR with a tamplate K1319000 and following primers was made. The PCR was made in two steps. The first step is PCR with both primers separatly and the second step includes PCR with two PCR products mixed with each other.<br />
** forward primer EYFPtoREACh1_F: AGTACAACTGGAACAGCCACAACGTCTATATC<br />
** rewerse primer EYFPtoREACh1_R: GTTGTGGCTGTTCCAGTTGTACTCCAGCTTG<br />
** forward primer EYFPtoREACh2_F: AGTACAACTGGAACAGCCGCAACGTCTATATCATG<br />
** rewerse primer EYFPtoREACh2_R: ATAGACGTTGCGGCTGTTCCAGTTGTACTCCAGCTTG<br />
<br />
'''1. Step''' with 3 cycles<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| anneal || 55 || 30"<br />
|-<br />
| elongate || 72 || 30"<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
'''2. Step''' with 14 cycles<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| anneal || 55 || 60"<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
<br />
* After PCR 5&nbsp;µL of each sample of PCR product were used for agarose gel, the rest was restricted with DpnI 20&nbsp;min at 37&nbsp;°C. Then DpnI was deaktevated at 80&nbsp;°C during 20&nbsp;min.<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-07-5_PCR_toREACh1%262.png|title=Agarose gel with PCR products after Quichchange from K1319000 to K1319001 and K1319002 |width=400px}}<br />
</center><br />
<br />
* REACh1 gets number K1319001 and REACh2 gets number K1319002.<br />
<br />
== 6th ==<br />
* transformation of J04450 in pSB1K3 and pSB1A3 in NEB10β cells.<br />
* They also did a plasmid prep of J04450 in pSB1C3 and Flo's vectors.<br />
* made precultures of NEB10βand DH5 alpha cells<br />
* inoculation of the fermenter at 11:40, and induced the fermentation of pET17-Gal3. The fermentation is expected to run 24&nbsp;h.<br />
* as the first Quickchange PCR for REACh2 was not sucsessful, it was reapeted as a gradient PCR with annealing temperatire 55&nbsp;°C, 57&nbsp;°C and 60&nbsp;°C. Then the agarose gel with PCR product samples was made.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-08-06_to_REACh2.png|title=Agarose gel with PCR products after Quickchange from K1319000 to K1319002 |width=400px}}<br />
</center><br />
<br />
== 7th ==<br />
* made media for ''Pseudomonas flourescens''<br />
** Nutrient Broth<br />
** Pseudomonas-F<br />
** Pseudomonas-P<br />
* made 2&nbsp;L LB<br />
<br />
== 8th ==<br />
* prepared 2x 60&nbsp;ml (LB + cam + IPTG) with K1319042<br />
* prepared 5&nbsp;ml K131026 and C0179<br />
* made SDS page<br />
<br />
== 9th ==<br />
* made a plate reader experiment with K131026 in LB and LB + HM<br />
<br />
== 11th ==<br />
* plated on LB + antibiotics<br />
** K131026<br />
** I746909<br />
** K13190042<br />
** I04450 in pSB1C3<br />
** I04450 in pSB1A3<br />
** I04450 in pSB1K3<br />
** pSEVA construct (pSEVA 641_FP pSEVA 234-LasR)<br />
<br />
== 13th ==<br />
* Agarose chips were prepared:<br />
** ''E. coli'' DH5α K131026 and I746909 in LB and HM<br />
** K1319042 and the pSEVA two plasmid construct in HM<br />
* Images were taken every 30 min with the Geldoc<br />
<br />
==15th ==<br />
* A bioreactor containing 1&nbsp;L Medium was inoculated with pET17-His-SNAP-YFP-Gal3.<br />
<br />
== 16th ==<br />
* The above mentioned Bioreactor was stopped after 20&nbsp;h and all cells were lysed.<br />
<br />
== 18th ==<br />
* Overnight cultures of I746909 and K131026 in LB, TB, 2x HM+ were made<br />
* 3x J23101.E0240 was plated<br />
* pET17-His-SNAP-YFP-Gal3 was purified with Äkta via a histidine-tagged protein purification.<br />
<br />
== 19th ==<br />
* Chips with K131026 and I746909 in HM were made. Images were taken every 30 min with the Geldoc<br />
* A PCR of J23101.E0240, K1319000, K1319001, K1319002 was run and the product was separated on a 1,2&nbsp;% agarose gel<br />
* A SDS gel with samples of protein purification of pET17-His-SNAP-YFP-Gal3 was made to check if the purifired samples contain the target protein - YFP-Gal3. The purification or the gel resulted in two samples with a yellow color. For the SDS we also used the two samples before and the two samples after ones with the yellow color, 6&nbsp;mL. <br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-08-18_Gal3_purification_iVA.png|title=YFP-Gal3 protein purification|subtitle=|width=400px}}<br />
</center><br />
<br />
* Two samples with YFP-Gal3 were concentrated till 1&nbsp;mL <br />
* The concentration of YFP-Gal3 was calculated on Tecan. Calculation showed concentration 13,42&nbsp;mg/ml<br />
<br />
== 20th ==<br />
* repeat PCR for REACh1 and J23101.E0240 and run a gel<br />
* plasmid prep of pSEVA BfsB, pSEVA lasR and I746909<br />
<br />
== 24th ==<br />
* made 2.5&nbsp;L LB<br />
* made chips of K131026 in NEB , DH5α and BL21 in LB and additionally K131026 in DH5α in HM+. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_24_08_2014_K131026_bl21_serie.png|title=Sensor Chips with K131026 in BL21 in LB taken with first prototyp of our own device|subtitle=Sensor chips with K131026 in BL21 in LB medium with 1,5&nbsp;% agar, lower chip induced. A) befor induction with 2&nbsp;µl of 5000&nbsp;µg/ml HSL (3-oxo-C12) B) 0.5&nbsp;h after induction C) 1&nbsp;h after induction D) 1.5&nbsp;h after induction E) 2&nbsp;h after induction F) 2.5&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
== 25th ==<br />
* did a plasmid restriction of I20260 (EcoRI,PstI), J23115 (EcoRI, SpeI), K516032 (XbaI,PstI), and J23101 (EcoRI, SpeI)<br />
* tested the growth of ''Pseudomonas fluorescens'' in different liquid media for high OD and strong fluorescence. She tested Standard I medium, Cetrimide medium and Pseudomonas-F medium, and Pseudomonas-F medium supplemented with 300&nbsp;µL Fe3+ in 500&nbsp;mL flasks with a filling volume of 30&nbsp;mL. The flasks were inoculated with ''P. fluorescens'' cells on Standard I agar, and incubated at 30&nbsp;°C at 250&nbsp;rpm.<br />
* prepared over night cultures of K131026 in DH5α and NEB for chips<br />
* prepared 2x 5&nbsp;ml of pSB1C3, psB3K3 and pSB1A2 for plasmid prep<br />
<br />
== 26th ==<br />
* ligation of J23115 and K516032 to J23115.K516032, and J23101 and K516032 to J23101.K516032, respectively.<br />
* plasmid prep of I20260, K516032 and B0034<br />
* restriction of plasmids I20260, K516032, B0034 with EcoRI and PstI<br />
* gel with restricted the I20260, K516032 and B0034 was run<br />
* purification of vector backbones pSB1A2, pSB3K3 and pSB1C3<br />
* restriciton of synthesized TEV protease with EcoRI and PstI<br />
* qualitatively tested the ''Pseudomonas fluorescens'' that had grown over night for OD and fluorescence. She determined that Pseudomonas-F medium is the most adequate for the cultivation of the strain we use, since both OD and fluorescence were best in the flask containing the respective medium. Growth in the Pseudomonas-F medium supplemented with 300&nbsp;µg/L Fe3+ was weaker, however, fluorescence was also successfully suppressed.<br />
* made chips with K131026 in DH5α and NEB, in LB and LB + 10&nbsp;% glycerol. Images were taken with our own device every 10 min (illumination problems).<br />
<center><br />
{{Team:Aachen/Figure|Aachen_26_08_2014_K131026_neb_serie.png|title=Sensor Chips with K131026 in NEB in LB taken with first prototyp of our own device|subtitle=Sensor chips with K131026 in NEB in LB medium with 1,5&nbsp;% agar. Chip on the top induced with 0.5&nbsp;µl of 500&nbsp;µg/ml HSL and on the bottom with less than 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12). A) befor induction B) 1&nbsp;h after induction C) 1.5&nbsp;h after induction D) 2&nbsp;h after induction |width=600px}}<br />
</center><br />
* plasmid prep of the back bones, restriction and gel purification<br />
<br />
== 27th ==<br />
* transformation of some BioBricks<br />
* ligation of J23101.K516032 into pSB3K3 and J23115.K516032 into pSB3K3 and K1319004 into pSB1C3<br />
* transformation of K1319004 into pUC and pSB1C3, and J04450 into pSB1K3 and pSB1A3, respectively<br />
<br />
== 28th ==<br />
* transformation of some BioBricks<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/AugustTeam:Aachen/Notebook/Wetlab/August2014-10-16T21:38:47Z<p>VeraA: /* 6th */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= August =<br />
== 1st ==<br />
* made electrocompetent ''E.coli'' rosetta cells.<br />
* prepared cultures of K1319042 and K131026<br />
<br />
== 2nd ==<br />
* tested the OD measurement device and compared it to the spectrophotometer and the plate reader. <br />
* tested K131026 and K1319042 for fluorescence in the plate reader<br />
* did a heat shock transformation of I746909 into NEB TOP 10 cells<br />
* did an electroshock transformation of pET17-Gal3 into ''E.coli'' rosetta<br />
<br />
== 3rd ==<br />
* OD measurements of the iGEM device in comparison to the spectrophotometer were taken. <br />
* cryo cultures of K131026 and K1319042 were prepared<br />
* master plates of Gal3 #1-#10 and I746909 #1-#4 and overnight cultures<br />
<br />
== 4th ==<br />
* made cryo stocks of K1319042 and K131026 in NEB/BL21/DH5alpha, I746909 in BL21 and pET17-His-SNAP-YFP-Gal3 in ''E.&nbsp;coli'' rosetta (DE3), respectively.<br />
* made plasmid prep, most of them using 1.5&nbsp;mL culture medium, and eluted with 1x 50&nbsp;µL of ddH{{sub|2}}O. The resulting DNA concentrations are shown below.<br />
<br />
<center><br />
{| class="wikitable"<br />
! combination !! concentration [ng/µl]<br />
|-<br />
| I746909 BL21 #1 || 73.5<br />
|-<br />
| I746909 BL21 #2 || 45<br />
|-<br />
| I746909 BL21 #3 || 49<br />
|-<br />
| K1319042 DH5alpha || 60<br />
|-<br />
| K131026 DH5alpha || 150<br />
|-<br />
| pET17-Gal3 #1 || 30.5<br />
|-<br />
| pET17-Gal3 #2 || 6.4<br />
|-<br />
| pET17-Gal3 #3 || 6.3<br />
|-<br />
| pET17-Gal3 #4 || 9.4<br />
|-<br />
| pET17-Gal3 #5 || 10.1<br />
|-<br />
| pET17-Gal3 #6 || 8.2<br />
|-<br />
| pET17-Gal3 #7 || 13.8<br />
|-<br />
| pET17-Gal3 #8 || 6.9<br />
|-<br />
| pET17-Gal3 #9 || 10.2<br />
|}<br />
</center><br />
<br />
To confirm the quality of pET17-Gal3 transformations, the purified plasmids were tested by carrying out a digest. Results are shown in the below picture and table.<br />
<br />
<center><br />
{{Team:Aachen/Figure|14-08-04_Test-Digest.png|title=Test digest|subtitle=clones were test-digested|width=400px}}<br />
<br />
{| class="wikitable"<br />
! combination !! cut products[bp]<br />
|-<br />
| I746909 BL21 #1 || 2029, 947<br />
|-<br />
| K1319042 DH5alpha || 2029, 1780<br />
|-<br />
| K131026 DH5alpha || 2029, 1848<br />
|-<br />
| pET17-Gal3 #1 || 3086, 923, 1262<br />
|}<br />
</center><br />
<br />
All pET17-Gal3 clones were positive and clone #1 was selected for further experiments.<br />
* prepared an over night cultur of K1319042 for chips<br />
<br />
== 5th ==<br />
* assembly of a V{{sub|R}}=2.5&nbsp;L bioreactor for cultivation of a 1&nbsp;L expression culture.<br />
* Two precultures of 20&nbsp;mL LB+A were inoculated at 19:00<br />
* transformation of K746909 into BL21 cells and K1319000 into NEB10β cells.<br />
* made Chips with K1319042 in HM. Images were taken every 30 min with the Geldoc<br />
* made alliquots of HM, 1&nbsp;L HM + glucose + supplements and 500&nbsp;ml LB<br />
<br />
* The Quickchange mutagenesis PCR with a tamplate K1319000 and following primers was made. The PCR was made in two steps. The first step is PCR with both primers separatly and the second step includes PCR with two PCR products mixed with each other.<br />
** forward primer EYFPtoREACh1_F: AGTACAACTGGAACAGCCACAACGTCTATATC<br />
** rewerse primer EYFPtoREACh1_R: GTTGTGGCTGTTCCAGTTGTACTCCAGCTTG<br />
** forward primer EYFPtoREACh2_F: AGTACAACTGGAACAGCCGCAACGTCTATATCATG<br />
** rewerse primer EYFPtoREACh2_R: ATAGACGTTGCGGCTGTTCCAGTTGTACTCCAGCTTG<br />
<br />
'''1. Step''' with 3 cycles<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| anneal || 55 || 30"<br />
|-<br />
| elongate || 72 || 30"<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
'''2. Step''' with 14 cycles<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| anneal || 55 || 60"<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-07-5_PCR_toREACh1%262.png|title=Agarose gel with PCR products after Quichchange from K1319000 to K1319001 and K1319002 |width=400px}}<br />
</center><br />
<br />
* REACh1 gets number K1319001 and REACh2 gets number K1319002.<br />
<br />
== 6th ==<br />
* transformation of J04450 in pSB1K3 and pSB1A3 in NEB10β cells.<br />
* They also did a plasmid prep of J04450 in pSB1C3 and Flo's vectors.<br />
* made precultures of NEB10βand DH5 alpha cells<br />
* inoculation of the fermenter at 11:40, and induced the fermentation of pET17-Gal3. The fermentation is expected to run 24&nbsp;h.<br />
* as the first Quickchange PCR for REACh2 was not sucsessful, it was reapeted as a gradient PCR with annealing temperatire 55&nbsp;°C, 57&nbsp;°C and 60&nbsp;°C. Then the agarose gel with PCR product samples was made.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-08-06_to_REACh2.png|title=Agarose gel with PCR products after Quickchange from K1319000 to K1319002 |width=400px}}<br />
</center><br />
<br />
== 7th ==<br />
* made media for ''Pseudomonas flourescens''<br />
** Nutrient Broth<br />
** Pseudomonas-F<br />
** Pseudomonas-P<br />
* made 2&nbsp;L LB<br />
<br />
== 8th ==<br />
* prepared 2x 60&nbsp;ml (LB + cam + IPTG) with K1319042<br />
* prepared 5&nbsp;ml K131026 and C0179<br />
* made SDS page<br />
<br />
== 9th ==<br />
* made a plate reader experiment with K131026 in LB and LB + HM<br />
<br />
== 11th ==<br />
* plated on LB + antibiotics<br />
** K131026<br />
** I746909<br />
** K13190042<br />
** I04450 in pSB1C3<br />
** I04450 in pSB1A3<br />
** I04450 in pSB1K3<br />
** pSEVA construct (pSEVA 641_FP pSEVA 234-LasR)<br />
<br />
== 13th ==<br />
* Agarose chips were prepared:<br />
** ''E. coli'' DH5α K131026 and I746909 in LB and HM<br />
** K1319042 and the pSEVA two plasmid construct in HM<br />
* Images were taken every 30 min with the Geldoc<br />
<br />
==15th ==<br />
* A bioreactor containing 1&nbsp;L Medium was inoculated with pET17-His-SNAP-YFP-Gal3.<br />
<br />
== 16th ==<br />
* The above mentioned Bioreactor was stopped after 20&nbsp;h and all cells were lysed.<br />
<br />
== 18th ==<br />
* Overnight cultures of I746909 and K131026 in LB, TB, 2x HM+ were made<br />
* 3x J23101.E0240 was plated<br />
* pET17-His-SNAP-YFP-Gal3 was purified with Äkta via a histidine-tagged protein purification.<br />
<br />
== 19th ==<br />
* Chips with K131026 and I746909 in HM were made. Images were taken every 30 min with the Geldoc<br />
* A PCR of J23101.E0240, K1319000, K1319001, K1319002 was run and the product was separated on a 1,2&nbsp;% agarose gel<br />
* A SDS gel with samples of protein purification of pET17-His-SNAP-YFP-Gal3 was made to check if the purifired samples contain the target protein - YFP-Gal3. The purification or the gel resulted in two samples with a yellow color. For the SDS we also used the two samples before and the two samples after ones with the yellow color, 6&nbsp;mL. <br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-08-18_Gal3_purification_iVA.png|title=YFP-Gal3 protein purification|subtitle=|width=400px}}<br />
</center><br />
<br />
* Two samples with YFP-Gal3 were concentrated till 1&nbsp;mL <br />
* The concentration of YFP-Gal3 was calculated on Tecan. Calculation showed concentration 13,42&nbsp;mg/ml<br />
<br />
== 20th ==<br />
* repeat PCR for REACh1 and J23101.E0240 and run a gel<br />
* plasmid prep of pSEVA BfsB, pSEVA lasR and I746909<br />
<br />
== 24th ==<br />
* made 2.5&nbsp;L LB<br />
* made chips of K131026 in NEB , DH5α and BL21 in LB and additionally K131026 in DH5α in HM+. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_24_08_2014_K131026_bl21_serie.png|title=Sensor Chips with K131026 in BL21 in LB taken with first prototyp of our own device|subtitle=Sensor chips with K131026 in BL21 in LB medium with 1,5&nbsp;% agar, lower chip induced. A) befor induction with 2&nbsp;µl of 5000&nbsp;µg/ml HSL (3-oxo-C12) B) 0.5&nbsp;h after induction C) 1&nbsp;h after induction D) 1.5&nbsp;h after induction E) 2&nbsp;h after induction F) 2.5&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
== 25th ==<br />
* did a plasmid restriction of I20260 (EcoRI,PstI), J23115 (EcoRI, SpeI), K516032 (XbaI,PstI), and J23101 (EcoRI, SpeI)<br />
* tested the growth of ''Pseudomonas fluorescens'' in different liquid media for high OD and strong fluorescence. She tested Standard I medium, Cetrimide medium and Pseudomonas-F medium, and Pseudomonas-F medium supplemented with 300&nbsp;µL Fe3+ in 500&nbsp;mL flasks with a filling volume of 30&nbsp;mL. The flasks were inoculated with ''P. fluorescens'' cells on Standard I agar, and incubated at 30&nbsp;°C at 250&nbsp;rpm.<br />
* prepared over night cultures of K131026 in DH5α and NEB for chips<br />
* prepared 2x 5&nbsp;ml of pSB1C3, psB3K3 and pSB1A2 for plasmid prep<br />
<br />
== 26th ==<br />
* ligation of J23115 and K516032 to J23115.K516032, and J23101 and K516032 to J23101.K516032, respectively.<br />
* plasmid prep of I20260, K516032 and B0034<br />
* restriction of plasmids I20260, K516032, B0034 with EcoRI and PstI<br />
* gel with restricted the I20260, K516032 and B0034 was run<br />
* purification of vector backbones pSB1A2, pSB3K3 and pSB1C3<br />
* restriciton of synthesized TEV protease with EcoRI and PstI<br />
* qualitatively tested the ''Pseudomonas fluorescens'' that had grown over night for OD and fluorescence. She determined that Pseudomonas-F medium is the most adequate for the cultivation of the strain we use, since both OD and fluorescence were best in the flask containing the respective medium. Growth in the Pseudomonas-F medium supplemented with 300&nbsp;µg/L Fe3+ was weaker, however, fluorescence was also successfully suppressed.<br />
* made chips with K131026 in DH5α and NEB, in LB and LB + 10&nbsp;% glycerol. Images were taken with our own device every 10 min (illumination problems).<br />
<center><br />
{{Team:Aachen/Figure|Aachen_26_08_2014_K131026_neb_serie.png|title=Sensor Chips with K131026 in NEB in LB taken with first prototyp of our own device|subtitle=Sensor chips with K131026 in NEB in LB medium with 1,5&nbsp;% agar. Chip on the top induced with 0.5&nbsp;µl of 500&nbsp;µg/ml HSL and on the bottom with less than 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12). A) befor induction B) 1&nbsp;h after induction C) 1.5&nbsp;h after induction D) 2&nbsp;h after induction |width=600px}}<br />
</center><br />
* plasmid prep of the back bones, restriction and gel purification<br />
<br />
== 27th ==<br />
* transformation of some BioBricks<br />
* ligation of J23101.K516032 into pSB3K3 and J23115.K516032 into pSB3K3 and K1319004 into pSB1C3<br />
* transformation of K1319004 into pUC and pSB1C3, and J04450 into pSB1K3 and pSB1A3, respectively<br />
<br />
== 28th ==<br />
* transformation of some BioBricks<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/File:Aachen_14-08-06_to_REACh2.pngFile:Aachen 14-08-06 to REACh2.png2014-10-16T21:37:52Z<p>VeraA: uploaded a new version of &quot;File:Aachen 14-08-06 to REACh2.png&quot;</p>
<hr />
<div></div>VeraAhttp://2014.igem.org/File:Aachen_14-09-17_E0030_with_RFC25.pngFile:Aachen 14-09-17 E0030 with RFC25.png2014-10-16T21:35:22Z<p>VeraA: uploaded a new version of &quot;File:Aachen 14-09-17 E0030 with RFC25.png&quot;</p>
<hr />
<div></div>VeraAhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/AugustTeam:Aachen/Notebook/Wetlab/August2014-10-16T20:22:26Z<p>VeraA: /* 5th */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= August =<br />
== 1st ==<br />
* made electrocompetent ''E.coli'' rosetta cells.<br />
* prepared cultures of K1319042 and K131026<br />
<br />
== 2nd ==<br />
* tested the OD measurement device and compared it to the spectrophotometer and the plate reader. <br />
* tested K131026 and K1319042 for fluorescence in the plate reader<br />
* did a heat shock transformation of I746909 into NEB TOP 10 cells<br />
* did an electroshock transformation of pET17-Gal3 into ''E.coli'' rosetta<br />
<br />
== 3rd ==<br />
* OD measurements of the iGEM device in comparison to the spectrophotometer were taken. <br />
* cryo cultures of K131026 and K1319042 were prepared<br />
* master plates of Gal3 #1-#10 and I746909 #1-#4 and overnight cultures<br />
<br />
== 4th ==<br />
* made cryo stocks of K1319042 and K131026 in NEB/BL21/DH5alpha, I746909 in BL21 and pET17-His-SNAP-YFP-Gal3 in ''E.&nbsp;coli'' rosetta (DE3), respectively.<br />
* made plasmid prep, most of them using 1.5&nbsp;mL culture medium, and eluted with 1x 50&nbsp;µL of ddH{{sub|2}}O. The resulting DNA concentrations are shown below.<br />
<br />
<center><br />
{| class="wikitable"<br />
! combination !! concentration [ng/µl]<br />
|-<br />
| I746909 BL21 #1 || 73.5<br />
|-<br />
| I746909 BL21 #2 || 45<br />
|-<br />
| I746909 BL21 #3 || 49<br />
|-<br />
| K1319042 DH5alpha || 60<br />
|-<br />
| K131026 DH5alpha || 150<br />
|-<br />
| pET17-Gal3 #1 || 30.5<br />
|-<br />
| pET17-Gal3 #2 || 6.4<br />
|-<br />
| pET17-Gal3 #3 || 6.3<br />
|-<br />
| pET17-Gal3 #4 || 9.4<br />
|-<br />
| pET17-Gal3 #5 || 10.1<br />
|-<br />
| pET17-Gal3 #6 || 8.2<br />
|-<br />
| pET17-Gal3 #7 || 13.8<br />
|-<br />
| pET17-Gal3 #8 || 6.9<br />
|-<br />
| pET17-Gal3 #9 || 10.2<br />
|}<br />
</center><br />
<br />
To confirm the quality of pET17-Gal3 transformations, the purified plasmids were tested by carrying out a digest. Results are shown in the below picture and table.<br />
<br />
<center><br />
{{Team:Aachen/Figure|14-08-04_Test-Digest.png|title=Test digest|subtitle=clones were test-digested|width=400px}}<br />
<br />
{| class="wikitable"<br />
! combination !! cut products[bp]<br />
|-<br />
| I746909 BL21 #1 || 2029, 947<br />
|-<br />
| K1319042 DH5alpha || 2029, 1780<br />
|-<br />
| K131026 DH5alpha || 2029, 1848<br />
|-<br />
| pET17-Gal3 #1 || 3086, 923, 1262<br />
|}<br />
</center><br />
<br />
All pET17-Gal3 clones were positive and clone #1 was selected for further experiments.<br />
* prepared an over night cultur of K1319042 for chips<br />
<br />
== 5th ==<br />
* assembly of a V{{sub|R}}=2.5&nbsp;L bioreactor for cultivation of a 1&nbsp;L expression culture.<br />
* Two precultures of 20&nbsp;mL LB+A were inoculated at 19:00<br />
* transformation of K746909 into BL21 cells and K1319000 into NEB10β cells.<br />
* made Chips with K1319042 in HM. Images were taken every 30 min with the Geldoc<br />
* made alliquots of HM, 1&nbsp;L HM + glucose + supplements and 500&nbsp;ml LB<br />
<br />
* The Quickchange mutagenesis PCR with a tamplate K1319000 and following primers was made. The PCR was made in two steps. The first step is PCR with both primers separatly and the second step includes PCR with two PCR products mixed with each other.<br />
** forward primer EYFPtoREACh1_F: AGTACAACTGGAACAGCCACAACGTCTATATC<br />
** rewerse primer EYFPtoREACh1_R: GTTGTGGCTGTTCCAGTTGTACTCCAGCTTG<br />
** forward primer EYFPtoREACh2_F: AGTACAACTGGAACAGCCGCAACGTCTATATCATG<br />
** rewerse primer EYFPtoREACh2_R: ATAGACGTTGCGGCTGTTCCAGTTGTACTCCAGCTTG<br />
<br />
'''1. Step''' with 3 cycles<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| anneal || 55 || 30"<br />
|-<br />
| elongate || 72 || 30"<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
'''2. Step''' with 14 cycles<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| anneal || 55 || 60"<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-07-5_PCR_toREACh1%262.png|title=Agarose gel with PCR products after Quichchange from K1319000 to K1319001 and K1319002 |width=400px}}<br />
</center><br />
<br />
* REACh1 gets number K1319001 and REACh2 gets number K1319002.<br />
<br />
== 6th ==<br />
* transformation of J04450 in pSB1K3 and pSB1A3 in NEB10β cells.<br />
* They also did a plasmid prep of J04450 in pSB1C3 and Flo's vectors.<br />
* made precultures of NEB10βand DH5 alpha cells<br />
* inoculation of the fermenter at 11:40, and induced the fermentation of pET17-Gal3. The fermentation is expected to run 24&nbsp;h.<br />
* as the first Quickchange PCR for REACh2 was not sucsessful, it was reapeted as a gradient PCR with annealing temperatire 55&nbsp;°C, 57&nbsp;°C and 60&nbsp;°C. Then the agarose gel with PCR product samples was made.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-08-06_to_REACh2.png|title=Agarose gel with PCR products after Quichchange from K1319000 to K1319002 |width=400px}}<br />
</center><br />
<br />
== 7th ==<br />
* made media for ''Pseudomonas flourescens''<br />
** Nutrient Broth<br />
** Pseudomonas-F<br />
** Pseudomonas-P<br />
* made 2&nbsp;L LB<br />
<br />
== 8th ==<br />
* prepared 2x 60&nbsp;ml (LB + cam + IPTG) with K1319042<br />
* prepared 5&nbsp;ml K131026 and C0179<br />
* made SDS page<br />
<br />
== 9th ==<br />
* made a plate reader experiment with K131026 in LB and LB + HM<br />
<br />
== 11th ==<br />
* plated on LB + antibiotics<br />
** K131026<br />
** I746909<br />
** K13190042<br />
** I04450 in pSB1C3<br />
** I04450 in pSB1A3<br />
** I04450 in pSB1K3<br />
** pSEVA construct (pSEVA 641_FP pSEVA 234-LasR)<br />
<br />
== 13th ==<br />
* Agarose chips were prepared:<br />
** ''E. coli'' DH5α K131026 and I746909 in LB and HM<br />
** K1319042 and the pSEVA two plasmid construct in HM<br />
* Images were taken every 30 min with the Geldoc<br />
<br />
==15th ==<br />
* A bioreactor containing 1&nbsp;L Medium was inoculated with pET17-His-SNAP-YFP-Gal3.<br />
<br />
== 16th ==<br />
* The above mentioned Bioreactor was stopped after 20&nbsp;h and all cells were lysed.<br />
<br />
== 18th ==<br />
* Overnight cultures of I746909 and K131026 in LB, TB, 2x HM+ were made<br />
* 3x J23101.E0240 was plated<br />
* pET17-His-SNAP-YFP-Gal3 was purified with Äkta via a histidine-tagged protein purification.<br />
<br />
== 19th ==<br />
* Chips with K131026 and I746909 in HM were made. Images were taken every 30 min with the Geldoc<br />
* A PCR of J23101.E0240, K1319000, K1319001, K1319002 was run and the product was separated on a 1,2&nbsp;% agarose gel<br />
* A SDS gel with samples of protein purification of pET17-His-SNAP-YFP-Gal3 was made to check if the purifired samples contain the target protein - YFP-Gal3. The purification or the gel resulted in two samples with a yellow color. For the SDS we also used the two samples before and the two samples after ones with the yellow color, 6&nbsp;mL. <br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-08-18_Gal3_purification_iVA.png|title=YFP-Gal3 protein purification|subtitle=|width=400px}}<br />
</center><br />
<br />
* Two samples with YFP-Gal3 were concentrated till 1&nbsp;mL <br />
* The concentration of YFP-Gal3 was calculated on Tecan. Calculation showed concentration 13,42&nbsp;mg/ml<br />
<br />
== 20th ==<br />
* repeat PCR for REACh1 and J23101.E0240 and run a gel<br />
* plasmid prep of pSEVA BfsB, pSEVA lasR and I746909<br />
<br />
== 24th ==<br />
* made 2.5&nbsp;L LB<br />
* made chips of K131026 in NEB , DH5α and BL21 in LB and additionally K131026 in DH5α in HM+. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_24_08_2014_K131026_bl21_serie.png|title=Sensor Chips with K131026 in BL21 in LB taken with first prototyp of our own device|subtitle=Sensor chips with K131026 in BL21 in LB medium with 1,5&nbsp;% agar, lower chip induced. A) befor induction with 2&nbsp;µl of 5000&nbsp;µg/ml HSL (3-oxo-C12) B) 0.5&nbsp;h after induction C) 1&nbsp;h after induction D) 1.5&nbsp;h after induction E) 2&nbsp;h after induction F) 2.5&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
== 25th ==<br />
* did a plasmid restriction of I20260 (EcoRI,PstI), J23115 (EcoRI, SpeI), K516032 (XbaI,PstI), and J23101 (EcoRI, SpeI)<br />
* tested the growth of ''Pseudomonas fluorescens'' in different liquid media for high OD and strong fluorescence. She tested Standard I medium, Cetrimide medium and Pseudomonas-F medium, and Pseudomonas-F medium supplemented with 300&nbsp;µL Fe3+ in 500&nbsp;mL flasks with a filling volume of 30&nbsp;mL. The flasks were inoculated with ''P. fluorescens'' cells on Standard I agar, and incubated at 30&nbsp;°C at 250&nbsp;rpm.<br />
* prepared over night cultures of K131026 in DH5α and NEB for chips<br />
* prepared 2x 5&nbsp;ml of pSB1C3, psB3K3 and pSB1A2 for plasmid prep<br />
<br />
== 26th ==<br />
* ligation of J23115 and K516032 to J23115.K516032, and J23101 and K516032 to J23101.K516032, respectively.<br />
* plasmid prep of I20260, K516032 and B0034<br />
* restriction of plasmids I20260, K516032, B0034 with EcoRI and PstI<br />
* gel with restricted the I20260, K516032 and B0034 was run<br />
* purification of vector backbones pSB1A2, pSB3K3 and pSB1C3<br />
* restriciton of synthesized TEV protease with EcoRI and PstI<br />
* qualitatively tested the ''Pseudomonas fluorescens'' that had grown over night for OD and fluorescence. She determined that Pseudomonas-F medium is the most adequate for the cultivation of the strain we use, since both OD and fluorescence were best in the flask containing the respective medium. Growth in the Pseudomonas-F medium supplemented with 300&nbsp;µg/L Fe3+ was weaker, however, fluorescence was also successfully suppressed.<br />
* made chips with K131026 in DH5α and NEB, in LB and LB + 10&nbsp;% glycerol. Images were taken with our own device every 10 min (illumination problems).<br />
<center><br />
{{Team:Aachen/Figure|Aachen_26_08_2014_K131026_neb_serie.png|title=Sensor Chips with K131026 in NEB in LB taken with first prototyp of our own device|subtitle=Sensor chips with K131026 in NEB in LB medium with 1,5&nbsp;% agar. Chip on the top induced with 0.5&nbsp;µl of 500&nbsp;µg/ml HSL and on the bottom with less than 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12). A) befor induction B) 1&nbsp;h after induction C) 1.5&nbsp;h after induction D) 2&nbsp;h after induction |width=600px}}<br />
</center><br />
* plasmid prep of the back bones, restriction and gel purification<br />
<br />
== 27th ==<br />
* transformation of some BioBricks<br />
* ligation of J23101.K516032 into pSB3K3 and J23115.K516032 into pSB3K3 and K1319004 into pSB1C3<br />
* transformation of K1319004 into pUC and pSB1C3, and J04450 into pSB1K3 and pSB1A3, respectively<br />
<br />
== 28th ==<br />
* transformation of some BioBricks<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/JulyTeam:Aachen/Notebook/Wetlab/July2014-10-16T20:19:24Z<p>VeraA: /* 16th */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= July =<br />
== 1st ==<br />
* transformation efficiency kit is broken<br />
&rarr; run an agarose gel with the kit plasmids to check for nuclease activity/ bands<br />
* inventory of the -80°C freezer was done<br />
<br />
== 2nd ==<br />
* overnight cultures (LB) of K731520 and K1319042 for chips were inoculated<br />
<br />
== 3rd ==<br />
* ODs of the overnight culture of <br />
** K731520: 2.3 <br />
** K1319042: 2.5<br />
* made chips with K1319042 and K731520 in NA and M9 medium. Images were taken every 30 min with the GelDoc<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-07-03_M9_iLOV_serie.png|title=Sensor Chips with K1319042 in M9 first try|subtitle=Sensor chips with K1319042 in M9 medium with 1,5&nbsp;% agar. A) befor induction with IPTG B) 1&nbsp;h after induction C) 4.5&nbsp;h after induction a) induced with 2x&nbsp;2&nbsp;µl 1&nbsp;mM IPTG b) induced with 2x&nbsp;2&nbsp;µl 10&nbsp;mM IPTG c) induced with 2x&nbsp;2&nbsp;µl 0.1&nbsp;mM IPTG d) induced with 2x&nbsp;2&nbsp;µl 100&nbsp;mM IPTG|width=900px}}<br />
</center><br />
* print K1319042 Chip on LB plate<br />
* overnight culture of E0030 for plasmid prep<br />
<br />
== 4th ==<br />
* plasmid prep of E0030: 159.5 ng/µl (concentration)<br />
* print of K1319042 Chip on LB plate made 1 and 7 colonies<br />
<br />
== 7th ==<br />
* 13 Biobricks were transformed<br />
* overnight culture of K103006 for a plasmid prep was inoculated<br />
* colony PCR master mix was prepared<br />
<br />
== 8th ==<br />
* overnight culture of K1319042 for chips was inoculated<br />
<br />
== 9th ==<br />
* made chips with K1319042 in M9, M9 + casamino acids, Hartman medium (HM). Images were taken every 30 min with the Geldoc<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-07-09_M9_iLOV_serie.png|title=Sensor Chips with K1319042 in M9 second try|subtitle=Sensor chips with K1319042 in M9 medium with 1,5&nbsp;% agar. A) befor induction with IPTG B) 1.5&nbsp;h after induction C) 3&nbsp;h after induction a) induced with 2x&nbsp;2&nbsp;µl 1&nbsp;mM IPTG b) induced with 2x&nbsp;2&nbsp;µl 10&nbsp;mM IPTG c) induced with 2x&nbsp;2&nbsp;µl 0.1&nbsp;mM IPTG d) induced with 2x&nbsp;2&nbsp;µl 100&nbsp;mM IPTG|width=900px}}<br />
</center><br />
* made OmpA-linker_iLOV 3A-Assambley<br />
* colony PCR<br />
* transformation for backbones<br />
<br />
== 10th ==<br />
* master plates of the strains for backbone isolation<br />
<br />
== 14th ==<br />
* built again J23115.E0240 for interlab study<br />
<br />
== 15th ==<br />
* made 500&nbsp;ml LB and LB plates<br />
* made the transformation of J23115.E0240<br />
* overnight culture of K1319042 for chips<br />
<br />
== 16th ==<br />
* did plasmid preps<br />
* transformation of different reporter strains<br />
** NEB <br />
***pSEVE641_BsFbFP<br />
***pSEVA234_LasR<br />
***pSEVE641_BsFbFP pSEVA234_LasR<br />
***pSEVE641_BsFbFP pSB1C3_C0179<br />
**BL21<br />
***pSEVE641_BsFbFP pSEVA234_LasR<br />
***pSEVE641_BsFbFP pSB1C3_C0179<br />
* made chips with K1319042 in Hartman, Hartman + 20&nbsp;% glycerol, M9 medium images were taken every 30 min with the Geldoc<br />
* The PCR of Biobrick E0030 in vector pSB1C3 with primers for RFC 25 was made. The expected length is <br />
** forward primer EYFP_RFC25_F: ACGTTGAATTCGCGGCCGCTTCTAGATGGCCGGCGTGAGCAAGGGCGAGGAG<br />
** rewerse primer EYFP_RFC25_R: ATCCTGCAGCGGCCGCTACTAGTATTAACCGGTGTACAGCTCGTCCATGC<br />
* PCR product gets number K1319000 <br />
<br />
<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
|-<br />
| denature || 94 || 60"<br />
|-<br />
| denature || 94 || 30"<br />
|-<br />
| anneal || 50/60,4/64,9 || 30"<br />
|-<br />
| elongate || 72 || 60"<br />
|-<br />
| elongate || 72 || 5'<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
<br />
The agarose gel with PCR product was made.Expected length is 778 kb.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-09-17_E0030_with_RFC25.png|title=Agarose gel with PCR products after PCR from E0030 to K1319000 |width=400px}}<br />
</center><br />
as it can be seen on the picture PCR worked with all annealing temperatures, all samples were used for a transformation in DH5α.<br />
<br />
== 17th ==<br />
* the PCR product was purificated and the concentration was measured.<br />
* Restriktion of PCR product for the insert and E0030 for the vector with ''Eco''RI and PstI with following purification from agarose gel was made.<br />
<br />
== 21st ==<br />
* the ligation of PCR product and the vector that was purified from agarose was made.<br />
<br />
== 22nd ==<br />
* made 100x stocks for Hartmans minimal medium.<br />
* made about 25 HM+C plates without glucose.<br />
* K1319042 was plated on a HM+C plate<br />
<br />
== 23rd ==<br />
* made 25 new HM+C plates with 1&nbsp;% agar and 4&nbsp;g/L glucose<br />
* added 170&nbsp;µL of the glucose stock (500&nbsp;g/L) to the glucose-free HM+C-plates<br />
* 1&nbsp;L of sterile HM+glucose was prepared<br />
* K1319042 was plated on HM+C+Glucose and HM+C+Glucose drops, 3x 5&nbsp;mL HM+C+Glucose precultures were inoculated (17:00)<br />
<br />
== 24th ==<br />
* K1319042 did not grow, neither on the plates, nor on in the liquid media. The most probable cause is that the ''E.&nbsp;coli'' is missing some vitamins<br />
* Based on the [http://openwetware.org/wiki/M9_medium/supplemented M9 recipes by the Knight and Endy labs on OpenWetWare], we made a 20&nbsp;mL supplement stock solution that can be added to 1x HM media<br />
<br />
<center><br />
{| class="wikitable"<br />
|-<br />
! Component !! supplement for 1x HM [g/L] !! final 1x concentration<br />
|-<br />
| Casamino acids || 2 || 2 g/L<br />
|-<br />
| Thiamine hydrochloride || 0.3 || 300 mg/L<br />
|-<br />
| MgSO{{sub|4}}/MgSO{{sub|4}}*7H{{sub|2}}O || 0.242 / 0.494 || 2 mmol/L<br />
|-<br />
| CaCl{{sub|2}} || 0.011 || 0.1 mmol/L<br />
|}<br />
</center><br />
<br />
The powders for 1&nbsp;L of 1x HM were dissolved in 20&nbsp;mL of a 10&nbsp;%&nbsp;w/v Casamino acid stock solution and filter-sterilized (.22&nbsp;µm PES). To make agar chips, we can add 1&nbsp;mL to the hot agar mixture, together with the three 500&nbsp;µL 100x stocks for the HM.<br />
<br />
We made 250&nbsp;mL of HM+C+Glucose+Supplements plates with 1.5&nbsp;% agar.<br />
<br />
Then we plated the following combinations:<br />
<br />
<center><br />
{| class="wikitable"<br />
|-<br />
! Construct !! HM+C+Glucose+Supplements !! LB+C<br />
|-<br />
| K1319042 || - || +<br />
|-<br />
| J23101.E0240 || + || +<br />
|}<br />
</center><br />
<br />
We also prepared a 150&nbsp;mL HM+C+Glucose+Supplements culture with K1319042 to hopefully make agar chips on Friday, July 25th.<br />
<br />
Six of last weeks J23115.E0240 clones were plated on LB+C, and 5&nbsp;mL LB+C precultures were inoculated for plasmid preparation.<br />
<br />
== 25th ==<br />
The K1319042 strain did not grow on the HM plate, while another strain with the J23101.E0240 construct did. Both have the pSB1C3 backbone. To confirm the plasmids and inserts, we set up a colony PCR:<br />
<br />
<center><br />
{| class="wikitable"<br />
|-<br />
! ID !! Template !! Product Length !! Result<br />
|-<br />
| 1 || J23101.E0240 #5 || 1233 ||<br />
|-<br />
| 2 || J23101.E0240 #6 || 1233 ||<br />
|-<br />
| 3 || J23101.E0240 #5 plasmid || 1233 ||<br />
|-<br />
| 4 || K1319042 LB colony || 2053 ||<br />
|-<br />
| 5 || K1319042 plasmid || 2053 ||<br />
|-<br />
| 6 || K731520 GFP plasmid || 2437 ||<br />
|-<br />
| 7 || water || none ||<br />
|}<br />
</center><br />
<br />
Reaction volume per tube was 15&nbsp;µL. GoTaq Green Mastermix and the VF2 and VR primers were used. You can find the durations and temperatures the table below:<br />
<br />
<center><br />
{| class="wikitable"<br />
! parameter !! duration !! temp [°C]<br />
|-<br />
| denature || 10:00 || 95<br />
|-<br />
| '''denature''' || 00:30 || 95<br />
|-<br />
| '''anneal''' || 00:30 || 49<br />
|-<br />
| '''elongate''' || 02:36 || 72<br />
|-<br />
| elongate || 05:00 || 72<br />
|-<br />
| store || forever|| 8<br />
|}<br />
</center><br />
<br />
We mini-prepped the 6 overnight cultures of J23115.E0240 clones. He used 3&nbsp;mL instead of 1.5&nbsp;mL culture medium and eluted twice with 25&nbsp;µL nuclease-free water. Everything else was according to the protocol of the [http://www.gelifesciences.com/webapp/wcs/stores/servlet/productById/de/GELifeSciences/28904269 illustra plasmidPrep Mini-Spin Kit].<br />
<br />
The resulting DNA concentrations are listed in this table:<br />
<br />
<center><br />
{| class="wikitable"<br />
! clone # !! concentration [ng/µl]<br />
|-<br />
| 1 || 73.5<br />
|-<br />
| 2 || 94.5<br />
|-<br />
| 3 || 100.5<br />
|-<br />
| 4 || 53<br />
|-<br />
| 5 || 82<br />
|-<br />
| 6 || 138<br />
|}<br />
</center><br />
<br />
In the evening, we plated some strains on the different media to investigate why the K3139042 did not grow on the HM+suppl. plate. (Note: In the morning, we re-inoculated the HM+C+suppl. shake flask with cells from the LB-plate and by afternoon the culture ''did'' grow to a high cell density.)<br />
<br />
<center><br />
{| class="wikitable"<br />
! Construct !! Host strain !! LB+C !! HM+C+Glucose !! HM+C+Glucose+supplements<br />
|-<br />
| J23101.E0240 || NEB10β || ++ || - || ++<br />
|-<br />
| K1319042 || DH5alpha || ++ || - || (+)<br />
|-<br />
| K131026 || NEB10β || ++ || - || -<br />
|-<br />
| K131026 || DH5alpha || ++ || - || +<br />
|}<br />
</center><br />
<br />
We inoculated J23101.E0240 in LB and HM+C+Glucose+supplements.<br />
<br />
<!-- == 28th ==<br />
IMPORTANT: Look for customs documents and write ZHV lady!!!! --><br />
<br />
== 29th ==<br />
* inoculate 2x 150&nbsp;ml cultures HM+Glucose+C<br />
* prepared 200&nbsp;ml 1.5&nbsp;% agar<br />
* pre-cool centrifuge<br />
* centrifuge 1x 50, 1x 100 and 1x 150&nbsp;ml<br />
* make 3 kinds of chips - OOx1, ODx2, ODx3<br />
* pre cultures of K1319042 and K131026 in LB<br />
<br />
== 30th ==<br />
* made chips with K1319042 and K131026 in HM medium images were taken every 30 min with the Geldoc<br />
* print chips on LB and LB + Cam , count 2-10 colonies<br />
<br />
== 31th ==<br />
* transformation of K1319042 and K131026 in DH5α, BL21 and NEB<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/JulyTeam:Aachen/Notebook/Wetlab/July2014-10-16T20:17:14Z<p>VeraA: /* 16th */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= July =<br />
== 1st ==<br />
* transformation efficiency kit is broken<br />
&rarr; run an agarose gel with the kit plasmids to check for nuclease activity/ bands<br />
* inventory of the -80°C freezer was done<br />
<br />
== 2nd ==<br />
* overnight cultures (LB) of K731520 and K1319042 for chips were inoculated<br />
<br />
== 3rd ==<br />
* ODs of the overnight culture of <br />
** K731520: 2.3 <br />
** K1319042: 2.5<br />
* made chips with K1319042 and K731520 in NA and M9 medium. Images were taken every 30 min with the GelDoc<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-07-03_M9_iLOV_serie.png|title=Sensor Chips with K1319042 in M9 first try|subtitle=Sensor chips with K1319042 in M9 medium with 1,5&nbsp;% agar. A) befor induction with IPTG B) 1&nbsp;h after induction C) 4.5&nbsp;h after induction a) induced with 2x&nbsp;2&nbsp;µl 1&nbsp;mM IPTG b) induced with 2x&nbsp;2&nbsp;µl 10&nbsp;mM IPTG c) induced with 2x&nbsp;2&nbsp;µl 0.1&nbsp;mM IPTG d) induced with 2x&nbsp;2&nbsp;µl 100&nbsp;mM IPTG|width=900px}}<br />
</center><br />
* print K1319042 Chip on LB plate<br />
* overnight culture of E0030 for plasmid prep<br />
<br />
== 4th ==<br />
* plasmid prep of E0030: 159.5 ng/µl (concentration)<br />
* print of K1319042 Chip on LB plate made 1 and 7 colonies<br />
<br />
== 7th ==<br />
* 13 Biobricks were transformed<br />
* overnight culture of K103006 for a plasmid prep was inoculated<br />
* colony PCR master mix was prepared<br />
<br />
== 8th ==<br />
* overnight culture of K1319042 for chips was inoculated<br />
<br />
== 9th ==<br />
* made chips with K1319042 in M9, M9 + casamino acids, Hartman medium (HM). Images were taken every 30 min with the Geldoc<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-07-09_M9_iLOV_serie.png|title=Sensor Chips with K1319042 in M9 second try|subtitle=Sensor chips with K1319042 in M9 medium with 1,5&nbsp;% agar. A) befor induction with IPTG B) 1.5&nbsp;h after induction C) 3&nbsp;h after induction a) induced with 2x&nbsp;2&nbsp;µl 1&nbsp;mM IPTG b) induced with 2x&nbsp;2&nbsp;µl 10&nbsp;mM IPTG c) induced with 2x&nbsp;2&nbsp;µl 0.1&nbsp;mM IPTG d) induced with 2x&nbsp;2&nbsp;µl 100&nbsp;mM IPTG|width=900px}}<br />
</center><br />
* made OmpA-linker_iLOV 3A-Assambley<br />
* colony PCR<br />
* transformation for backbones<br />
<br />
== 10th ==<br />
* master plates of the strains for backbone isolation<br />
<br />
== 14th ==<br />
* built again J23115.E0240 for interlab study<br />
<br />
== 15th ==<br />
* made 500&nbsp;ml LB and LB plates<br />
* made the transformation of J23115.E0240<br />
* overnight culture of K1319042 for chips<br />
<br />
== 16th ==<br />
* did plasmid preps<br />
* transformation of different reporter strains<br />
** NEB <br />
***pSEVE641_BsFbFP<br />
***pSEVA234_LasR<br />
***pSEVE641_BsFbFP pSEVA234_LasR<br />
***pSEVE641_BsFbFP pSB1C3_C0179<br />
**BL21<br />
***pSEVE641_BsFbFP pSEVA234_LasR<br />
***pSEVE641_BsFbFP pSB1C3_C0179<br />
* made chips with K1319042 in Hartman, Hartman + 20&nbsp;% glycerol, M9 medium images were taken every 30 min with the Geldoc<br />
* The PCR of Biobrick E0030 in vector pSB1C3 with primers for RFC 25 was made. The expected length is <br />
** forward primer EYFP_RFC25_F: ACGTTGAATTCGCGGCCGCTTCTAGATGGCCGGCGTGAGCAAGGGCGAGGAG<br />
** rewerse primer EYFP_RFC25_R: ATCCTGCAGCGGCCGCTACTAGTATTAACCGGTGTACAGCTCGTCCATGC<br />
* PCR product gets number K1319000 <br />
<br />
<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
|-<br />
| denature || 94 || 60"<br />
|-<br />
| denature || 94 || 30"<br />
|-<br />
| anneal || 50/60,4/64,9 || 30"<br />
|-<br />
| elongate || 72 || 60"<br />
|-<br />
| elongate || 72 || 5'<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
<br />
The agarose gel with PCR product was made.Expected length is 778 kb.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-09-17_E0030_with_RFC25.png|title=Agarose gel with PCR products after PCR from E0030 to K1319000 |width=400px}}<br />
</center><br />
<br />
== 17th ==<br />
* the PCR product was purificated and the concentration was measured.<br />
* Restriktion of PCR product for the insert and E0030 for the vector with ''Eco''RI and PstI with following purification from agarose gel was made.<br />
<br />
== 21st ==<br />
* the ligation of PCR product and the vector that was purified from agarose was made.<br />
<br />
== 22nd ==<br />
* made 100x stocks for Hartmans minimal medium.<br />
* made about 25 HM+C plates without glucose.<br />
* K1319042 was plated on a HM+C plate<br />
<br />
== 23rd ==<br />
* made 25 new HM+C plates with 1&nbsp;% agar and 4&nbsp;g/L glucose<br />
* added 170&nbsp;µL of the glucose stock (500&nbsp;g/L) to the glucose-free HM+C-plates<br />
* 1&nbsp;L of sterile HM+glucose was prepared<br />
* K1319042 was plated on HM+C+Glucose and HM+C+Glucose drops, 3x 5&nbsp;mL HM+C+Glucose precultures were inoculated (17:00)<br />
<br />
== 24th ==<br />
* K1319042 did not grow, neither on the plates, nor on in the liquid media. The most probable cause is that the ''E.&nbsp;coli'' is missing some vitamins<br />
* Based on the [http://openwetware.org/wiki/M9_medium/supplemented M9 recipes by the Knight and Endy labs on OpenWetWare], we made a 20&nbsp;mL supplement stock solution that can be added to 1x HM media<br />
<br />
<center><br />
{| class="wikitable"<br />
|-<br />
! Component !! supplement for 1x HM [g/L] !! final 1x concentration<br />
|-<br />
| Casamino acids || 2 || 2 g/L<br />
|-<br />
| Thiamine hydrochloride || 0.3 || 300 mg/L<br />
|-<br />
| MgSO{{sub|4}}/MgSO{{sub|4}}*7H{{sub|2}}O || 0.242 / 0.494 || 2 mmol/L<br />
|-<br />
| CaCl{{sub|2}} || 0.011 || 0.1 mmol/L<br />
|}<br />
</center><br />
<br />
The powders for 1&nbsp;L of 1x HM were dissolved in 20&nbsp;mL of a 10&nbsp;%&nbsp;w/v Casamino acid stock solution and filter-sterilized (.22&nbsp;µm PES). To make agar chips, we can add 1&nbsp;mL to the hot agar mixture, together with the three 500&nbsp;µL 100x stocks for the HM.<br />
<br />
We made 250&nbsp;mL of HM+C+Glucose+Supplements plates with 1.5&nbsp;% agar.<br />
<br />
Then we plated the following combinations:<br />
<br />
<center><br />
{| class="wikitable"<br />
|-<br />
! Construct !! HM+C+Glucose+Supplements !! LB+C<br />
|-<br />
| K1319042 || - || +<br />
|-<br />
| J23101.E0240 || + || +<br />
|}<br />
</center><br />
<br />
We also prepared a 150&nbsp;mL HM+C+Glucose+Supplements culture with K1319042 to hopefully make agar chips on Friday, July 25th.<br />
<br />
Six of last weeks J23115.E0240 clones were plated on LB+C, and 5&nbsp;mL LB+C precultures were inoculated for plasmid preparation.<br />
<br />
== 25th ==<br />
The K1319042 strain did not grow on the HM plate, while another strain with the J23101.E0240 construct did. Both have the pSB1C3 backbone. To confirm the plasmids and inserts, we set up a colony PCR:<br />
<br />
<center><br />
{| class="wikitable"<br />
|-<br />
! ID !! Template !! Product Length !! Result<br />
|-<br />
| 1 || J23101.E0240 #5 || 1233 ||<br />
|-<br />
| 2 || J23101.E0240 #6 || 1233 ||<br />
|-<br />
| 3 || J23101.E0240 #5 plasmid || 1233 ||<br />
|-<br />
| 4 || K1319042 LB colony || 2053 ||<br />
|-<br />
| 5 || K1319042 plasmid || 2053 ||<br />
|-<br />
| 6 || K731520 GFP plasmid || 2437 ||<br />
|-<br />
| 7 || water || none ||<br />
|}<br />
</center><br />
<br />
Reaction volume per tube was 15&nbsp;µL. GoTaq Green Mastermix and the VF2 and VR primers were used. You can find the durations and temperatures the table below:<br />
<br />
<center><br />
{| class="wikitable"<br />
! parameter !! duration !! temp [°C]<br />
|-<br />
| denature || 10:00 || 95<br />
|-<br />
| '''denature''' || 00:30 || 95<br />
|-<br />
| '''anneal''' || 00:30 || 49<br />
|-<br />
| '''elongate''' || 02:36 || 72<br />
|-<br />
| elongate || 05:00 || 72<br />
|-<br />
| store || forever|| 8<br />
|}<br />
</center><br />
<br />
We mini-prepped the 6 overnight cultures of J23115.E0240 clones. He used 3&nbsp;mL instead of 1.5&nbsp;mL culture medium and eluted twice with 25&nbsp;µL nuclease-free water. Everything else was according to the protocol of the [http://www.gelifesciences.com/webapp/wcs/stores/servlet/productById/de/GELifeSciences/28904269 illustra plasmidPrep Mini-Spin Kit].<br />
<br />
The resulting DNA concentrations are listed in this table:<br />
<br />
<center><br />
{| class="wikitable"<br />
! clone # !! concentration [ng/µl]<br />
|-<br />
| 1 || 73.5<br />
|-<br />
| 2 || 94.5<br />
|-<br />
| 3 || 100.5<br />
|-<br />
| 4 || 53<br />
|-<br />
| 5 || 82<br />
|-<br />
| 6 || 138<br />
|}<br />
</center><br />
<br />
In the evening, we plated some strains on the different media to investigate why the K3139042 did not grow on the HM+suppl. plate. (Note: In the morning, we re-inoculated the HM+C+suppl. shake flask with cells from the LB-plate and by afternoon the culture ''did'' grow to a high cell density.)<br />
<br />
<center><br />
{| class="wikitable"<br />
! Construct !! Host strain !! LB+C !! HM+C+Glucose !! HM+C+Glucose+supplements<br />
|-<br />
| J23101.E0240 || NEB10β || ++ || - || ++<br />
|-<br />
| K1319042 || DH5alpha || ++ || - || (+)<br />
|-<br />
| K131026 || NEB10β || ++ || - || -<br />
|-<br />
| K131026 || DH5alpha || ++ || - || +<br />
|}<br />
</center><br />
<br />
We inoculated J23101.E0240 in LB and HM+C+Glucose+supplements.<br />
<br />
<!-- == 28th ==<br />
IMPORTANT: Look for customs documents and write ZHV lady!!!! --><br />
<br />
== 29th ==<br />
* inoculate 2x 150&nbsp;ml cultures HM+Glucose+C<br />
* prepared 200&nbsp;ml 1.5&nbsp;% agar<br />
* pre-cool centrifuge<br />
* centrifuge 1x 50, 1x 100 and 1x 150&nbsp;ml<br />
* make 3 kinds of chips - OOx1, ODx2, ODx3<br />
* pre cultures of K1319042 and K131026 in LB<br />
<br />
== 30th ==<br />
* made chips with K1319042 and K131026 in HM medium images were taken every 30 min with the Geldoc<br />
* print chips on LB and LB + Cam , count 2-10 colonies<br />
<br />
== 31th ==<br />
* transformation of K1319042 and K131026 in DH5α, BL21 and NEB<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/JulyTeam:Aachen/Notebook/Wetlab/July2014-10-16T20:11:45Z<p>VeraA: /* 16th */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= July =<br />
== 1st ==<br />
* transformation efficiency kit is broken<br />
&rarr; run an agarose gel with the kit plasmids to check for nuclease activity/ bands<br />
* inventory of the -80°C freezer was done<br />
<br />
== 2nd ==<br />
* overnight cultures (LB) of K731520 and K1319042 for chips were inoculated<br />
<br />
== 3rd ==<br />
* ODs of the overnight culture of <br />
** K731520: 2.3 <br />
** K1319042: 2.5<br />
* made chips with K1319042 and K731520 in NA and M9 medium. Images were taken every 30 min with the GelDoc<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-07-03_M9_iLOV_serie.png|title=Sensor Chips with K1319042 in M9 first try|subtitle=Sensor chips with K1319042 in M9 medium with 1,5&nbsp;% agar. A) befor induction with IPTG B) 1&nbsp;h after induction C) 4.5&nbsp;h after induction a) induced with 2x&nbsp;2&nbsp;µl 1&nbsp;mM IPTG b) induced with 2x&nbsp;2&nbsp;µl 10&nbsp;mM IPTG c) induced with 2x&nbsp;2&nbsp;µl 0.1&nbsp;mM IPTG d) induced with 2x&nbsp;2&nbsp;µl 100&nbsp;mM IPTG|width=900px}}<br />
</center><br />
* print K1319042 Chip on LB plate<br />
* overnight culture of E0030 for plasmid prep<br />
<br />
== 4th ==<br />
* plasmid prep of E0030: 159.5 ng/µl (concentration)<br />
* print of K1319042 Chip on LB plate made 1 and 7 colonies<br />
<br />
== 7th ==<br />
* 13 Biobricks were transformed<br />
* overnight culture of K103006 for a plasmid prep was inoculated<br />
* colony PCR master mix was prepared<br />
<br />
== 8th ==<br />
* overnight culture of K1319042 for chips was inoculated<br />
<br />
== 9th ==<br />
* made chips with K1319042 in M9, M9 + casamino acids, Hartman medium (HM). Images were taken every 30 min with the Geldoc<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-07-09_M9_iLOV_serie.png|title=Sensor Chips with K1319042 in M9 second try|subtitle=Sensor chips with K1319042 in M9 medium with 1,5&nbsp;% agar. A) befor induction with IPTG B) 1.5&nbsp;h after induction C) 3&nbsp;h after induction a) induced with 2x&nbsp;2&nbsp;µl 1&nbsp;mM IPTG b) induced with 2x&nbsp;2&nbsp;µl 10&nbsp;mM IPTG c) induced with 2x&nbsp;2&nbsp;µl 0.1&nbsp;mM IPTG d) induced with 2x&nbsp;2&nbsp;µl 100&nbsp;mM IPTG|width=900px}}<br />
</center><br />
* made OmpA-linker_iLOV 3A-Assambley<br />
* colony PCR<br />
* transformation for backbones<br />
<br />
== 10th ==<br />
* master plates of the strains for backbone isolation<br />
<br />
== 14th ==<br />
* built again J23115.E0240 for interlab study<br />
<br />
== 15th ==<br />
* made 500&nbsp;ml LB and LB plates<br />
* made the transformation of J23115.E0240<br />
* overnight culture of K1319042 for chips<br />
<br />
== 16th ==<br />
* did plasmid preps<br />
* transformation of different reporter strains<br />
** NEB <br />
***pSEVE641_BsFbFP<br />
***pSEVA234_LasR<br />
***pSEVE641_BsFbFP pSEVA234_LasR<br />
***pSEVE641_BsFbFP pSB1C3_C0179<br />
**BL21<br />
***pSEVE641_BsFbFP pSEVA234_LasR<br />
***pSEVE641_BsFbFP pSB1C3_C0179<br />
* made chips with K1319042 in Hartman, Hartman + 20&nbsp;% glycerol, M9 medium images were taken every 30 min with the Geldoc<br />
* The PCR of Biobrick E0030 in vector pSB1C3 with primers for RFC 25 was made. The expected length is <br />
** forward primer EYFP_RFC25_F: ACGTTGAATTCGCGGCCGCTTCTAGATGGCCGGCGTGAGCAAGGGCGAGGAG<br />
** rewerse primer EYFP_RFC25_R: ATCCTGCAGCGGCCGCTACTAGTATTAACCGGTGTACAGCTCGTCCATGC<br />
* PCR product gets number K1319000 <br />
<br />
<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
|-<br />
| denature || 94 || 60"<br />
|-<br />
| denature || 94 || 30"<br />
|-<br />
| anneal || 50/60,4/64,9 || 30"<br />
|-<br />
| elongate || 72 || 60"<br />
|-<br />
| elongate || 72 || 5'<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
<br />
The agarose gel with PCR product was made.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-09-17_E0030_with_RFC25.png|title=Agarose gel with PCR products after PCR from E0030 to K1319000 |width=400px}}<br />
</center><br />
<br />
== 17th ==<br />
* the PCR product was purificated and the concentration was measured.<br />
* Restriktion of PCR product for the insert and E0030 for the vector with ''Eco''RI and PstI with following purification from agarose gel was made.<br />
<br />
== 21st ==<br />
* the ligation of PCR product and the vector that was purified from agarose was made.<br />
<br />
== 22nd ==<br />
* made 100x stocks for Hartmans minimal medium.<br />
* made about 25 HM+C plates without glucose.<br />
* K1319042 was plated on a HM+C plate<br />
<br />
== 23rd ==<br />
* made 25 new HM+C plates with 1&nbsp;% agar and 4&nbsp;g/L glucose<br />
* added 170&nbsp;µL of the glucose stock (500&nbsp;g/L) to the glucose-free HM+C-plates<br />
* 1&nbsp;L of sterile HM+glucose was prepared<br />
* K1319042 was plated on HM+C+Glucose and HM+C+Glucose drops, 3x 5&nbsp;mL HM+C+Glucose precultures were inoculated (17:00)<br />
<br />
== 24th ==<br />
* K1319042 did not grow, neither on the plates, nor on in the liquid media. The most probable cause is that the ''E.&nbsp;coli'' is missing some vitamins<br />
* Based on the [http://openwetware.org/wiki/M9_medium/supplemented M9 recipes by the Knight and Endy labs on OpenWetWare], we made a 20&nbsp;mL supplement stock solution that can be added to 1x HM media<br />
<br />
<center><br />
{| class="wikitable"<br />
|-<br />
! Component !! supplement for 1x HM [g/L] !! final 1x concentration<br />
|-<br />
| Casamino acids || 2 || 2 g/L<br />
|-<br />
| Thiamine hydrochloride || 0.3 || 300 mg/L<br />
|-<br />
| MgSO{{sub|4}}/MgSO{{sub|4}}*7H{{sub|2}}O || 0.242 / 0.494 || 2 mmol/L<br />
|-<br />
| CaCl{{sub|2}} || 0.011 || 0.1 mmol/L<br />
|}<br />
</center><br />
<br />
The powders for 1&nbsp;L of 1x HM were dissolved in 20&nbsp;mL of a 10&nbsp;%&nbsp;w/v Casamino acid stock solution and filter-sterilized (.22&nbsp;µm PES). To make agar chips, we can add 1&nbsp;mL to the hot agar mixture, together with the three 500&nbsp;µL 100x stocks for the HM.<br />
<br />
We made 250&nbsp;mL of HM+C+Glucose+Supplements plates with 1.5&nbsp;% agar.<br />
<br />
Then we plated the following combinations:<br />
<br />
<center><br />
{| class="wikitable"<br />
|-<br />
! Construct !! HM+C+Glucose+Supplements !! LB+C<br />
|-<br />
| K1319042 || - || +<br />
|-<br />
| J23101.E0240 || + || +<br />
|}<br />
</center><br />
<br />
We also prepared a 150&nbsp;mL HM+C+Glucose+Supplements culture with K1319042 to hopefully make agar chips on Friday, July 25th.<br />
<br />
Six of last weeks J23115.E0240 clones were plated on LB+C, and 5&nbsp;mL LB+C precultures were inoculated for plasmid preparation.<br />
<br />
== 25th ==<br />
The K1319042 strain did not grow on the HM plate, while another strain with the J23101.E0240 construct did. Both have the pSB1C3 backbone. To confirm the plasmids and inserts, we set up a colony PCR:<br />
<br />
<center><br />
{| class="wikitable"<br />
|-<br />
! ID !! Template !! Product Length !! Result<br />
|-<br />
| 1 || J23101.E0240 #5 || 1233 ||<br />
|-<br />
| 2 || J23101.E0240 #6 || 1233 ||<br />
|-<br />
| 3 || J23101.E0240 #5 plasmid || 1233 ||<br />
|-<br />
| 4 || K1319042 LB colony || 2053 ||<br />
|-<br />
| 5 || K1319042 plasmid || 2053 ||<br />
|-<br />
| 6 || K731520 GFP plasmid || 2437 ||<br />
|-<br />
| 7 || water || none ||<br />
|}<br />
</center><br />
<br />
Reaction volume per tube was 15&nbsp;µL. GoTaq Green Mastermix and the VF2 and VR primers were used. You can find the durations and temperatures the table below:<br />
<br />
<center><br />
{| class="wikitable"<br />
! parameter !! duration !! temp [°C]<br />
|-<br />
| denature || 10:00 || 95<br />
|-<br />
| '''denature''' || 00:30 || 95<br />
|-<br />
| '''anneal''' || 00:30 || 49<br />
|-<br />
| '''elongate''' || 02:36 || 72<br />
|-<br />
| elongate || 05:00 || 72<br />
|-<br />
| store || forever|| 8<br />
|}<br />
</center><br />
<br />
We mini-prepped the 6 overnight cultures of J23115.E0240 clones. He used 3&nbsp;mL instead of 1.5&nbsp;mL culture medium and eluted twice with 25&nbsp;µL nuclease-free water. Everything else was according to the protocol of the [http://www.gelifesciences.com/webapp/wcs/stores/servlet/productById/de/GELifeSciences/28904269 illustra plasmidPrep Mini-Spin Kit].<br />
<br />
The resulting DNA concentrations are listed in this table:<br />
<br />
<center><br />
{| class="wikitable"<br />
! clone # !! concentration [ng/µl]<br />
|-<br />
| 1 || 73.5<br />
|-<br />
| 2 || 94.5<br />
|-<br />
| 3 || 100.5<br />
|-<br />
| 4 || 53<br />
|-<br />
| 5 || 82<br />
|-<br />
| 6 || 138<br />
|}<br />
</center><br />
<br />
In the evening, we plated some strains on the different media to investigate why the K3139042 did not grow on the HM+suppl. plate. (Note: In the morning, we re-inoculated the HM+C+suppl. shake flask with cells from the LB-plate and by afternoon the culture ''did'' grow to a high cell density.)<br />
<br />
<center><br />
{| class="wikitable"<br />
! Construct !! Host strain !! LB+C !! HM+C+Glucose !! HM+C+Glucose+supplements<br />
|-<br />
| J23101.E0240 || NEB10β || ++ || - || ++<br />
|-<br />
| K1319042 || DH5alpha || ++ || - || (+)<br />
|-<br />
| K131026 || NEB10β || ++ || - || -<br />
|-<br />
| K131026 || DH5alpha || ++ || - || +<br />
|}<br />
</center><br />
<br />
We inoculated J23101.E0240 in LB and HM+C+Glucose+supplements.<br />
<br />
<!-- == 28th ==<br />
IMPORTANT: Look for customs documents and write ZHV lady!!!! --><br />
<br />
== 29th ==<br />
* inoculate 2x 150&nbsp;ml cultures HM+Glucose+C<br />
* prepared 200&nbsp;ml 1.5&nbsp;% agar<br />
* pre-cool centrifuge<br />
* centrifuge 1x 50, 1x 100 and 1x 150&nbsp;ml<br />
* make 3 kinds of chips - OOx1, ODx2, ODx3<br />
* pre cultures of K1319042 and K131026 in LB<br />
<br />
== 30th ==<br />
* made chips with K1319042 and K131026 in HM medium images were taken every 30 min with the Geldoc<br />
* print chips on LB and LB + Cam , count 2-10 colonies<br />
<br />
== 31th ==<br />
* transformation of K1319042 and K131026 in DH5α, BL21 and NEB<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/File:Aachen_14-09-17_E0030_with_RFC25.pngFile:Aachen 14-09-17 E0030 with RFC25.png2014-10-16T20:09:54Z<p>VeraA: </p>
<hr />
<div></div>VeraAhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/AugustTeam:Aachen/Notebook/Wetlab/August2014-10-16T19:49:36Z<p>VeraA: /* 6th */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= August =<br />
== 1st ==<br />
* made electrocompetent ''E.coli'' rosetta cells.<br />
* prepared cultures of K1319042 and K131026<br />
<br />
== 2nd ==<br />
* tested the OD measurement device and compared it to the spectrophotometer and the plate reader. <br />
* tested K131026 and K1319042 for fluorescence in the plate reader<br />
* did a heat shock transformation of I746909 into NEB TOP 10 cells<br />
* did an electroshock transformation of pET17-Gal3 into ''E.coli'' rosetta<br />
<br />
== 3rd ==<br />
* OD measurements of the iGEM device in comparison to the spectrophotometer were taken. <br />
* cryo cultures of K131026 and K1319042 were prepared<br />
* master plates of Gal3 #1-#10 and I746909 #1-#4 and overnight cultures<br />
<br />
== 4th ==<br />
* made cryo stocks of K1319042 and K131026 in NEB/BL21/DH5alpha, I746909 in BL21 and pET17-His-SNAP-YFP-Gal3 in ''E.&nbsp;coli'' rosetta (DE3), respectively.<br />
* made plasmid prep, most of them using 1.5&nbsp;mL culture medium, and eluted with 1x 50&nbsp;µL of ddH{{sub|2}}O. The resulting DNA concentrations are shown below.<br />
<br />
<center><br />
{| class="wikitable"<br />
! combination !! concentration [ng/µl]<br />
|-<br />
| I746909 BL21 #1 || 73.5<br />
|-<br />
| I746909 BL21 #2 || 45<br />
|-<br />
| I746909 BL21 #3 || 49<br />
|-<br />
| K1319042 DH5alpha || 60<br />
|-<br />
| K131026 DH5alpha || 150<br />
|-<br />
| pET17-Gal3 #1 || 30.5<br />
|-<br />
| pET17-Gal3 #2 || 6.4<br />
|-<br />
| pET17-Gal3 #3 || 6.3<br />
|-<br />
| pET17-Gal3 #4 || 9.4<br />
|-<br />
| pET17-Gal3 #5 || 10.1<br />
|-<br />
| pET17-Gal3 #6 || 8.2<br />
|-<br />
| pET17-Gal3 #7 || 13.8<br />
|-<br />
| pET17-Gal3 #8 || 6.9<br />
|-<br />
| pET17-Gal3 #9 || 10.2<br />
|}<br />
</center><br />
<br />
To confirm the quality of pET17-Gal3 transformations, the purified plasmids were tested by carrying out a digest. Results are shown in the below picture and table.<br />
<br />
<center><br />
{{Team:Aachen/Figure|14-08-04_Test-Digest.png|title=Test digest|subtitle=clones were test-digested|width=400px}}<br />
<br />
{| class="wikitable"<br />
! combination !! cut products[bp]<br />
|-<br />
| I746909 BL21 #1 || 2029, 947<br />
|-<br />
| K1319042 DH5alpha || 2029, 1780<br />
|-<br />
| K131026 DH5alpha || 2029, 1848<br />
|-<br />
| pET17-Gal3 #1 || 3086, 923, 1262<br />
|}<br />
</center><br />
<br />
All pET17-Gal3 clones were positive and clone #1 was selected for further experiments.<br />
* prepared an over night cultur of K1319042 for chips<br />
<br />
== 5th ==<br />
* assembly of a V{{sub|R}}=2.5&nbsp;L bioreactor for cultivation of a 1&nbsp;L expression culture.<br />
* Two precultures of 20&nbsp;mL LB+A were inoculated at 19:00<br />
* transformation of K746909 into BL21 cells and K1319000 into NEB10β cells.<br />
* made Chips with K1319042 in HM. Images were taken every 30 min with the Geldoc<br />
* made alliquots of HM, 1&nbsp;L HM + glucose + supplements and 500&nbsp;ml LB<br />
<br />
* The Quickchange mutagenesis PCR with a tamplate K1319000 and following primers was made. The PCR was made in two steps. The first step is PCR with both primers separatly and the second step includes PCR with two PCR products mixed with each other.<br />
** forward primer EYFPtoREACh1_F: AGTACAACTGGAACAGCCACAACGTCTATATC<br />
** rewerse primer EYFPtoREACh1_R: GTTGTGGCTGTTCCAGTTGTACTCCAGCTTG<br />
'''1. Step''' with 3 cycles<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| anneal || 55 || 30"<br />
|-<br />
| elongate || 72 || 30"<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
'''2. Step''' with 14 cycles<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| anneal || 55 || 60"<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-07-5_PCR_toREACh1%262.png|title=Agarose gel with PCR products after Quichchange from K1319000 to K1319001 and K1319002 |width=400px}}<br />
</center><br />
<br />
== 6th ==<br />
* transformation of J04450 in pSB1K3 and pSB1A3 in NEB10β cells.<br />
* They also did a plasmid prep of J04450 in pSB1C3 and Flo's vectors.<br />
* made precultures of NEB10βand DH5 alpha cells<br />
* inoculation of the fermenter at 11:40, and induced the fermentation of pET17-Gal3. The fermentation is expected to run 24&nbsp;h.<br />
* as the first Quickchange PCR for REACh2 was not sucsessful, it was reapeted as a gradient PCR with annealing temperatire 55&nbsp;°C, 57&nbsp;°C and 60&nbsp;°C. Then the agarose gel with PCR product samples was made.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-08-06_to_REACh2.png|title=Agarose gel with PCR products after Quichchange from K1319000 to K1319002 |width=400px}}<br />
</center><br />
<br />
== 7th ==<br />
* made media for ''Pseudomonas flourescens''<br />
** Nutrient Broth<br />
** Pseudomonas-F<br />
** Pseudomonas-P<br />
* made 2&nbsp;L LB<br />
<br />
== 8th ==<br />
* prepared 2x 60&nbsp;ml (LB + cam + IPTG) with K1319042<br />
* prepared 5&nbsp;ml K131026 and C0179<br />
* made SDS page<br />
<br />
== 9th ==<br />
* made a plate reader experiment with K131026 in LB and LB + HM<br />
<br />
== 11th ==<br />
* plated on LB + antibiotics<br />
** K131026<br />
** I746909<br />
** K13190042<br />
** I04450 in pSB1C3<br />
** I04450 in pSB1A3<br />
** I04450 in pSB1K3<br />
** pSEVA construct (pSEVA 641_FP pSEVA 234-LasR)<br />
<br />
== 13th ==<br />
* Agarose chips were prepared:<br />
** ''E. coli'' DH5α K131026 and I746909 in LB and HM<br />
** K1319042 and the pSEVA two plasmid construct in HM<br />
* Images were taken every 30 min with the Geldoc<br />
<br />
==15th ==<br />
* A bioreactor containing 1&nbsp;L Medium was inoculated with pET17-His-SNAP-YFP-Gal3.<br />
<br />
== 16th ==<br />
* The above mentioned Bioreactor was stopped after 20&nbsp;h and all cells were lysed.<br />
<br />
== 18th ==<br />
* Overnight cultures of I746909 and K131026 in LB, TB, 2x HM+ were made<br />
* 3x J23101.E0240 was plated<br />
* pET17-His-SNAP-YFP-Gal3 was purified with Äkta via a histidine-tagged protein purification.<br />
<br />
== 19th ==<br />
* Chips with K131026 and I746909 in HM were made. Images were taken every 30 min with the Geldoc<br />
* A PCR of J23101.E0240, K1319000, K1319001, K1319002 was run and the product was separated on a 1,2&nbsp;% agarose gel<br />
* A SDS gel with samples of protein purification of pET17-His-SNAP-YFP-Gal3 was made to check if the purifired samples contain the target protein - YFP-Gal3. The purification or the gel resulted in two samples with a yellow color. For the SDS we also used the two samples before and the two samples after ones with the yellow color, 6&nbsp;mL. <br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-08-18_Gal3_purification_iVA.png|title=YFP-Gal3 protein purification|subtitle=|width=400px}}<br />
</center><br />
<br />
* Two samples with YFP-Gal3 were concentrated till 1&nbsp;mL <br />
* The concentration of YFP-Gal3 was calculated on Tecan. Calculation showed concentration 13,42&nbsp;mg/ml<br />
<br />
== 20th ==<br />
* repeat PCR for REACh1 and J23101.E0240 and run a gel<br />
* plasmid prep of pSEVA BfsB, pSEVA lasR and I746909<br />
<br />
== 24th ==<br />
* made 2.5&nbsp;L LB<br />
* made chips of K131026 in NEB , DH5α and BL21 in LB and additionally K131026 in DH5α in HM+. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_24_08_2014_K131026_bl21_serie.png|title=Sensor Chips with K131026 in BL21 in LB taken with first prototyp of our own device|subtitle=Sensor chips with K131026 in BL21 in LB medium with 1,5&nbsp;% agar, lower chip induced. A) befor induction with 2&nbsp;µl of 5000&nbsp;µg/ml HSL (3-oxo-C12) B) 0.5&nbsp;h after induction C) 1&nbsp;h after induction D) 1.5&nbsp;h after induction E) 2&nbsp;h after induction F) 2.5&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
== 25th ==<br />
* did a plasmid restriction of I20260 (EcoRI,PstI), J23115 (EcoRI, SpeI), K516032 (XbaI,PstI), and J23101 (EcoRI, SpeI)<br />
* tested the growth of ''Pseudomonas fluorescens'' in different liquid media for high OD and strong fluorescence. She tested Standard I medium, Cetrimide medium and Pseudomonas-F medium, and Pseudomonas-F medium supplemented with 300&nbsp;µL Fe3+ in 500&nbsp;mL flasks with a filling volume of 30&nbsp;mL. The flasks were inoculated with ''P. fluorescens'' cells on Standard I agar, and incubated at 30&nbsp;°C at 250&nbsp;rpm.<br />
* prepared over night cultures of K131026 in DH5α and NEB for chips<br />
* prepared 2x 5&nbsp;ml of pSB1C3, psB3K3 and pSB1A2 for plasmid prep<br />
<br />
== 26th ==<br />
* ligation of J23115 and K516032 to J23115.K516032, and J23101 and K516032 to J23101.K516032, respectively.<br />
* plasmid prep of I20260, K516032 and B0034<br />
* restriction of plasmids I20260, K516032, B0034 with EcoRI and PstI<br />
* gel with restricted the I20260, K516032 and B0034 was run<br />
* purification of vector backbones pSB1A2, pSB3K3 and pSB1C3<br />
* restriciton of synthesized TEV protease with EcoRI and PstI<br />
* qualitatively tested the ''Pseudomonas fluorescens'' that had grown over night for OD and fluorescence. She determined that Pseudomonas-F medium is the most adequate for the cultivation of the strain we use, since both OD and fluorescence were best in the flask containing the respective medium. Growth in the Pseudomonas-F medium supplemented with 300&nbsp;µg/L Fe3+ was weaker, however, fluorescence was also successfully suppressed.<br />
* made chips with K131026 in DH5α and NEB, in LB and LB + 10&nbsp;% glycerol. Images were taken with our own device every 10 min (illumination problems).<br />
<center><br />
{{Team:Aachen/Figure|Aachen_26_08_2014_K131026_neb_serie.png|title=Sensor Chips with K131026 in NEB in LB taken with first prototyp of our own device|subtitle=Sensor chips with K131026 in NEB in LB medium with 1,5&nbsp;% agar. Chip on the top induced with 0.5&nbsp;µl of 500&nbsp;µg/ml HSL and on the bottom with less than 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12). A) befor induction B) 1&nbsp;h after induction C) 1.5&nbsp;h after induction D) 2&nbsp;h after induction |width=600px}}<br />
</center><br />
* plasmid prep of the back bones, restriction and gel purification<br />
<br />
== 27th ==<br />
* transformation of some BioBricks<br />
* ligation of J23101.K516032 into pSB3K3 and J23115.K516032 into pSB3K3 and K1319004 into pSB1C3<br />
* transformation of K1319004 into pUC and pSB1C3, and J04450 into pSB1K3 and pSB1A3, respectively<br />
<br />
== 28th ==<br />
* transformation of some BioBricks<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/AugustTeam:Aachen/Notebook/Wetlab/August2014-10-16T19:49:07Z<p>VeraA: /* 5th */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= August =<br />
== 1st ==<br />
* made electrocompetent ''E.coli'' rosetta cells.<br />
* prepared cultures of K1319042 and K131026<br />
<br />
== 2nd ==<br />
* tested the OD measurement device and compared it to the spectrophotometer and the plate reader. <br />
* tested K131026 and K1319042 for fluorescence in the plate reader<br />
* did a heat shock transformation of I746909 into NEB TOP 10 cells<br />
* did an electroshock transformation of pET17-Gal3 into ''E.coli'' rosetta<br />
<br />
== 3rd ==<br />
* OD measurements of the iGEM device in comparison to the spectrophotometer were taken. <br />
* cryo cultures of K131026 and K1319042 were prepared<br />
* master plates of Gal3 #1-#10 and I746909 #1-#4 and overnight cultures<br />
<br />
== 4th ==<br />
* made cryo stocks of K1319042 and K131026 in NEB/BL21/DH5alpha, I746909 in BL21 and pET17-His-SNAP-YFP-Gal3 in ''E.&nbsp;coli'' rosetta (DE3), respectively.<br />
* made plasmid prep, most of them using 1.5&nbsp;mL culture medium, and eluted with 1x 50&nbsp;µL of ddH{{sub|2}}O. The resulting DNA concentrations are shown below.<br />
<br />
<center><br />
{| class="wikitable"<br />
! combination !! concentration [ng/µl]<br />
|-<br />
| I746909 BL21 #1 || 73.5<br />
|-<br />
| I746909 BL21 #2 || 45<br />
|-<br />
| I746909 BL21 #3 || 49<br />
|-<br />
| K1319042 DH5alpha || 60<br />
|-<br />
| K131026 DH5alpha || 150<br />
|-<br />
| pET17-Gal3 #1 || 30.5<br />
|-<br />
| pET17-Gal3 #2 || 6.4<br />
|-<br />
| pET17-Gal3 #3 || 6.3<br />
|-<br />
| pET17-Gal3 #4 || 9.4<br />
|-<br />
| pET17-Gal3 #5 || 10.1<br />
|-<br />
| pET17-Gal3 #6 || 8.2<br />
|-<br />
| pET17-Gal3 #7 || 13.8<br />
|-<br />
| pET17-Gal3 #8 || 6.9<br />
|-<br />
| pET17-Gal3 #9 || 10.2<br />
|}<br />
</center><br />
<br />
To confirm the quality of pET17-Gal3 transformations, the purified plasmids were tested by carrying out a digest. Results are shown in the below picture and table.<br />
<br />
<center><br />
{{Team:Aachen/Figure|14-08-04_Test-Digest.png|title=Test digest|subtitle=clones were test-digested|width=400px}}<br />
<br />
{| class="wikitable"<br />
! combination !! cut products[bp]<br />
|-<br />
| I746909 BL21 #1 || 2029, 947<br />
|-<br />
| K1319042 DH5alpha || 2029, 1780<br />
|-<br />
| K131026 DH5alpha || 2029, 1848<br />
|-<br />
| pET17-Gal3 #1 || 3086, 923, 1262<br />
|}<br />
</center><br />
<br />
All pET17-Gal3 clones were positive and clone #1 was selected for further experiments.<br />
* prepared an over night cultur of K1319042 for chips<br />
<br />
== 5th ==<br />
* assembly of a V{{sub|R}}=2.5&nbsp;L bioreactor for cultivation of a 1&nbsp;L expression culture.<br />
* Two precultures of 20&nbsp;mL LB+A were inoculated at 19:00<br />
* transformation of K746909 into BL21 cells and K1319000 into NEB10β cells.<br />
* made Chips with K1319042 in HM. Images were taken every 30 min with the Geldoc<br />
* made alliquots of HM, 1&nbsp;L HM + glucose + supplements and 500&nbsp;ml LB<br />
<br />
* The Quickchange mutagenesis PCR with a tamplate K1319000 and following primers was made. The PCR was made in two steps. The first step is PCR with both primers separatly and the second step includes PCR with two PCR products mixed with each other.<br />
** forward primer EYFPtoREACh1_F: AGTACAACTGGAACAGCCACAACGTCTATATC<br />
** rewerse primer EYFPtoREACh1_R: GTTGTGGCTGTTCCAGTTGTACTCCAGCTTG<br />
'''1. Step''' with 3 cycles<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| anneal || 55 || 30"<br />
|-<br />
| elongate || 72 || 30"<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
'''2. Step''' with 14 cycles<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| anneal || 55 || 60"<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-07-5_PCR_toREACh1%262.png|title=Agarose gel with PCR products after Quichchange from K1319000 to K1319001 and K1319002 |width=400px}}<br />
</center><br />
<br />
== 6th ==<br />
* transformation of J04450 in pSB1K3 and pSB1A3 in NEB10β cells.<br />
* They also did a plasmid prep of J04450 in pSB1C3 and Flo's vectors.<br />
* made precultures of NEB10βand DH5 alpha cells<br />
* inoculation of the fermenter at 11:40, and induced the fermentation of pET17-Gal3. The fermentation is expected to run 24&nbsp;h.<br />
* as the first Quickchange PCR for REACh2 was not sucsessful, it was reapeted as a gradient PCR with annealing temperatire 55&nbsp;°C, 57&nbsp;°C and 60&nbsp;°C. Then the agarose gel with PCR product samples was made.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-08-06_to_REACh2.png|title=Agarose gel with PCR products after Quichchange from K1319000 to K1319002 |width=600px}}<br />
</center><br />
<br />
== 7th ==<br />
* made media for ''Pseudomonas flourescens''<br />
** Nutrient Broth<br />
** Pseudomonas-F<br />
** Pseudomonas-P<br />
* made 2&nbsp;L LB<br />
<br />
== 8th ==<br />
* prepared 2x 60&nbsp;ml (LB + cam + IPTG) with K1319042<br />
* prepared 5&nbsp;ml K131026 and C0179<br />
* made SDS page<br />
<br />
== 9th ==<br />
* made a plate reader experiment with K131026 in LB and LB + HM<br />
<br />
== 11th ==<br />
* plated on LB + antibiotics<br />
** K131026<br />
** I746909<br />
** K13190042<br />
** I04450 in pSB1C3<br />
** I04450 in pSB1A3<br />
** I04450 in pSB1K3<br />
** pSEVA construct (pSEVA 641_FP pSEVA 234-LasR)<br />
<br />
== 13th ==<br />
* Agarose chips were prepared:<br />
** ''E. coli'' DH5α K131026 and I746909 in LB and HM<br />
** K1319042 and the pSEVA two plasmid construct in HM<br />
* Images were taken every 30 min with the Geldoc<br />
<br />
==15th ==<br />
* A bioreactor containing 1&nbsp;L Medium was inoculated with pET17-His-SNAP-YFP-Gal3.<br />
<br />
== 16th ==<br />
* The above mentioned Bioreactor was stopped after 20&nbsp;h and all cells were lysed.<br />
<br />
== 18th ==<br />
* Overnight cultures of I746909 and K131026 in LB, TB, 2x HM+ were made<br />
* 3x J23101.E0240 was plated<br />
* pET17-His-SNAP-YFP-Gal3 was purified with Äkta via a histidine-tagged protein purification.<br />
<br />
== 19th ==<br />
* Chips with K131026 and I746909 in HM were made. Images were taken every 30 min with the Geldoc<br />
* A PCR of J23101.E0240, K1319000, K1319001, K1319002 was run and the product was separated on a 1,2&nbsp;% agarose gel<br />
* A SDS gel with samples of protein purification of pET17-His-SNAP-YFP-Gal3 was made to check if the purifired samples contain the target protein - YFP-Gal3. The purification or the gel resulted in two samples with a yellow color. For the SDS we also used the two samples before and the two samples after ones with the yellow color, 6&nbsp;mL. <br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-08-18_Gal3_purification_iVA.png|title=YFP-Gal3 protein purification|subtitle=|width=400px}}<br />
</center><br />
<br />
* Two samples with YFP-Gal3 were concentrated till 1&nbsp;mL <br />
* The concentration of YFP-Gal3 was calculated on Tecan. Calculation showed concentration 13,42&nbsp;mg/ml<br />
<br />
== 20th ==<br />
* repeat PCR for REACh1 and J23101.E0240 and run a gel<br />
* plasmid prep of pSEVA BfsB, pSEVA lasR and I746909<br />
<br />
== 24th ==<br />
* made 2.5&nbsp;L LB<br />
* made chips of K131026 in NEB , DH5α and BL21 in LB and additionally K131026 in DH5α in HM+. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_24_08_2014_K131026_bl21_serie.png|title=Sensor Chips with K131026 in BL21 in LB taken with first prototyp of our own device|subtitle=Sensor chips with K131026 in BL21 in LB medium with 1,5&nbsp;% agar, lower chip induced. A) befor induction with 2&nbsp;µl of 5000&nbsp;µg/ml HSL (3-oxo-C12) B) 0.5&nbsp;h after induction C) 1&nbsp;h after induction D) 1.5&nbsp;h after induction E) 2&nbsp;h after induction F) 2.5&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
== 25th ==<br />
* did a plasmid restriction of I20260 (EcoRI,PstI), J23115 (EcoRI, SpeI), K516032 (XbaI,PstI), and J23101 (EcoRI, SpeI)<br />
* tested the growth of ''Pseudomonas fluorescens'' in different liquid media for high OD and strong fluorescence. She tested Standard I medium, Cetrimide medium and Pseudomonas-F medium, and Pseudomonas-F medium supplemented with 300&nbsp;µL Fe3+ in 500&nbsp;mL flasks with a filling volume of 30&nbsp;mL. The flasks were inoculated with ''P. fluorescens'' cells on Standard I agar, and incubated at 30&nbsp;°C at 250&nbsp;rpm.<br />
* prepared over night cultures of K131026 in DH5α and NEB for chips<br />
* prepared 2x 5&nbsp;ml of pSB1C3, psB3K3 and pSB1A2 for plasmid prep<br />
<br />
== 26th ==<br />
* ligation of J23115 and K516032 to J23115.K516032, and J23101 and K516032 to J23101.K516032, respectively.<br />
* plasmid prep of I20260, K516032 and B0034<br />
* restriction of plasmids I20260, K516032, B0034 with EcoRI and PstI<br />
* gel with restricted the I20260, K516032 and B0034 was run<br />
* purification of vector backbones pSB1A2, pSB3K3 and pSB1C3<br />
* restriciton of synthesized TEV protease with EcoRI and PstI<br />
* qualitatively tested the ''Pseudomonas fluorescens'' that had grown over night for OD and fluorescence. She determined that Pseudomonas-F medium is the most adequate for the cultivation of the strain we use, since both OD and fluorescence were best in the flask containing the respective medium. Growth in the Pseudomonas-F medium supplemented with 300&nbsp;µg/L Fe3+ was weaker, however, fluorescence was also successfully suppressed.<br />
* made chips with K131026 in DH5α and NEB, in LB and LB + 10&nbsp;% glycerol. Images were taken with our own device every 10 min (illumination problems).<br />
<center><br />
{{Team:Aachen/Figure|Aachen_26_08_2014_K131026_neb_serie.png|title=Sensor Chips with K131026 in NEB in LB taken with first prototyp of our own device|subtitle=Sensor chips with K131026 in NEB in LB medium with 1,5&nbsp;% agar. Chip on the top induced with 0.5&nbsp;µl of 500&nbsp;µg/ml HSL and on the bottom with less than 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12). A) befor induction B) 1&nbsp;h after induction C) 1.5&nbsp;h after induction D) 2&nbsp;h after induction |width=600px}}<br />
</center><br />
* plasmid prep of the back bones, restriction and gel purification<br />
<br />
== 27th ==<br />
* transformation of some BioBricks<br />
* ligation of J23101.K516032 into pSB3K3 and J23115.K516032 into pSB3K3 and K1319004 into pSB1C3<br />
* transformation of K1319004 into pUC and pSB1C3, and J04450 into pSB1K3 and pSB1A3, respectively<br />
<br />
== 28th ==<br />
* transformation of some BioBricks<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/AugustTeam:Aachen/Notebook/Wetlab/August2014-10-16T19:48:43Z<p>VeraA: /* 5th */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= August =<br />
== 1st ==<br />
* made electrocompetent ''E.coli'' rosetta cells.<br />
* prepared cultures of K1319042 and K131026<br />
<br />
== 2nd ==<br />
* tested the OD measurement device and compared it to the spectrophotometer and the plate reader. <br />
* tested K131026 and K1319042 for fluorescence in the plate reader<br />
* did a heat shock transformation of I746909 into NEB TOP 10 cells<br />
* did an electroshock transformation of pET17-Gal3 into ''E.coli'' rosetta<br />
<br />
== 3rd ==<br />
* OD measurements of the iGEM device in comparison to the spectrophotometer were taken. <br />
* cryo cultures of K131026 and K1319042 were prepared<br />
* master plates of Gal3 #1-#10 and I746909 #1-#4 and overnight cultures<br />
<br />
== 4th ==<br />
* made cryo stocks of K1319042 and K131026 in NEB/BL21/DH5alpha, I746909 in BL21 and pET17-His-SNAP-YFP-Gal3 in ''E.&nbsp;coli'' rosetta (DE3), respectively.<br />
* made plasmid prep, most of them using 1.5&nbsp;mL culture medium, and eluted with 1x 50&nbsp;µL of ddH{{sub|2}}O. The resulting DNA concentrations are shown below.<br />
<br />
<center><br />
{| class="wikitable"<br />
! combination !! concentration [ng/µl]<br />
|-<br />
| I746909 BL21 #1 || 73.5<br />
|-<br />
| I746909 BL21 #2 || 45<br />
|-<br />
| I746909 BL21 #3 || 49<br />
|-<br />
| K1319042 DH5alpha || 60<br />
|-<br />
| K131026 DH5alpha || 150<br />
|-<br />
| pET17-Gal3 #1 || 30.5<br />
|-<br />
| pET17-Gal3 #2 || 6.4<br />
|-<br />
| pET17-Gal3 #3 || 6.3<br />
|-<br />
| pET17-Gal3 #4 || 9.4<br />
|-<br />
| pET17-Gal3 #5 || 10.1<br />
|-<br />
| pET17-Gal3 #6 || 8.2<br />
|-<br />
| pET17-Gal3 #7 || 13.8<br />
|-<br />
| pET17-Gal3 #8 || 6.9<br />
|-<br />
| pET17-Gal3 #9 || 10.2<br />
|}<br />
</center><br />
<br />
To confirm the quality of pET17-Gal3 transformations, the purified plasmids were tested by carrying out a digest. Results are shown in the below picture and table.<br />
<br />
<center><br />
{{Team:Aachen/Figure|14-08-04_Test-Digest.png|title=Test digest|subtitle=clones were test-digested|width=400px}}<br />
<br />
{| class="wikitable"<br />
! combination !! cut products[bp]<br />
|-<br />
| I746909 BL21 #1 || 2029, 947<br />
|-<br />
| K1319042 DH5alpha || 2029, 1780<br />
|-<br />
| K131026 DH5alpha || 2029, 1848<br />
|-<br />
| pET17-Gal3 #1 || 3086, 923, 1262<br />
|}<br />
</center><br />
<br />
All pET17-Gal3 clones were positive and clone #1 was selected for further experiments.<br />
* prepared an over night cultur of K1319042 for chips<br />
<br />
== 5th ==<br />
* assembly of a V{{sub|R}}=2.5&nbsp;L bioreactor for cultivation of a 1&nbsp;L expression culture.<br />
* Two precultures of 20&nbsp;mL LB+A were inoculated at 19:00<br />
* transformation of K746909 into BL21 cells and K1319000 into NEB10β cells.<br />
* made Chips with K1319042 in HM. Images were taken every 30 min with the Geldoc<br />
* made alliquots of HM, 1&nbsp;L HM + glucose + supplements and 500&nbsp;ml LB<br />
<br />
* The Quickchange mutagenesis PCR with a tamplate K1319000 and following primers was made. The PCR was made in two steps. The first step is PCR with both primers separatly and the second step includes PCR with two PCR products mixed with each other.<br />
** forward primer EYFPtoREACh1_F: AGTACAACTGGAACAGCCACAACGTCTATATC<br />
** rewerse primer EYFPtoREACh1_R: GTTGTGGCTGTTCCAGTTGTACTCCAGCTTG<br />
'''1. Step''' with 3 cycles<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| anneal || 55 || 30"<br />
|-<br />
| elongate || 72 || 30"<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
'''2. Step''' with 14 cycles<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| anneal || 55 || 60"<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-07-5_PCR_toREACh1%262.png|title=Agarose gel with PCR products after Quichchange from K1319000 to K1319001 and K1319002 |width=800px}}<br />
</center><br />
<br />
== 6th ==<br />
* transformation of J04450 in pSB1K3 and pSB1A3 in NEB10β cells.<br />
* They also did a plasmid prep of J04450 in pSB1C3 and Flo's vectors.<br />
* made precultures of NEB10βand DH5 alpha cells<br />
* inoculation of the fermenter at 11:40, and induced the fermentation of pET17-Gal3. The fermentation is expected to run 24&nbsp;h.<br />
* as the first Quickchange PCR for REACh2 was not sucsessful, it was reapeted as a gradient PCR with annealing temperatire 55&nbsp;°C, 57&nbsp;°C and 60&nbsp;°C. Then the agarose gel with PCR product samples was made.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-08-06_to_REACh2.png|title=Agarose gel with PCR products after Quichchange from K1319000 to K1319002 |width=600px}}<br />
</center><br />
<br />
== 7th ==<br />
* made media for ''Pseudomonas flourescens''<br />
** Nutrient Broth<br />
** Pseudomonas-F<br />
** Pseudomonas-P<br />
* made 2&nbsp;L LB<br />
<br />
== 8th ==<br />
* prepared 2x 60&nbsp;ml (LB + cam + IPTG) with K1319042<br />
* prepared 5&nbsp;ml K131026 and C0179<br />
* made SDS page<br />
<br />
== 9th ==<br />
* made a plate reader experiment with K131026 in LB and LB + HM<br />
<br />
== 11th ==<br />
* plated on LB + antibiotics<br />
** K131026<br />
** I746909<br />
** K13190042<br />
** I04450 in pSB1C3<br />
** I04450 in pSB1A3<br />
** I04450 in pSB1K3<br />
** pSEVA construct (pSEVA 641_FP pSEVA 234-LasR)<br />
<br />
== 13th ==<br />
* Agarose chips were prepared:<br />
** ''E. coli'' DH5α K131026 and I746909 in LB and HM<br />
** K1319042 and the pSEVA two plasmid construct in HM<br />
* Images were taken every 30 min with the Geldoc<br />
<br />
==15th ==<br />
* A bioreactor containing 1&nbsp;L Medium was inoculated with pET17-His-SNAP-YFP-Gal3.<br />
<br />
== 16th ==<br />
* The above mentioned Bioreactor was stopped after 20&nbsp;h and all cells were lysed.<br />
<br />
== 18th ==<br />
* Overnight cultures of I746909 and K131026 in LB, TB, 2x HM+ were made<br />
* 3x J23101.E0240 was plated<br />
* pET17-His-SNAP-YFP-Gal3 was purified with Äkta via a histidine-tagged protein purification.<br />
<br />
== 19th ==<br />
* Chips with K131026 and I746909 in HM were made. Images were taken every 30 min with the Geldoc<br />
* A PCR of J23101.E0240, K1319000, K1319001, K1319002 was run and the product was separated on a 1,2&nbsp;% agarose gel<br />
* A SDS gel with samples of protein purification of pET17-His-SNAP-YFP-Gal3 was made to check if the purifired samples contain the target protein - YFP-Gal3. The purification or the gel resulted in two samples with a yellow color. For the SDS we also used the two samples before and the two samples after ones with the yellow color, 6&nbsp;mL. <br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-08-18_Gal3_purification_iVA.png|title=YFP-Gal3 protein purification|subtitle=|width=400px}}<br />
</center><br />
<br />
* Two samples with YFP-Gal3 were concentrated till 1&nbsp;mL <br />
* The concentration of YFP-Gal3 was calculated on Tecan. Calculation showed concentration 13,42&nbsp;mg/ml<br />
<br />
== 20th ==<br />
* repeat PCR for REACh1 and J23101.E0240 and run a gel<br />
* plasmid prep of pSEVA BfsB, pSEVA lasR and I746909<br />
<br />
== 24th ==<br />
* made 2.5&nbsp;L LB<br />
* made chips of K131026 in NEB , DH5α and BL21 in LB and additionally K131026 in DH5α in HM+. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_24_08_2014_K131026_bl21_serie.png|title=Sensor Chips with K131026 in BL21 in LB taken with first prototyp of our own device|subtitle=Sensor chips with K131026 in BL21 in LB medium with 1,5&nbsp;% agar, lower chip induced. A) befor induction with 2&nbsp;µl of 5000&nbsp;µg/ml HSL (3-oxo-C12) B) 0.5&nbsp;h after induction C) 1&nbsp;h after induction D) 1.5&nbsp;h after induction E) 2&nbsp;h after induction F) 2.5&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
== 25th ==<br />
* did a plasmid restriction of I20260 (EcoRI,PstI), J23115 (EcoRI, SpeI), K516032 (XbaI,PstI), and J23101 (EcoRI, SpeI)<br />
* tested the growth of ''Pseudomonas fluorescens'' in different liquid media for high OD and strong fluorescence. She tested Standard I medium, Cetrimide medium and Pseudomonas-F medium, and Pseudomonas-F medium supplemented with 300&nbsp;µL Fe3+ in 500&nbsp;mL flasks with a filling volume of 30&nbsp;mL. The flasks were inoculated with ''P. fluorescens'' cells on Standard I agar, and incubated at 30&nbsp;°C at 250&nbsp;rpm.<br />
* prepared over night cultures of K131026 in DH5α and NEB for chips<br />
* prepared 2x 5&nbsp;ml of pSB1C3, psB3K3 and pSB1A2 for plasmid prep<br />
<br />
== 26th ==<br />
* ligation of J23115 and K516032 to J23115.K516032, and J23101 and K516032 to J23101.K516032, respectively.<br />
* plasmid prep of I20260, K516032 and B0034<br />
* restriction of plasmids I20260, K516032, B0034 with EcoRI and PstI<br />
* gel with restricted the I20260, K516032 and B0034 was run<br />
* purification of vector backbones pSB1A2, pSB3K3 and pSB1C3<br />
* restriciton of synthesized TEV protease with EcoRI and PstI<br />
* qualitatively tested the ''Pseudomonas fluorescens'' that had grown over night for OD and fluorescence. She determined that Pseudomonas-F medium is the most adequate for the cultivation of the strain we use, since both OD and fluorescence were best in the flask containing the respective medium. Growth in the Pseudomonas-F medium supplemented with 300&nbsp;µg/L Fe3+ was weaker, however, fluorescence was also successfully suppressed.<br />
* made chips with K131026 in DH5α and NEB, in LB and LB + 10&nbsp;% glycerol. Images were taken with our own device every 10 min (illumination problems).<br />
<center><br />
{{Team:Aachen/Figure|Aachen_26_08_2014_K131026_neb_serie.png|title=Sensor Chips with K131026 in NEB in LB taken with first prototyp of our own device|subtitle=Sensor chips with K131026 in NEB in LB medium with 1,5&nbsp;% agar. Chip on the top induced with 0.5&nbsp;µl of 500&nbsp;µg/ml HSL and on the bottom with less than 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12). A) befor induction B) 1&nbsp;h after induction C) 1.5&nbsp;h after induction D) 2&nbsp;h after induction |width=600px}}<br />
</center><br />
* plasmid prep of the back bones, restriction and gel purification<br />
<br />
== 27th ==<br />
* transformation of some BioBricks<br />
* ligation of J23101.K516032 into pSB3K3 and J23115.K516032 into pSB3K3 and K1319004 into pSB1C3<br />
* transformation of K1319004 into pUC and pSB1C3, and J04450 into pSB1K3 and pSB1A3, respectively<br />
<br />
== 28th ==<br />
* transformation of some BioBricks<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/AugustTeam:Aachen/Notebook/Wetlab/August2014-10-16T19:47:43Z<p>VeraA: /* 5th */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= August =<br />
== 1st ==<br />
* made electrocompetent ''E.coli'' rosetta cells.<br />
* prepared cultures of K1319042 and K131026<br />
<br />
== 2nd ==<br />
* tested the OD measurement device and compared it to the spectrophotometer and the plate reader. <br />
* tested K131026 and K1319042 for fluorescence in the plate reader<br />
* did a heat shock transformation of I746909 into NEB TOP 10 cells<br />
* did an electroshock transformation of pET17-Gal3 into ''E.coli'' rosetta<br />
<br />
== 3rd ==<br />
* OD measurements of the iGEM device in comparison to the spectrophotometer were taken. <br />
* cryo cultures of K131026 and K1319042 were prepared<br />
* master plates of Gal3 #1-#10 and I746909 #1-#4 and overnight cultures<br />
<br />
== 4th ==<br />
* made cryo stocks of K1319042 and K131026 in NEB/BL21/DH5alpha, I746909 in BL21 and pET17-His-SNAP-YFP-Gal3 in ''E.&nbsp;coli'' rosetta (DE3), respectively.<br />
* made plasmid prep, most of them using 1.5&nbsp;mL culture medium, and eluted with 1x 50&nbsp;µL of ddH{{sub|2}}O. The resulting DNA concentrations are shown below.<br />
<br />
<center><br />
{| class="wikitable"<br />
! combination !! concentration [ng/µl]<br />
|-<br />
| I746909 BL21 #1 || 73.5<br />
|-<br />
| I746909 BL21 #2 || 45<br />
|-<br />
| I746909 BL21 #3 || 49<br />
|-<br />
| K1319042 DH5alpha || 60<br />
|-<br />
| K131026 DH5alpha || 150<br />
|-<br />
| pET17-Gal3 #1 || 30.5<br />
|-<br />
| pET17-Gal3 #2 || 6.4<br />
|-<br />
| pET17-Gal3 #3 || 6.3<br />
|-<br />
| pET17-Gal3 #4 || 9.4<br />
|-<br />
| pET17-Gal3 #5 || 10.1<br />
|-<br />
| pET17-Gal3 #6 || 8.2<br />
|-<br />
| pET17-Gal3 #7 || 13.8<br />
|-<br />
| pET17-Gal3 #8 || 6.9<br />
|-<br />
| pET17-Gal3 #9 || 10.2<br />
|}<br />
</center><br />
<br />
To confirm the quality of pET17-Gal3 transformations, the purified plasmids were tested by carrying out a digest. Results are shown in the below picture and table.<br />
<br />
<center><br />
{{Team:Aachen/Figure|14-08-04_Test-Digest.png|title=Test digest|subtitle=clones were test-digested|width=400px}}<br />
<br />
{| class="wikitable"<br />
! combination !! cut products[bp]<br />
|-<br />
| I746909 BL21 #1 || 2029, 947<br />
|-<br />
| K1319042 DH5alpha || 2029, 1780<br />
|-<br />
| K131026 DH5alpha || 2029, 1848<br />
|-<br />
| pET17-Gal3 #1 || 3086, 923, 1262<br />
|}<br />
</center><br />
<br />
All pET17-Gal3 clones were positive and clone #1 was selected for further experiments.<br />
* prepared an over night cultur of K1319042 for chips<br />
<br />
== 5th ==<br />
* assembly of a V{{sub|R}}=2.5&nbsp;L bioreactor for cultivation of a 1&nbsp;L expression culture.<br />
* Two precultures of 20&nbsp;mL LB+A were inoculated at 19:00<br />
* transformation of K746909 into BL21 cells and K1319000 into NEB10β cells.<br />
* made Chips with K1319042 in HM. Images were taken every 30 min with the Geldoc<br />
* made alliquots of HM, 1&nbsp;L HM + glucose + supplements and 500&nbsp;ml LB<br />
<br />
* The Quickchange mutagenesis PCR with a tamplate K1319000 and following primers was made. The PCR was made in two steps. The first step is PCR with both primers separatly and the second step includes PCR with two PCR products mixed with each other.<br />
** forward primer EYFPtoREACh1_F: AGTACAACTGGAACAGCCACAACGTCTATATC<br />
** rewerse primer EYFPtoREACh1_R: GTTGTGGCTGTTCCAGTTGTACTCCAGCTTG<br />
'''1. Step''' with 3 cycles<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| anneal || 55 || 30"<br />
|-<br />
| elongate || 72 || 30"<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
'''2. Step''' with 14 cycles<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| anneal || 55 || 60"<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-07-5_PCR_toREACh1%262.png|title=Agarose gel with PCR products after Quichchange from K1319000 to K1319001 and K1319002 |width=600px}}<br />
</center><br />
<br />
== 6th ==<br />
* transformation of J04450 in pSB1K3 and pSB1A3 in NEB10β cells.<br />
* They also did a plasmid prep of J04450 in pSB1C3 and Flo's vectors.<br />
* made precultures of NEB10βand DH5 alpha cells<br />
* inoculation of the fermenter at 11:40, and induced the fermentation of pET17-Gal3. The fermentation is expected to run 24&nbsp;h.<br />
* as the first Quickchange PCR for REACh2 was not sucsessful, it was reapeted as a gradient PCR with annealing temperatire 55&nbsp;°C, 57&nbsp;°C and 60&nbsp;°C. Then the agarose gel with PCR product samples was made.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-08-06_to_REACh2.png|title=Agarose gel with PCR products after Quichchange from K1319000 to K1319002 |width=600px}}<br />
</center><br />
<br />
== 7th ==<br />
* made media for ''Pseudomonas flourescens''<br />
** Nutrient Broth<br />
** Pseudomonas-F<br />
** Pseudomonas-P<br />
* made 2&nbsp;L LB<br />
<br />
== 8th ==<br />
* prepared 2x 60&nbsp;ml (LB + cam + IPTG) with K1319042<br />
* prepared 5&nbsp;ml K131026 and C0179<br />
* made SDS page<br />
<br />
== 9th ==<br />
* made a plate reader experiment with K131026 in LB and LB + HM<br />
<br />
== 11th ==<br />
* plated on LB + antibiotics<br />
** K131026<br />
** I746909<br />
** K13190042<br />
** I04450 in pSB1C3<br />
** I04450 in pSB1A3<br />
** I04450 in pSB1K3<br />
** pSEVA construct (pSEVA 641_FP pSEVA 234-LasR)<br />
<br />
== 13th ==<br />
* Agarose chips were prepared:<br />
** ''E. coli'' DH5α K131026 and I746909 in LB and HM<br />
** K1319042 and the pSEVA two plasmid construct in HM<br />
* Images were taken every 30 min with the Geldoc<br />
<br />
==15th ==<br />
* A bioreactor containing 1&nbsp;L Medium was inoculated with pET17-His-SNAP-YFP-Gal3.<br />
<br />
== 16th ==<br />
* The above mentioned Bioreactor was stopped after 20&nbsp;h and all cells were lysed.<br />
<br />
== 18th ==<br />
* Overnight cultures of I746909 and K131026 in LB, TB, 2x HM+ were made<br />
* 3x J23101.E0240 was plated<br />
* pET17-His-SNAP-YFP-Gal3 was purified with Äkta via a histidine-tagged protein purification.<br />
<br />
== 19th ==<br />
* Chips with K131026 and I746909 in HM were made. Images were taken every 30 min with the Geldoc<br />
* A PCR of J23101.E0240, K1319000, K1319001, K1319002 was run and the product was separated on a 1,2&nbsp;% agarose gel<br />
* A SDS gel with samples of protein purification of pET17-His-SNAP-YFP-Gal3 was made to check if the purifired samples contain the target protein - YFP-Gal3. The purification or the gel resulted in two samples with a yellow color. For the SDS we also used the two samples before and the two samples after ones with the yellow color, 6&nbsp;mL. <br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-08-18_Gal3_purification_iVA.png|title=YFP-Gal3 protein purification|subtitle=|width=400px}}<br />
</center><br />
<br />
* Two samples with YFP-Gal3 were concentrated till 1&nbsp;mL <br />
* The concentration of YFP-Gal3 was calculated on Tecan. Calculation showed concentration 13,42&nbsp;mg/ml<br />
<br />
== 20th ==<br />
* repeat PCR for REACh1 and J23101.E0240 and run a gel<br />
* plasmid prep of pSEVA BfsB, pSEVA lasR and I746909<br />
<br />
== 24th ==<br />
* made 2.5&nbsp;L LB<br />
* made chips of K131026 in NEB , DH5α and BL21 in LB and additionally K131026 in DH5α in HM+. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_24_08_2014_K131026_bl21_serie.png|title=Sensor Chips with K131026 in BL21 in LB taken with first prototyp of our own device|subtitle=Sensor chips with K131026 in BL21 in LB medium with 1,5&nbsp;% agar, lower chip induced. A) befor induction with 2&nbsp;µl of 5000&nbsp;µg/ml HSL (3-oxo-C12) B) 0.5&nbsp;h after induction C) 1&nbsp;h after induction D) 1.5&nbsp;h after induction E) 2&nbsp;h after induction F) 2.5&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
== 25th ==<br />
* did a plasmid restriction of I20260 (EcoRI,PstI), J23115 (EcoRI, SpeI), K516032 (XbaI,PstI), and J23101 (EcoRI, SpeI)<br />
* tested the growth of ''Pseudomonas fluorescens'' in different liquid media for high OD and strong fluorescence. She tested Standard I medium, Cetrimide medium and Pseudomonas-F medium, and Pseudomonas-F medium supplemented with 300&nbsp;µL Fe3+ in 500&nbsp;mL flasks with a filling volume of 30&nbsp;mL. The flasks were inoculated with ''P. fluorescens'' cells on Standard I agar, and incubated at 30&nbsp;°C at 250&nbsp;rpm.<br />
* prepared over night cultures of K131026 in DH5α and NEB for chips<br />
* prepared 2x 5&nbsp;ml of pSB1C3, psB3K3 and pSB1A2 for plasmid prep<br />
<br />
== 26th ==<br />
* ligation of J23115 and K516032 to J23115.K516032, and J23101 and K516032 to J23101.K516032, respectively.<br />
* plasmid prep of I20260, K516032 and B0034<br />
* restriction of plasmids I20260, K516032, B0034 with EcoRI and PstI<br />
* gel with restricted the I20260, K516032 and B0034 was run<br />
* purification of vector backbones pSB1A2, pSB3K3 and pSB1C3<br />
* restriciton of synthesized TEV protease with EcoRI and PstI<br />
* qualitatively tested the ''Pseudomonas fluorescens'' that had grown over night for OD and fluorescence. She determined that Pseudomonas-F medium is the most adequate for the cultivation of the strain we use, since both OD and fluorescence were best in the flask containing the respective medium. Growth in the Pseudomonas-F medium supplemented with 300&nbsp;µg/L Fe3+ was weaker, however, fluorescence was also successfully suppressed.<br />
* made chips with K131026 in DH5α and NEB, in LB and LB + 10&nbsp;% glycerol. Images were taken with our own device every 10 min (illumination problems).<br />
<center><br />
{{Team:Aachen/Figure|Aachen_26_08_2014_K131026_neb_serie.png|title=Sensor Chips with K131026 in NEB in LB taken with first prototyp of our own device|subtitle=Sensor chips with K131026 in NEB in LB medium with 1,5&nbsp;% agar. Chip on the top induced with 0.5&nbsp;µl of 500&nbsp;µg/ml HSL and on the bottom with less than 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12). A) befor induction B) 1&nbsp;h after induction C) 1.5&nbsp;h after induction D) 2&nbsp;h after induction |width=600px}}<br />
</center><br />
* plasmid prep of the back bones, restriction and gel purification<br />
<br />
== 27th ==<br />
* transformation of some BioBricks<br />
* ligation of J23101.K516032 into pSB3K3 and J23115.K516032 into pSB3K3 and K1319004 into pSB1C3<br />
* transformation of K1319004 into pUC and pSB1C3, and J04450 into pSB1K3 and pSB1A3, respectively<br />
<br />
== 28th ==<br />
* transformation of some BioBricks<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/File:Aachen_14-07-5_PCR_toREACh1%262.pngFile:Aachen 14-07-5 PCR toREACh1&2.png2014-10-16T19:46:11Z<p>VeraA: </p>
<hr />
<div></div>VeraAhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/AugustTeam:Aachen/Notebook/Wetlab/August2014-10-16T19:44:51Z<p>VeraA: /* 6th */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= August =<br />
== 1st ==<br />
* made electrocompetent ''E.coli'' rosetta cells.<br />
* prepared cultures of K1319042 and K131026<br />
<br />
== 2nd ==<br />
* tested the OD measurement device and compared it to the spectrophotometer and the plate reader. <br />
* tested K131026 and K1319042 for fluorescence in the plate reader<br />
* did a heat shock transformation of I746909 into NEB TOP 10 cells<br />
* did an electroshock transformation of pET17-Gal3 into ''E.coli'' rosetta<br />
<br />
== 3rd ==<br />
* OD measurements of the iGEM device in comparison to the spectrophotometer were taken. <br />
* cryo cultures of K131026 and K1319042 were prepared<br />
* master plates of Gal3 #1-#10 and I746909 #1-#4 and overnight cultures<br />
<br />
== 4th ==<br />
* made cryo stocks of K1319042 and K131026 in NEB/BL21/DH5alpha, I746909 in BL21 and pET17-His-SNAP-YFP-Gal3 in ''E.&nbsp;coli'' rosetta (DE3), respectively.<br />
* made plasmid prep, most of them using 1.5&nbsp;mL culture medium, and eluted with 1x 50&nbsp;µL of ddH{{sub|2}}O. The resulting DNA concentrations are shown below.<br />
<br />
<center><br />
{| class="wikitable"<br />
! combination !! concentration [ng/µl]<br />
|-<br />
| I746909 BL21 #1 || 73.5<br />
|-<br />
| I746909 BL21 #2 || 45<br />
|-<br />
| I746909 BL21 #3 || 49<br />
|-<br />
| K1319042 DH5alpha || 60<br />
|-<br />
| K131026 DH5alpha || 150<br />
|-<br />
| pET17-Gal3 #1 || 30.5<br />
|-<br />
| pET17-Gal3 #2 || 6.4<br />
|-<br />
| pET17-Gal3 #3 || 6.3<br />
|-<br />
| pET17-Gal3 #4 || 9.4<br />
|-<br />
| pET17-Gal3 #5 || 10.1<br />
|-<br />
| pET17-Gal3 #6 || 8.2<br />
|-<br />
| pET17-Gal3 #7 || 13.8<br />
|-<br />
| pET17-Gal3 #8 || 6.9<br />
|-<br />
| pET17-Gal3 #9 || 10.2<br />
|}<br />
</center><br />
<br />
To confirm the quality of pET17-Gal3 transformations, the purified plasmids were tested by carrying out a digest. Results are shown in the below picture and table.<br />
<br />
<center><br />
{{Team:Aachen/Figure|14-08-04_Test-Digest.png|title=Test digest|subtitle=clones were test-digested|width=400px}}<br />
<br />
{| class="wikitable"<br />
! combination !! cut products[bp]<br />
|-<br />
| I746909 BL21 #1 || 2029, 947<br />
|-<br />
| K1319042 DH5alpha || 2029, 1780<br />
|-<br />
| K131026 DH5alpha || 2029, 1848<br />
|-<br />
| pET17-Gal3 #1 || 3086, 923, 1262<br />
|}<br />
</center><br />
<br />
All pET17-Gal3 clones were positive and clone #1 was selected for further experiments.<br />
* prepared an over night cultur of K1319042 for chips<br />
<br />
== 5th ==<br />
* assembly of a V{{sub|R}}=2.5&nbsp;L bioreactor for cultivation of a 1&nbsp;L expression culture.<br />
* Two precultures of 20&nbsp;mL LB+A were inoculated at 19:00<br />
* transformation of K746909 into BL21 cells and K1319000 into NEB10β cells.<br />
* made Chips with K1319042 in HM. Images were taken every 30 min with the Geldoc<br />
* made alliquots of HM, 1&nbsp;L HM + glucose + supplements and 500&nbsp;ml LB<br />
<br />
* The Quickchange mutagenesis PCR with a tamplate K1319000 and following primers was made. The PCR was made in two steps. The first step is PCR with both primers separatly and the second step includes PCR with two PCR products mixed with each other.<br />
** forward primer EYFPtoREACh1_F: AGTACAACTGGAACAGCCACAACGTCTATATC<br />
** rewerse primer EYFPtoREACh1_R: GTTGTGGCTGTTCCAGTTGTACTCCAGCTTG<br />
'''1. Step''' with 3 cycles<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| anneal || 55 || 30"<br />
|-<br />
| elongate || 72 || 30"<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
'''2. Step''' with 14 cycles<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| anneal || 55 || 60"<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
<br />
''Picture''<br />
<br />
== 6th ==<br />
* transformation of J04450 in pSB1K3 and pSB1A3 in NEB10β cells.<br />
* They also did a plasmid prep of J04450 in pSB1C3 and Flo's vectors.<br />
* made precultures of NEB10βand DH5 alpha cells<br />
* inoculation of the fermenter at 11:40, and induced the fermentation of pET17-Gal3. The fermentation is expected to run 24&nbsp;h.<br />
* as the first Quickchange PCR for REACh2 was not sucsessful, it was reapeted as a gradient PCR with annealing temperatire 55&nbsp;°C, 57&nbsp;°C and 60&nbsp;°C. Then the agarose gel with PCR product samples was made.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-08-06_to_REACh2.png|title=Agarose gel with PCR products after Quichchange from K1319000 to K1319002 |width=600px}}<br />
</center><br />
<br />
== 7th ==<br />
* made media for ''Pseudomonas flourescens''<br />
** Nutrient Broth<br />
** Pseudomonas-F<br />
** Pseudomonas-P<br />
* made 2&nbsp;L LB<br />
<br />
== 8th ==<br />
* prepared 2x 60&nbsp;ml (LB + cam + IPTG) with K1319042<br />
* prepared 5&nbsp;ml K131026 and C0179<br />
* made SDS page<br />
<br />
== 9th ==<br />
* made a plate reader experiment with K131026 in LB and LB + HM<br />
<br />
== 11th ==<br />
* plated on LB + antibiotics<br />
** K131026<br />
** I746909<br />
** K13190042<br />
** I04450 in pSB1C3<br />
** I04450 in pSB1A3<br />
** I04450 in pSB1K3<br />
** pSEVA construct (pSEVA 641_FP pSEVA 234-LasR)<br />
<br />
== 13th ==<br />
* Agarose chips were prepared:<br />
** ''E. coli'' DH5α K131026 and I746909 in LB and HM<br />
** K1319042 and the pSEVA two plasmid construct in HM<br />
* Images were taken every 30 min with the Geldoc<br />
<br />
==15th ==<br />
* A bioreactor containing 1&nbsp;L Medium was inoculated with pET17-His-SNAP-YFP-Gal3.<br />
<br />
== 16th ==<br />
* The above mentioned Bioreactor was stopped after 20&nbsp;h and all cells were lysed.<br />
<br />
== 18th ==<br />
* Overnight cultures of I746909 and K131026 in LB, TB, 2x HM+ were made<br />
* 3x J23101.E0240 was plated<br />
* pET17-His-SNAP-YFP-Gal3 was purified with Äkta via a histidine-tagged protein purification.<br />
<br />
== 19th ==<br />
* Chips with K131026 and I746909 in HM were made. Images were taken every 30 min with the Geldoc<br />
* A PCR of J23101.E0240, K1319000, K1319001, K1319002 was run and the product was separated on a 1,2&nbsp;% agarose gel<br />
* A SDS gel with samples of protein purification of pET17-His-SNAP-YFP-Gal3 was made to check if the purifired samples contain the target protein - YFP-Gal3. The purification or the gel resulted in two samples with a yellow color. For the SDS we also used the two samples before and the two samples after ones with the yellow color, 6&nbsp;mL. <br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-08-18_Gal3_purification_iVA.png|title=YFP-Gal3 protein purification|subtitle=|width=400px}}<br />
</center><br />
<br />
* Two samples with YFP-Gal3 were concentrated till 1&nbsp;mL <br />
* The concentration of YFP-Gal3 was calculated on Tecan. Calculation showed concentration 13,42&nbsp;mg/ml<br />
<br />
== 20th ==<br />
* repeat PCR for REACh1 and J23101.E0240 and run a gel<br />
* plasmid prep of pSEVA BfsB, pSEVA lasR and I746909<br />
<br />
== 24th ==<br />
* made 2.5&nbsp;L LB<br />
* made chips of K131026 in NEB , DH5α and BL21 in LB and additionally K131026 in DH5α in HM+. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_24_08_2014_K131026_bl21_serie.png|title=Sensor Chips with K131026 in BL21 in LB taken with first prototyp of our own device|subtitle=Sensor chips with K131026 in BL21 in LB medium with 1,5&nbsp;% agar, lower chip induced. A) befor induction with 2&nbsp;µl of 5000&nbsp;µg/ml HSL (3-oxo-C12) B) 0.5&nbsp;h after induction C) 1&nbsp;h after induction D) 1.5&nbsp;h after induction E) 2&nbsp;h after induction F) 2.5&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
== 25th ==<br />
* did a plasmid restriction of I20260 (EcoRI,PstI), J23115 (EcoRI, SpeI), K516032 (XbaI,PstI), and J23101 (EcoRI, SpeI)<br />
* tested the growth of ''Pseudomonas fluorescens'' in different liquid media for high OD and strong fluorescence. She tested Standard I medium, Cetrimide medium and Pseudomonas-F medium, and Pseudomonas-F medium supplemented with 300&nbsp;µL Fe3+ in 500&nbsp;mL flasks with a filling volume of 30&nbsp;mL. The flasks were inoculated with ''P. fluorescens'' cells on Standard I agar, and incubated at 30&nbsp;°C at 250&nbsp;rpm.<br />
* prepared over night cultures of K131026 in DH5α and NEB for chips<br />
* prepared 2x 5&nbsp;ml of pSB1C3, psB3K3 and pSB1A2 for plasmid prep<br />
<br />
== 26th ==<br />
* ligation of J23115 and K516032 to J23115.K516032, and J23101 and K516032 to J23101.K516032, respectively.<br />
* plasmid prep of I20260, K516032 and B0034<br />
* restriction of plasmids I20260, K516032, B0034 with EcoRI and PstI<br />
* gel with restricted the I20260, K516032 and B0034 was run<br />
* purification of vector backbones pSB1A2, pSB3K3 and pSB1C3<br />
* restriciton of synthesized TEV protease with EcoRI and PstI<br />
* qualitatively tested the ''Pseudomonas fluorescens'' that had grown over night for OD and fluorescence. She determined that Pseudomonas-F medium is the most adequate for the cultivation of the strain we use, since both OD and fluorescence were best in the flask containing the respective medium. Growth in the Pseudomonas-F medium supplemented with 300&nbsp;µg/L Fe3+ was weaker, however, fluorescence was also successfully suppressed.<br />
* made chips with K131026 in DH5α and NEB, in LB and LB + 10&nbsp;% glycerol. Images were taken with our own device every 10 min (illumination problems).<br />
<center><br />
{{Team:Aachen/Figure|Aachen_26_08_2014_K131026_neb_serie.png|title=Sensor Chips with K131026 in NEB in LB taken with first prototyp of our own device|subtitle=Sensor chips with K131026 in NEB in LB medium with 1,5&nbsp;% agar. Chip on the top induced with 0.5&nbsp;µl of 500&nbsp;µg/ml HSL and on the bottom with less than 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12). A) befor induction B) 1&nbsp;h after induction C) 1.5&nbsp;h after induction D) 2&nbsp;h after induction |width=600px}}<br />
</center><br />
* plasmid prep of the back bones, restriction and gel purification<br />
<br />
== 27th ==<br />
* transformation of some BioBricks<br />
* ligation of J23101.K516032 into pSB3K3 and J23115.K516032 into pSB3K3 and K1319004 into pSB1C3<br />
* transformation of K1319004 into pUC and pSB1C3, and J04450 into pSB1K3 and pSB1A3, respectively<br />
<br />
== 28th ==<br />
* transformation of some BioBricks<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/AugustTeam:Aachen/Notebook/Wetlab/August2014-10-16T19:44:20Z<p>VeraA: /* 6th */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= August =<br />
== 1st ==<br />
* made electrocompetent ''E.coli'' rosetta cells.<br />
* prepared cultures of K1319042 and K131026<br />
<br />
== 2nd ==<br />
* tested the OD measurement device and compared it to the spectrophotometer and the plate reader. <br />
* tested K131026 and K1319042 for fluorescence in the plate reader<br />
* did a heat shock transformation of I746909 into NEB TOP 10 cells<br />
* did an electroshock transformation of pET17-Gal3 into ''E.coli'' rosetta<br />
<br />
== 3rd ==<br />
* OD measurements of the iGEM device in comparison to the spectrophotometer were taken. <br />
* cryo cultures of K131026 and K1319042 were prepared<br />
* master plates of Gal3 #1-#10 and I746909 #1-#4 and overnight cultures<br />
<br />
== 4th ==<br />
* made cryo stocks of K1319042 and K131026 in NEB/BL21/DH5alpha, I746909 in BL21 and pET17-His-SNAP-YFP-Gal3 in ''E.&nbsp;coli'' rosetta (DE3), respectively.<br />
* made plasmid prep, most of them using 1.5&nbsp;mL culture medium, and eluted with 1x 50&nbsp;µL of ddH{{sub|2}}O. The resulting DNA concentrations are shown below.<br />
<br />
<center><br />
{| class="wikitable"<br />
! combination !! concentration [ng/µl]<br />
|-<br />
| I746909 BL21 #1 || 73.5<br />
|-<br />
| I746909 BL21 #2 || 45<br />
|-<br />
| I746909 BL21 #3 || 49<br />
|-<br />
| K1319042 DH5alpha || 60<br />
|-<br />
| K131026 DH5alpha || 150<br />
|-<br />
| pET17-Gal3 #1 || 30.5<br />
|-<br />
| pET17-Gal3 #2 || 6.4<br />
|-<br />
| pET17-Gal3 #3 || 6.3<br />
|-<br />
| pET17-Gal3 #4 || 9.4<br />
|-<br />
| pET17-Gal3 #5 || 10.1<br />
|-<br />
| pET17-Gal3 #6 || 8.2<br />
|-<br />
| pET17-Gal3 #7 || 13.8<br />
|-<br />
| pET17-Gal3 #8 || 6.9<br />
|-<br />
| pET17-Gal3 #9 || 10.2<br />
|}<br />
</center><br />
<br />
To confirm the quality of pET17-Gal3 transformations, the purified plasmids were tested by carrying out a digest. Results are shown in the below picture and table.<br />
<br />
<center><br />
{{Team:Aachen/Figure|14-08-04_Test-Digest.png|title=Test digest|subtitle=clones were test-digested|width=400px}}<br />
<br />
{| class="wikitable"<br />
! combination !! cut products[bp]<br />
|-<br />
| I746909 BL21 #1 || 2029, 947<br />
|-<br />
| K1319042 DH5alpha || 2029, 1780<br />
|-<br />
| K131026 DH5alpha || 2029, 1848<br />
|-<br />
| pET17-Gal3 #1 || 3086, 923, 1262<br />
|}<br />
</center><br />
<br />
All pET17-Gal3 clones were positive and clone #1 was selected for further experiments.<br />
* prepared an over night cultur of K1319042 for chips<br />
<br />
== 5th ==<br />
* assembly of a V{{sub|R}}=2.5&nbsp;L bioreactor for cultivation of a 1&nbsp;L expression culture.<br />
* Two precultures of 20&nbsp;mL LB+A were inoculated at 19:00<br />
* transformation of K746909 into BL21 cells and K1319000 into NEB10β cells.<br />
* made Chips with K1319042 in HM. Images were taken every 30 min with the Geldoc<br />
* made alliquots of HM, 1&nbsp;L HM + glucose + supplements and 500&nbsp;ml LB<br />
<br />
* The Quickchange mutagenesis PCR with a tamplate K1319000 and following primers was made. The PCR was made in two steps. The first step is PCR with both primers separatly and the second step includes PCR with two PCR products mixed with each other.<br />
** forward primer EYFPtoREACh1_F: AGTACAACTGGAACAGCCACAACGTCTATATC<br />
** rewerse primer EYFPtoREACh1_R: GTTGTGGCTGTTCCAGTTGTACTCCAGCTTG<br />
'''1. Step''' with 3 cycles<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| anneal || 55 || 30"<br />
|-<br />
| elongate || 72 || 30"<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
'''2. Step''' with 14 cycles<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| anneal || 55 || 60"<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
<br />
''Picture''<br />
<br />
== 6th ==<br />
* transformation of J04450 in pSB1K3 and pSB1A3 in NEB10β cells.<br />
* They also did a plasmid prep of J04450 in pSB1C3 and Flo's vectors.<br />
* made precultures of NEB10βand DH5 alpha cells<br />
* inoculation of the fermenter at 11:40, and induced the fermentation of pET17-Gal3. The fermentation is expected to run 24&nbsp;h.<br />
* as the first Quickchange PCR for REACh2 was not sucsessful, it was reapeted as a gradient PCR with annealing temperatire 55&nbsp;°C, 57&nbsp;°C, 60&nbsp;°C. Then the agarose gel with PCR product samples was made.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-08-06_to_REACh2.png|title=Agarose gel with PCR products after Quichchange from K1319000 to K1319002 |width=600px}}<br />
</center><br />
<br />
== 7th ==<br />
* made media for ''Pseudomonas flourescens''<br />
** Nutrient Broth<br />
** Pseudomonas-F<br />
** Pseudomonas-P<br />
* made 2&nbsp;L LB<br />
<br />
== 8th ==<br />
* prepared 2x 60&nbsp;ml (LB + cam + IPTG) with K1319042<br />
* prepared 5&nbsp;ml K131026 and C0179<br />
* made SDS page<br />
<br />
== 9th ==<br />
* made a plate reader experiment with K131026 in LB and LB + HM<br />
<br />
== 11th ==<br />
* plated on LB + antibiotics<br />
** K131026<br />
** I746909<br />
** K13190042<br />
** I04450 in pSB1C3<br />
** I04450 in pSB1A3<br />
** I04450 in pSB1K3<br />
** pSEVA construct (pSEVA 641_FP pSEVA 234-LasR)<br />
<br />
== 13th ==<br />
* Agarose chips were prepared:<br />
** ''E. coli'' DH5α K131026 and I746909 in LB and HM<br />
** K1319042 and the pSEVA two plasmid construct in HM<br />
* Images were taken every 30 min with the Geldoc<br />
<br />
==15th ==<br />
* A bioreactor containing 1&nbsp;L Medium was inoculated with pET17-His-SNAP-YFP-Gal3.<br />
<br />
== 16th ==<br />
* The above mentioned Bioreactor was stopped after 20&nbsp;h and all cells were lysed.<br />
<br />
== 18th ==<br />
* Overnight cultures of I746909 and K131026 in LB, TB, 2x HM+ were made<br />
* 3x J23101.E0240 was plated<br />
* pET17-His-SNAP-YFP-Gal3 was purified with Äkta via a histidine-tagged protein purification.<br />
<br />
== 19th ==<br />
* Chips with K131026 and I746909 in HM were made. Images were taken every 30 min with the Geldoc<br />
* A PCR of J23101.E0240, K1319000, K1319001, K1319002 was run and the product was separated on a 1,2&nbsp;% agarose gel<br />
* A SDS gel with samples of protein purification of pET17-His-SNAP-YFP-Gal3 was made to check if the purifired samples contain the target protein - YFP-Gal3. The purification or the gel resulted in two samples with a yellow color. For the SDS we also used the two samples before and the two samples after ones with the yellow color, 6&nbsp;mL. <br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-08-18_Gal3_purification_iVA.png|title=YFP-Gal3 protein purification|subtitle=|width=400px}}<br />
</center><br />
<br />
* Two samples with YFP-Gal3 were concentrated till 1&nbsp;mL <br />
* The concentration of YFP-Gal3 was calculated on Tecan. Calculation showed concentration 13,42&nbsp;mg/ml<br />
<br />
== 20th ==<br />
* repeat PCR for REACh1 and J23101.E0240 and run a gel<br />
* plasmid prep of pSEVA BfsB, pSEVA lasR and I746909<br />
<br />
== 24th ==<br />
* made 2.5&nbsp;L LB<br />
* made chips of K131026 in NEB , DH5α and BL21 in LB and additionally K131026 in DH5α in HM+. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_24_08_2014_K131026_bl21_serie.png|title=Sensor Chips with K131026 in BL21 in LB taken with first prototyp of our own device|subtitle=Sensor chips with K131026 in BL21 in LB medium with 1,5&nbsp;% agar, lower chip induced. A) befor induction with 2&nbsp;µl of 5000&nbsp;µg/ml HSL (3-oxo-C12) B) 0.5&nbsp;h after induction C) 1&nbsp;h after induction D) 1.5&nbsp;h after induction E) 2&nbsp;h after induction F) 2.5&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
== 25th ==<br />
* did a plasmid restriction of I20260 (EcoRI,PstI), J23115 (EcoRI, SpeI), K516032 (XbaI,PstI), and J23101 (EcoRI, SpeI)<br />
* tested the growth of ''Pseudomonas fluorescens'' in different liquid media for high OD and strong fluorescence. She tested Standard I medium, Cetrimide medium and Pseudomonas-F medium, and Pseudomonas-F medium supplemented with 300&nbsp;µL Fe3+ in 500&nbsp;mL flasks with a filling volume of 30&nbsp;mL. The flasks were inoculated with ''P. fluorescens'' cells on Standard I agar, and incubated at 30&nbsp;°C at 250&nbsp;rpm.<br />
* prepared over night cultures of K131026 in DH5α and NEB for chips<br />
* prepared 2x 5&nbsp;ml of pSB1C3, psB3K3 and pSB1A2 for plasmid prep<br />
<br />
== 26th ==<br />
* ligation of J23115 and K516032 to J23115.K516032, and J23101 and K516032 to J23101.K516032, respectively.<br />
* plasmid prep of I20260, K516032 and B0034<br />
* restriction of plasmids I20260, K516032, B0034 with EcoRI and PstI<br />
* gel with restricted the I20260, K516032 and B0034 was run<br />
* purification of vector backbones pSB1A2, pSB3K3 and pSB1C3<br />
* restriciton of synthesized TEV protease with EcoRI and PstI<br />
* qualitatively tested the ''Pseudomonas fluorescens'' that had grown over night for OD and fluorescence. She determined that Pseudomonas-F medium is the most adequate for the cultivation of the strain we use, since both OD and fluorescence were best in the flask containing the respective medium. Growth in the Pseudomonas-F medium supplemented with 300&nbsp;µg/L Fe3+ was weaker, however, fluorescence was also successfully suppressed.<br />
* made chips with K131026 in DH5α and NEB, in LB and LB + 10&nbsp;% glycerol. Images were taken with our own device every 10 min (illumination problems).<br />
<center><br />
{{Team:Aachen/Figure|Aachen_26_08_2014_K131026_neb_serie.png|title=Sensor Chips with K131026 in NEB in LB taken with first prototyp of our own device|subtitle=Sensor chips with K131026 in NEB in LB medium with 1,5&nbsp;% agar. Chip on the top induced with 0.5&nbsp;µl of 500&nbsp;µg/ml HSL and on the bottom with less than 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12). A) befor induction B) 1&nbsp;h after induction C) 1.5&nbsp;h after induction D) 2&nbsp;h after induction |width=600px}}<br />
</center><br />
* plasmid prep of the back bones, restriction and gel purification<br />
<br />
== 27th ==<br />
* transformation of some BioBricks<br />
* ligation of J23101.K516032 into pSB3K3 and J23115.K516032 into pSB3K3 and K1319004 into pSB1C3<br />
* transformation of K1319004 into pUC and pSB1C3, and J04450 into pSB1K3 and pSB1A3, respectively<br />
<br />
== 28th ==<br />
* transformation of some BioBricks<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
{{Team:Aachen/Footer}}</div>VeraAhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/AugustTeam:Aachen/Notebook/Wetlab/August2014-10-16T19:43:42Z<p>VeraA: /* 6th */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= August =<br />
== 1st ==<br />
* made electrocompetent ''E.coli'' rosetta cells.<br />
* prepared cultures of K1319042 and K131026<br />
<br />
== 2nd ==<br />
* tested the OD measurement device and compared it to the spectrophotometer and the plate reader. <br />
* tested K131026 and K1319042 for fluorescence in the plate reader<br />
* did a heat shock transformation of I746909 into NEB TOP 10 cells<br />
* did an electroshock transformation of pET17-Gal3 into ''E.coli'' rosetta<br />
<br />
== 3rd ==<br />
* OD measurements of the iGEM device in comparison to the spectrophotometer were taken. <br />
* cryo cultures of K131026 and K1319042 were prepared<br />
* master plates of Gal3 #1-#10 and I746909 #1-#4 and overnight cultures<br />
<br />
== 4th ==<br />
* made cryo stocks of K1319042 and K131026 in NEB/BL21/DH5alpha, I746909 in BL21 and pET17-His-SNAP-YFP-Gal3 in ''E.&nbsp;coli'' rosetta (DE3), respectively.<br />
* made plasmid prep, most of them using 1.5&nbsp;mL culture medium, and eluted with 1x 50&nbsp;µL of ddH{{sub|2}}O. The resulting DNA concentrations are shown below.<br />
<br />
<center><br />
{| class="wikitable"<br />
! combination !! concentration [ng/µl]<br />
|-<br />
| I746909 BL21 #1 || 73.5<br />
|-<br />
| I746909 BL21 #2 || 45<br />
|-<br />
| I746909 BL21 #3 || 49<br />
|-<br />
| K1319042 DH5alpha || 60<br />
|-<br />
| K131026 DH5alpha || 150<br />
|-<br />
| pET17-Gal3 #1 || 30.5<br />
|-<br />
| pET17-Gal3 #2 || 6.4<br />
|-<br />
| pET17-Gal3 #3 || 6.3<br />
|-<br />
| pET17-Gal3 #4 || 9.4<br />
|-<br />
| pET17-Gal3 #5 || 10.1<br />
|-<br />
| pET17-Gal3 #6 || 8.2<br />
|-<br />
| pET17-Gal3 #7 || 13.8<br />
|-<br />
| pET17-Gal3 #8 || 6.9<br />
|-<br />
| pET17-Gal3 #9 || 10.2<br />
|}<br />
</center><br />
<br />
To confirm the quality of pET17-Gal3 transformations, the purified plasmids were tested by carrying out a digest. Results are shown in the below picture and table.<br />
<br />
<center><br />
{{Team:Aachen/Figure|14-08-04_Test-Digest.png|title=Test digest|subtitle=clones were test-digested|width=400px}}<br />
<br />
{| class="wikitable"<br />
! combination !! cut products[bp]<br />
|-<br />
| I746909 BL21 #1 || 2029, 947<br />
|-<br />
| K1319042 DH5alpha || 2029, 1780<br />
|-<br />
| K131026 DH5alpha || 2029, 1848<br />
|-<br />
| pET17-Gal3 #1 || 3086, 923, 1262<br />
|}<br />
</center><br />
<br />
All pET17-Gal3 clones were positive and clone #1 was selected for further experiments.<br />
* prepared an over night cultur of K1319042 for chips<br />
<br />
== 5th ==<br />
* assembly of a V{{sub|R}}=2.5&nbsp;L bioreactor for cultivation of a 1&nbsp;L expression culture.<br />
* Two precultures of 20&nbsp;mL LB+A were inoculated at 19:00<br />
* transformation of K746909 into BL21 cells and K1319000 into NEB10β cells.<br />
* made Chips with K1319042 in HM. Images were taken every 30 min with the Geldoc<br />
* made alliquots of HM, 1&nbsp;L HM + glucose + supplements and 500&nbsp;ml LB<br />
<br />
* The Quickchange mutagenesis PCR with a tamplate K1319000 and following primers was made. The PCR was made in two steps. The first step is PCR with both primers separatly and the second step includes PCR with two PCR products mixed with each other.<br />
** forward primer EYFPtoREACh1_F: AGTACAACTGGAACAGCCACAACGTCTATATC<br />
** rewerse primer EYFPtoREACh1_R: GTTGTGGCTGTTCCAGTTGTACTCCAGCTTG<br />
'''1. Step''' with 3 cycles<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| anneal || 55 || 30"<br />
|-<br />
| elongate || 72 || 30"<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
'''2. Step''' with 14 cycles<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| anneal || 55 || 60"<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
<br />
''Picture''<br />
<br />
== 6th ==<br />
* transformation of J04450 in pSB1K3 and pSB1A3 in NEB10β cells.<br />
* They also did a plasmid prep of J04450 in pSB1C3 and Flo's vectors.<br />
* made precultures of NEB10βand DH5 alpha cells<br />
* inoculation of the fermenter at 11:40, and induced the fermentation of pET17-Gal3. The fermentation is expected to run 24&nbsp;h.<br />
* as the first Quickchange PCR for REACh2 was not sucsessful, it was reapeted as a gradient PCR with annealing temperatire 55&nbsp;°C, 57&nbsp;°C, 60&nbsp;°C. Then the agarose gel with PCR product samples was made.<br />
<br />
[[File:Aachen_14-08-06_to_REACh2.png|title=Agarose gel with PCR products after Quichchange from K1319000 to K1319002 |width=200px]]<br />
<br />
{{Team:Aachen/Figure|Aachen_14-08-06_to_REACh2.png|title=Agarose gel with PCR products after Quichchange from K1319000 to K1319002 |width=600px}}<br />
<br />
== 7th ==<br />
* made media for ''Pseudomonas flourescens''<br />
** Nutrient Broth<br />
** Pseudomonas-F<br />
** Pseudomonas-P<br />
* made 2&nbsp;L LB<br />
<br />
== 8th ==<br />
* prepared 2x 60&nbsp;ml (LB + cam + IPTG) with K1319042<br />
* prepared 5&nbsp;ml K131026 and C0179<br />
* made SDS page<br />
<br />
== 9th ==<br />
* made a plate reader experiment with K131026 in LB and LB + HM<br />
<br />
== 11th ==<br />
* plated on LB + antibiotics<br />
** K131026<br />
** I746909<br />
** K13190042<br />
** I04450 in pSB1C3<br />
** I04450 in pSB1A3<br />
** I04450 in pSB1K3<br />
** pSEVA construct (pSEVA 641_FP pSEVA 234-LasR)<br />
<br />
== 13th ==<br />
* Agarose chips were prepared:<br />
** ''E. coli'' DH5α K131026 and I746909 in LB and HM<br />
** K1319042 and the pSEVA two plasmid construct in HM<br />
* Images were taken every 30 min with the Geldoc<br />
<br />
==15th ==<br />
* A bioreactor containing 1&nbsp;L Medium was inoculated with pET17-His-SNAP-YFP-Gal3.<br />
<br />
== 16th ==<br />
* The above mentioned Bioreactor was stopped after 20&nbsp;h and all cells were lysed.<br />
<br />
== 18th ==<br />
* Overnight cultures of I746909 and K131026 in LB, TB, 2x HM+ were made<br />
* 3x J23101.E0240 was plated<br />
* pET17-His-SNAP-YFP-Gal3 was purified with Äkta via a histidine-tagged protein purification.<br />
<br />
== 19th ==<br />
* Chips with K131026 and I746909 in HM were made. Images were taken every 30 min with the Geldoc<br />
* A PCR of J23101.E0240, K1319000, K1319001, K1319002 was run and the product was separated on a 1,2&nbsp;% agarose gel<br />
* A SDS gel with samples of protein purification of pET17-His-SNAP-YFP-Gal3 was made to check if the purifired samples contain the target protein - YFP-Gal3. The purification or the gel resulted in two samples with a yellow color. For the SDS we also used the two samples before and the two samples after ones with the yellow color, 6&nbsp;mL. <br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-08-18_Gal3_purification_iVA.png|title=YFP-Gal3 protein purification|subtitle=|width=400px}}<br />
</center><br />
<br />
* Two samples with YFP-Gal3 were concentrated till 1&nbsp;mL <br />
* The concentration of YFP-Gal3 was calculated on Tecan. Calculation showed concentration 13,42&nbsp;mg/ml<br />
<br />
== 20th ==<br />
* repeat PCR for REACh1 and J23101.E0240 and run a gel<br />
* plasmid prep of pSEVA BfsB, pSEVA lasR and I746909<br />
<br />
== 24th ==<br />
* made 2.5&nbsp;L LB<br />
* made chips of K131026 in NEB , DH5α and BL21 in LB and additionally K131026 in DH5α in HM+. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_24_08_2014_K131026_bl21_serie.png|title=Sensor Chips with K131026 in BL21 in LB taken with first prototyp of our own device|subtitle=Sensor chips with K131026 in BL21 in LB medium with 1,5&nbsp;% agar, lower chip induced. A) befor induction with 2&nbsp;µl of 5000&nbsp;µg/ml HSL (3-oxo-C12) B) 0.5&nbsp;h after induction C) 1&nbsp;h after induction D) 1.5&nbsp;h after induction E) 2&nbsp;h after induction F) 2.5&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
== 25th ==<br />
* did a plasmid restriction of I20260 (EcoRI,PstI), J23115 (EcoRI, SpeI), K516032 (XbaI,PstI), and J23101 (EcoRI, SpeI)<br />
* tested the growth of ''Pseudomonas fluorescens'' in different liquid media for high OD and strong fluorescence. She tested Standard I medium, Cetrimide medium and Pseudomonas-F medium, and Pseudomonas-F medium supplemented with 300&nbsp;µL Fe3+ in 500&nbsp;mL flasks with a filling volume of 30&nbsp;mL. The flasks were inoculated with ''P. fluorescens'' cells on Standard I agar, and incubated at 30&nbsp;°C at 250&nbsp;rpm.<br />
* prepared over night cultures of K131026 in DH5α and NEB for chips<br />
* prepared 2x 5&nbsp;ml of pSB1C3, psB3K3 and pSB1A2 for plasmid prep<br />
<br />
== 26th ==<br />
* ligation of J23115 and K516032 to J23115.K516032, and J23101 and K516032 to J23101.K516032, respectively.<br />
* plasmid prep of I20260, K516032 and B0034<br />
* restriction of plasmids I20260, K516032, B0034 with EcoRI and PstI<br />
* gel with restricted the I20260, K516032 and B0034 was run<br />
* purification of vector backbones pSB1A2, pSB3K3 and pSB1C3<br />
* restriciton of synthesized TEV protease with EcoRI and PstI<br />
* qualitatively tested the ''Pseudomonas fluorescens'' that had grown over night for OD and fluorescence. She determined that Pseudomonas-F medium is the most adequate for the cultivation of the strain we use, since both OD and fluorescence were best in the flask containing the respective medium. Growth in the Pseudomonas-F medium supplemented with 300&nbsp;µg/L Fe3+ was weaker, however, fluorescence was also successfully suppressed.<br />
* made chips with K131026 in DH5α and NEB, in LB and LB + 10&nbsp;% glycerol. Images were taken with our own device every 10 min (illumination problems).<br />
<center><br />
{{Team:Aachen/Figure|Aachen_26_08_2014_K131026_neb_serie.png|title=Sensor Chips with K131026 in NEB in LB taken with first prototyp of our own device|subtitle=Sensor chips with K131026 in NEB in LB medium with 1,5&nbsp;% agar. Chip on the top induced with 0.5&nbsp;µl of 500&nbsp;µg/ml HSL and on the bottom with less than 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12). A) befor induction B) 1&nbsp;h after induction C) 1.5&nbsp;h after induction D) 2&nbsp;h after induction |width=600px}}<br />
</center><br />
* plasmid prep of the back bones, restriction and gel purification<br />
<br />
== 27th ==<br />
* transformation of some BioBricks<br />
* ligation of J23101.K516032 into pSB3K3 and J23115.K516032 into pSB3K3 and K1319004 into pSB1C3<br />
* transformation of K1319004 into pUC and pSB1C3, and J04450 into pSB1K3 and pSB1A3, respectively<br />
<br />
== 28th ==<br />
* transformation of some BioBricks<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
{{Team:Aachen/Footer}}</div>VeraA