http://2014.igem.org/wiki/index.php?title=Special:Contributions/HChughtai&feed=atom&limit=50&target=HChughtai&year=&month=2014.igem.org - User contributions [en]2024-03-29T09:50:44ZFrom 2014.igem.orgMediaWiki 1.16.5http://2014.igem.org/Team:Imperial/FunctionalisationTeam:Imperial/Functionalisation2014-10-18T03:59:47Z<p>HChughtai: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Functionalisation</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#introduction">Introduction</a><br />
</li><br />
<li><a data-scroll href="#aim">Aims</a><br />
</li><br />
<li><a data-scroll href="#CBDs">CBDs</a><br />
</li><br />
<li><a data-scroll href="#binding-partners">Functionalisation proteins</a><br />
</li><br />
<br />
<li><a data-scroll href="#results">Results</a><br />
</li><br />
<li><a data-scroll href="#references">References</a><br />
</li><br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
</div><br />
</div><br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p>Attaching functional proteins to cellulose can expand the properties of cellulose and allow us to selectivity capture specific contaminants in water. By creating fusion proteins of sfGFP and metal-binding proteins with five different cellulose binding domains, three of which are new to the registry, we were able to characterise the relative affinities of the CBDs and show proof-of-concept removal of contaminants from water.</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>Key Achievements </h2><br />
<ul><br />
<li>Added three new cellulose binding domains to the registry</li><br />
<li>Performed an assay with sfGFP-fusions to determine the strongest potential binders which could be carried forward for further testing</li><br />
<li>Identified potential metal binding proteins to bind heavy metals from wastewater, including the addition of a new promising polypeptide phytochelatin EC20</li><br />
<li>Tested metal ion capture ability of the CBD-phytochelatin fusion constructs when attached to cellulose</li><br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<section id="introduction"><br />
<h2>Introduction</h2><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/a/a0/IC14-func-strategy-both-pursue.png"><br />
<figcaption>Figure 1. Pictorial summary showing the two cellulose functionalization approaches considered in our project. Strategy 1: Cellulose binding domains are expressed as fusions with the protein of interest, separated optionally by a linker sequence. The cellulose binding domains attach to the cellulose by hydrophobic interactions. Strategy 2: Curli fibrils are expressed in parallel with cellulose to form a composite material. The curli fibres coding sequence is modified to contain a ‘SpyTag’ peptide (Zakeri <i>et al</i> 2012) which binds specifically via a covalent isopeptide bond to its protein partner, ‘SpyCatcher’. This SpyCatcher is fused to the proteins of interest. In our project we only had time to pursue strategy 1 but are still excited about the potential of strategy 2 in the future.</figcaption><br />
</figure><br />
<p>Bacterial cellulose is already a useful biomaterial as is due its attractive mechanical properties, with research on applications from loudspeaker diaphragms to protective packaging and wound dressings (Lee 2014). However, our project also aims to extend the properties of cellulose by conjugating functional proteins and peptides to it. This allows us to target specific contaminants in water which can not be filtered by size exclusion alone. (See <a href="https://2014.igem.org/Team:Imperial/Water_Report">water report</a> and <a href="https://2014.igem.org/Team:Imperial/Informing_Design">informing design</a> sections).</p><br />
<br />
<p>We considered two ways of functionalising cellulose (figure 1) but continued to work fully on the cellulose-binding domain (CBD) method. The curli-fibre method would be an exciting avenue to explore in the future; it is feasible since there has already been research into making a “programmable” biomaterial from curli fibres using a peptide tag approach (Nguyen <i>et al</i> 2014), and in combination with cellulose could produce a composite with robust mechanical properties as well.<br />
</p><br />
<br />
</section><br />
<section id="aim"><br />
<h2>Aims</h2><br />
<br />
<p>We aimed to make and characterise new cellulose binding domains, and fuse them to functional proteins. </p><br />
<br />
<br />
</section><br />
<section id="CBDs"><br />
<h2>Cellulose Binding Domains (CBDs)</h2><br />
<p>The cellulose binding domain (CBD) is the link between our functional proteins and the cellulose. Therefore, we wanted to use a CBD which had high affinity and strong binding to cellulose. However, weaker CBDs may still be useful since they could have the potential be controllably eluted under specific conditions, thereby enabling regeneration of the filter when saturated, and controlled disposal of the collected contaminants (refer to water report if relevant?).<br />
</p><br />
<p>We started our search by looking into the <a href="http://parts.igem.org/">parts registry</a> and found two CBDs already existed in the registry: CBDclos (<a href="http://parts.igem.org/Part:BBa_K863111">BBa_K863111</a>) and CBDcex (<a href="http://parts.igem.org/Part:BBa_K863101">BBa_K863101</a>). We also made three new CBDs to contribute to the registry: dCBD, CBDcipA, and CBDcenA. All the CBDs are in RFC(25) freiberg fusion format to allow for ease of use in protein fusions.</p><br />
<br />
<div class="accordion"><br />
<h3>CBDclos and CBDcex</h3><br />
<div><br />
<p>These parts were biobricked by <a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/cbc">Bielefeld 2012</a>, please see their part pages (<a href="http://parts.igem.org/Part:BBa_K863111">BBa_K863111</a>a and <a href="http://parts.igem.org/Part:BBa_K863101">BBa_K863101</a>) for detailed information. CBDclos is from the cellulolytic bacterium <em>Clostridium cellulovorans</em> and CBDcex originates from the cellulolytic bacterium <em>Cellulomonas fimi</em>. This is the same organism as for CBDcenA; cex is from the exoglucanase gene and cen is from the endoglucanase gene.</p><br />
</div><br />
<h3>Double CBD (dCBD) with N-terminal linker</h3><br />
<div><br />
<p>This part, <a href="http://parts.igem.org/Part:BBa_K1321340">BBa_K1321340</a> is based on the double cellulose-binding domain construct synthesised and characterised by Linder <i>et al</i>1996, who found that this double CBD had higher affinity for cellulose than either of the two CBDs on their own. The main difference is that our part contains an additional linker sequence on the N-terminus of the protein.<br />
</p><br />
<p>The two CBDs are from the fungus <i>Trichoderma reesei</i> (<i>Hypocrea jecorina</i>) Exocellobiohydrolase (Exoglucanase) I (cbh1), uniprot ID P62694; and Exocellobiohydrolase (Exoglucanase) II, uniprot ID P07987 (cbh2); with a linker peptide between the two CBDs and at the N-terminus of the protein. Both linkers are the same amino acid sequence and are based on the endogenous linker sequences that exists in cbh1 and cbh2 genes. The linker sequence is PGANPPGTTTTSRPATTTGSSPGP which is the same as used by Linder <i>et al</i> 1996. The first three amino acids are from the cbh2 endogenous linker, and the rest is from the cbh1 endogenous linker. CBDcbh1 is placed C-terminal to CBDcbh2 because naturally CBDcbh1 is a C-terminal domain and CBDcbh2 is an N-terminal domain. Both CBDs are from the <a class='iframe' href="http://www.cazy.org/CBM1.html">CBM family 1</a>. The precise location of the CBD within the cbh genes was slightly different according to the uniprot annotations and the sequence used by Linder <i>et al</i> 1996; we chose to use the sequence from the paper since the protein was expressed and characterised successfully.</p><br />
<br />
</div><br />
<h3>CBDcipA with N and C-terminal linker</h3><br />
<div><br />
<p>This CBD is from the Cellulosomal -scaffolding protein A (cipA) of Clostridium thermocellum including the endogenous linker sequences at the N and C-terminus (<a class='iframe' href="http://www.uniprot.org/uniprot/Q06851">UniProt ID Q06851</a>). It is in RFC25 format to allow for easy use in protein fusions.</p><br />
<br />
<p>The CBD is part of the <a class='iframe' href="http://www.cazy.org/CBM3.html">CBM3 family</a> . This CBD has been used in many application: in fusions with cell adhesion peptides to enhance the properties of cellulose as a cell-growth matrix (Andrade <i>et al </i> 2010a, Andrade <i>et al </i> 2010b), fused to enzymes to remove contaminants from water (Kauffmann <i> et al </i> 2000) and fused to an antimicrobial peptide (Ramos, Domingues & Gama 2010).</p><br />
<br />
<p>At present the cloning for these constructs is still in progress to correct an illegal EcoRI site which was identified in the parts with this CBD. This can be achieved with a silent mutation via site-directed mutagenesis and we aim to send these parts to the registry once thi<br />
</p><br />
<br />
</div><br />
<h3>CBDcenA with C-terminal linker</h3><br />
<div><br />
<p>This CBD is from the Endoglucanase A (cenA) gene from <i>Cellulomonas fimi</i> and also contains an endogenous C-terminal linker. The cellulose binding domain region occurs at the N-terminus of the cenA gene (UniProt P07984 link to http://www.uniprot.org/uniprot/P07984) and is from the <a class='iframe' href="http://www.cazy.org/CBM2.html">CBM family 2</a><br />
</p><br />
<p>The linker sequence (PTTSPTPTPTPTTPTPTPTPTPTPTPTVTP) is Pro-Thr box which has an extended conformation and acts as a hinge region (Gilkes <i>et al</i> 1989). The endoglucanase CBDcenA has 50% homology to the exoglucanase CBDcex (<a class="iframe" href="http://parts.igem.org/Part:BBa_K863101">BBa_K863101</a>) and the linker is highly conserved in both, but the order of the catalytic, linker and cellulose-binding regions is reversed (Warren <i>et al</i> 1986). It has been shown that CBDcenA has the highest binding affinity for crystalline cellulose out of the <i>C. fimi</i> CBDs (Kim <i>et al</i> 2013).<br />
</p><br />
</div><br />
</div><br />
</section><br />
<br />
<br />
</section><br />
<section id="binding-partners"><br />
<h2>Functionalisation proteins: Binding partners</h2><br />
<h3>Superfolder Green Fluorescent Protein (sfGFP) </h3><br />
<figure class="content-image image-right"> <br />
<img class="image-full" src=https://static.igem.org/mediawiki/2014/8/85/IC14-sfGFP-part-table.PNG> <br />
<figcaption>sfGFP-CBD fusion parts</figcaption> <br />
</figure> <p> sfGFP is a more stable mutant of <a href="http://parts.igem.org/Parts:BBa_E0040">mut3GFP</a> and we chose to use this as a robust, easily visible protein to initially fuse to our CBDs. We also designed one of our assays [insert link on 'one of our assays'] for characterising CBD binding using the sfGFP fusion constructs. sfGFP already existed in the registry (<a href="http://parts.igem.org/Part:BBa_I746916">BBa_I746916</a>), detailed information on sfGFP properties is included in this part description) however since we needed to make fusion proteins with our CBDs we modified the part and submitted it in RFC[25] Freiberg fusion format (<a href="http://parts.igem.org/Parts:BBa_K1321337">K1321337</a>). We created the following fusion parts with sfGFP: <br />
<br />
<br />
<br />
</p><br />
<br />
<h3> Metal Binding Proteins </h3><br />
<p>One of the contaminants we can filter out which current size-exclusion technologies can not target, are <a href="https://2014.igem.org/Team:Imperial/Water_Report">heavy metals</a>. We have worked with four different metal binding proteins: the metallothioneins SmtA and fMT, a histidine-rich nickel binding protein (NiBP) from the bacterium <i>Heliobacter pylori</i> and a synthetic phytochelatin (PC) EC20.<br />
</p><br />
<div class="accordion"><br />
<h3>SmtA and fMT metallothioneins</h3><br />
<div><br />
<p>These two parts already existed in the BioBrick registry, but since we needed to use them as fusions with the CBDs we improved the parts by making them compatible with the <a class="iframe" href="http://parts.igem.org/Assembly_standard_25">RFC(25) Frieburg Fusion BioBrick standard.</a></p><br />
<p>Metallothioneins (MTs) are genetically encoded cysteine-rich peptides which serve a role in the detoxification of heavy metals in plants, animals and some prokaryotes (Cobbett, 2002). They have a similar structure and function to phytochelatins, but are produced by different mechanisms (Cobbett, 2002). SmtA is from the cyanobacteria <i>Synechococcus sp.</i> and was used by the <a target="_blank" href="https://2011.igem.org/Team:Tokyo-NoKoGen">Tokyo-NoKoGen 2011</a> iGEM team (who submitted the RFC10 part originally, <a class="iframe" href="http://parts.igem.org/Part:BBa_K519010">BBa_K519010</a>) to confer cadmium (Cd2+) tolerance to <em>E. coli</em> cells when expressed. fMT originates from the seaweed <i>Fucus vesiculosus</i> and was submitted by <a target="_blank" href="https://2009.igem.org/Team:Groningen">Groningen 2009 iGEM team </a> and detailed information can be found on the original part page (<a class="iframe" href="http://parts.igem.org/Part:BBa_K190019">BBa_K190019</a>).</p><br />
<p>We successfully <a href="https://2014.igem.org/Team:Imperial/Protocols#general">cloned</a> the following CBD fusion constructs: </p><br />
<br />
<figure class="content-image image-right image-small"> <br />
<img class="image-full" src=https://static.igem.org/mediawiki/2014/a/ac/IC14-SmtA-part-table.PNG> <br />
<figcaption>SmtA-CBD fusion parts</figcaption> <br />
</figure> <br />
<br />
<figure class="content-image image-left image-small"> <br />
<img class="image-full" src=https://static.igem.org/mediawiki/2014/6/62/IC14-fMT-part-table.PNG> <br />
<figcaption>fMT-CBD fusion parts</figcaption> <br />
</figure> <br />
<br />
<br />
<br />
<br />
</div><br />
<h3>Nickel binding protein (NiBP)</h3><br />
<div><br />
<figure class="content-image image-right"> <br />
<img class="image-full" src=https://static.igem.org/mediawiki/2014/f/f6/IC14-NiBP-part-table.PNG> <br />
<figcaption>NiBP-CBD fusions parts</figcaption> <br />
</figure><br />
<p><br />
This protein is the histidine-rich nickel-binding protein from <i>Heliobacter pylori</i> (GenBank accession ACX98466.1), and already existed as a BioBrick in the registry (<a class="iframe" href="http://parts.igem.org/Part:K1151001">K1151001</a>). Since we needed to use this part in fusion proteins we improved the part by submitting it as a basic part in RFC(25) (link) Freiberg fusion format (<a class="iframe" href="http://parts.igem.org/Part:K1321009">K1321009</a>).<br />
</p><br />
<p>We successfully <a href="https://2014.igem.org/Team:Imperial/Protocols#general">cloned</a> the following CBD fusion constructs with NiBP:<br />
<br />
</p><br />
<p>However we discovered late on in the project that the DNA sequence of the NiBP protein in the registry is out of frame, leading to an incorrect protein translation and read-through of the stop codon (figure 2).</p><br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/8/80/IC14-NiBP-protein-alignment.PNG"><br />
<figcaption>Figure 2. Alignment of BBa_K1151001 NiBP in the registry to the , showing incorrect amino-acid sequence in red compared to <a target="_blank" href="http://www.ncbi.nlm.nih.gov/protein/261838700">native <i>H.pylori</i></a> sequence.<br />
</figcaption><br />
</figure><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/e/e1/IC14-NiBP-DNA-alignment.PNG"><br />
<figcaption>Figure 3. Single nucleotide deletion in BBa_K1151001 compared to native <i>H.pylori</i> sequence (<a target="_blank" href="http://www.ncbi.nlm.nih.gov/nuccore/261837457">GenBank CP000012.1</a> (link ) bp1391851-1392033, reverse complement) resulting in any downstream nucleotides being out of frame.</figcaption><br />
</figure><br />
<br />
<p>Further investigation into the error let us to identify a single nucleotide deletion in <a class="iframe" href="http://parts.igem.org/Part:BBa_K1151001">BBa_K1151001</a> compared to the native <i>H.pylori</i> DNA sequence (<a target="_blank" href="http://www.ncbi.nlm.nih.gov/nuccore/261837457">GenBank CP000012.1</a> bp1391851-1392033, reverse complement strand). As seen in Figure 3 the deletion is a ‘C’ at bp 53 of the native sequence. This error was propagated through all our NiBP constructs and means that any subsequent C-terminal fusions are also out of frame and we were unable to express and characterise these constructs. We have noted this on the description pages for each of the parts and hope that in the future they will still be useful, since the error could be corrected relatively easily by a team who wishes to use them by site-directed-mutagenesis PCR to insert the missing nucleotide. </p><br />
<br />
<br />
<br />
</div><br />
<h3>Synthetic phytochelatin EC20</h3><br />
<div><br />
<p>This is our new contribution of a metal-binding protein to the parts registry. Synthetic phytochelatins are analogues of phytochelatins (PCs); cysteine-rich peptides of the general structure (γ-GluCys)n-Gly (n~2-5) which bind and sequester heavy metals, with a role in detoxification (Cobbett & Goldsbrough 2002). PCs are found mainly in plants but also in other organisms including diatoms, fungi, algae (including cyanobacteria) and some invertebrates (Cobbett & Goldsbrough 2002, Rea 2012). Natively, the PCs are enzymatically synthesized by phytochelatin synthase (PCS) from a glutathione (GSH) precursor and the amino acids in the resulting peptide are linked by the non-standard gamma peptide bonds (Cobbett & Goldsbrough 2002, Rea 2012). However, genetically encoded analogues (containing normal alpha-peptide bonds) of different number Glu-Cys (EC) repeats have been characterised, with the EC20 having the highest binding (Bae <i>et al</i> 2000).<br />
</p><br />
<br />
<br />
<figure class="content-image image-right image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/1/18/IC14-Biondo-et-al-2012-ion-table.PNG"><br />
<figcaption>Table 1. Metal ion adsorption increase of C. metallidurans cells with PC EC20 displayed on cell surface, compared to negative control. Taken from Biondo <i>et al</i> 2012</figcaption><br />
</figure><br />
<p>The main metal PCs confer tolerance to is Cadmium (Cobbett & Goldsbrough 2002) with a reported stoichiometry of 10 Cd2+ per peptide (Bae <i>et al</i>, . EC20 peptide has still showed good metal ion binding whilst fused to a cellulose binding domain (CBD) for water purification (Xu <i>et al</i> 2002) and when anchored to bacterial cell membrane to confer Cd2+ tolerance (Bae <i>et al</i> 2000, Chaturvedi & Archana 2014). PC EC20 has also been shown to bind many more heavy metals. For example, when displayed on the surface of Cupriavidus metallidurans, the cells capacity to adsorb ions increased by 31 to 219% depending on the ion (table 1, Biondo <i>et al</i> 2012). These binding properties of PC EC20 have been utilised in applications including a regeneratable biosensor of Hg2+, Cd2+, Pb2+, Cu2+ and Zn2+ ions to 100 fM–10 mM (Bontidean <i>et al</i> 2003), and to target CdSe/ZnS quantum dots to streptavidin expressing HeLa cells when biotinylated (Pinaud <i>et al</i> 2004). INSERT TABLE OF THE IONS FROM THE PAPER<br />
</p><br />
<p>We used this part to <a href="https://2014.igem.org/Team:Imperial/Protocols#general">clone</a> a library of different cellulose-binding domains fused to phytochelatin:<figure class="content-image"> <br />
<img class="image-full" src=https://static.igem.org/mediawiki/2014/4/40/IC14-PC-part-table.PNG > <br />
<figcaption>Phytochelatin-CBD fusion parts. </figcaption> <br />
</figure> <br />
</p><br />
</div><br />
<br />
</div><br />
<br />
<br />
<br />
<h3> Other potential proteins </h3><br />
<p>During our research we also explored other functional proteins to fuse to the CBDs.<br />
<div class="accordion"><br />
<h3>Laccases</h3><br />
<div><br />
<p>Laccases are enzymes which can break down aromatic and phenolic compounds such as modified estrogens which can end up unfiltered in the water supply with unknown consequences (Auriol <i>et al</i> 2008). This method of treating estrogen in water was explored by <a target="_blank" href="https://2012.igem.org/Team:Bielefeld-Germany">Bielefeld 2012 iGEM team</a>, and our system also has potential to address this.<br />
</p><br />
</div><br />
<br />
<h3>Nanobodies</h3><br />
<div><br />
<p>Nanobodies are fragments of camelid antibodies which can be generated against a variety of antigens and can be easily expressed by organisms such as <i>E. coli </i>. Nanobodies could be used to target viruses, which are often too small to be filtered by size exclusion. For example there are already nanobodies which can bind to <i> Vaccinia </i> virus, ricin, <i>Cholera</i> toxin, Stephylococcal enterotoxin B and H5N1 Influenza (Goldman <i>et al </i> 2006, Ibanez <i>et al </i> 2011) to name a few. Additionally, nanobodies are stable and can be selected to resist proteolytic attach (Harmsen <i>et al </i> 2006). Nanobodies can also be functional when as fusions or conjugates to other proteins for example to target enzymes to specific cells (Cortez-Retamozo 2004), so there is much potential for targeting a wide array of contaminants when fused to cellulose binding domains.<br />
<br />
</p><br />
</div><br />
</div><br />
<br />
</section><br />
<br />
<br />
<section id="results"><br />
<h2>Results</h2><br />
<p>The assay for strength of CBD binding utilised our sfGFP-CBD fusion proteins. Strength of binding was assayed between the CBDs by assuming it will be proportional to the level of fluorescence which remains after washing of cellulose coated plates(link to plates protocol)<br />
<div class="accordion"><br />
<h3>Preliminary Assay</h3><br />
<div><br />
<figure class="content-image image-full"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/8/8a/Screen_Shot_2014-10-18_at_04.47.35.png"><br />
<figcaption>Figure: </figcaption><br />
</figure><br />
<p>text</p><br />
</div><br />
<h3>Full Assay</h3><br />
<div><br />
<figure class="content-image image-full"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/4/44/IC14-Etoh.png"><br />
<figcaption>Figure: </figcaption><br />
</figure><br />
<figure class="content-image image-full"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/d/da/IC14-Water.png"><br />
<figcaption>Figure: </figcaption><br />
</figure><br />
<p>text</p><br />
</div><br />
</div><br />
</section><br />
<br />
<section id="references"><br />
<h2>References</h2><br />
<br />
<ul><br />
<li>Andrade, F.K., Costa, R., Domingues, L., Soares, R., et al. (2010) Improving bacterial cellulose for blood vessel replacement: Functionalization with a chimeric protein containing a cellulose-binding module and an adhesion peptide. Acta biomaterialia. [Online] 6 (10), 4034–4041. Available from: doi:10.1016/j.actbio.2010.04.023.</li><br />
<br />
<li>Andrade, F.K., Moreira, S.M.G., Domingues, L. & Gama, F.M.P. (2010) Improving the affinity of fibroblasts for bacterial cellulose using carbohydrate-binding modules fused to RGD. Journal of biomedical materials research. Part A. [Online] 92 (1), 9–17. Available from: doi:10.1002/jbm.a.32284.</li><br />
<br />
<li>Auriol, M., Filali-Meknassi, Y., Adams, C.D., Tyagi, R.D., et al. (2008) Removal of estrogenic activity of natural and synthetic hormones from a municipal wastewater: efficiency of horseradish peroxidase and laccase from Trametes versicolor. Chemosphere. [Online] 70 (3), 445–452. Available from: doi:10.1016/j.chemosphere.2007.06.064.</li><br />
<br />
<li>Bae, W., Chen, W., Mulchandani, A. & Mehra, R.K. (2000) Enhanced bioaccumulation of heavy metals by bacterial cells displaying synthetic phytochelatins. Biotechnology and bioengineering. 70 (5), 518–524.</li><br />
<br />
<li>Biondo, R., da Silva, F.A., Vicente, E.J., Souza Sarkis, J.E., et al. (2012) Synthetic phytochelatin surface display in Cupriavidus metallidurans CH34 for enhanced metals bioremediation. Environmental science & technology. 46 (15), 8325–8332.</li><br />
<br />
<li>Bontidean, I., Ahlqvist, J., Mulchandani, A., Chen, W., et al. (2003) Novel synthetic phytochelatin-based capacitive biosensor for heavy metal ion detection. Biosensors and Bioelectronics. 18 (5-6), 547–553.</li><br />
<br />
<li>Chaturvedi, R. & Archana, G. (2014) Cytosolic expression of synthetic phytochelatin and bacterial metallothionein genes in Deinococcus radiodurans R1 for enhanced tolerance and bioaccumulation of cadmium. Biometals : an international journal on the role of metal ions in biology, biochemistry, and medicine. 27 (3), 471–482.</li><br />
<br />
<br />
<li>Cobbett, C. & Goldsbrough, P. (2002) Phytochelatins and metallothioneins: roles in heavy metal detoxification and homeostasis. Annual review of plant biology. [Online] 53159–182. Available from: doi:10.1146/annurev.arplant.53.100301.135154.</li><br />
<br />
<li>Cortez-Retamozo, V. (2004) Efficient Cancer Therapy with a Nanobody-Based Conjugate. Cancer Research. [Online] 64 (8), 2853–2857. Available from: doi:10.1158/0008-5472.CAN-03-3935.</li><br />
<br />
<li>Gilkes, N.R., Kilburn, D.G., Miller, R.C. & Warren, R.A. (1989) Structural and functional analysis of a bacterial cellulase by proteolysis. The Journal of biological chemistry. 264 (30), 17802–17808.</li><br />
<br />
<li>Harmsen, M.M., van Solt, C.B., van Zijderveld-van Bemmel, A.M., Niewold, T.A., et al. (2006) Selection and optimization of proteolytically stable llama single-domain antibody fragments for oral immunotherapy. Applied microbiology and biotechnology. [Online] 72 (3), 544–551. Available from: doi:10.1007/s00253-005-0300-7.</li><br />
<br />
<li>Kauffmann, C., Shoseyov, O., Shpigel, E., Bayer, E.A., et al. (2000) Novel Methodology for Enzymatic Removal of Atrazine from Water by CBD-Fusion Protein Immobilized on Cellulose. Environmental Science & Technology. [Online] 34 (7), 1292–1296. Available from: doi:10.1021/es990754h.</li><br />
<br />
<li>Kim, H.-D., Choi, S.-L., Kim, H., Sohn, J.H., et al. (2013) Enzyme-linked assay of cellulose-binding domain functions from Cellulomonas fimi on multi-well microtiter plate. Biotechnology and Bioprocess Engineering. 18 (3), 575–580.</li><br />
<br />
<li>Lee, K.-Y., Buldum, G., Mantalaris, A. and Bismarck, A. (2014), More Than Meets the Eye in Bacterial Cellulose: Biosynthesis, Bioprocessing, and Applications in Advanced Fiber Composites. Macromol. Biosci., 14: 10–32. doi: 10.1002/mabi.201300298</li><br />
<br />
<li>Linder, M.; Salovuori, I.; Ruohonen, L.; Teeri, T.T., 1996. Characterization of a Double Cellulose-binding Domain. SYNERGISTIC HIGH AFFINITY BINDING TO CRYSTALLINE CELLULOSE. Journal of Biological Chemistry, 271(35), pp.21268–21272. Available at: http://www.jbc.org/content/271/35/21268.full</li><br />
<br />
<li>Nguyen, P.Q., Botyanszki, Z., Tay, P.K.R. & Joshi, N.S. (2014) Programmable biofilm-based materials from engineered curli nanofibres. Nature communications. [Online] 54945. Available from: doi:10.1038/ncomms5945.</li><br />
<br />
<li>Pinaud, F., King, D., Moore, H.-P. & Weiss, S. (2004) Bioactivation and cell targeting of semiconductor CdSe/ZnS nanocrystals with phytochelatin-related peptides. Journal of the American Chemical Society. 126 (19), 6115–6123.</li><br />
<br />
<br />
<li>Ramos, R., Domingues, L. & Gama, M. (2010) Escherichia coli expression and purification of LL37 fused to a family III carbohydrate-binding module from Clostridium thermocellum. Protein expression and purification. [Online] 71 (1), 1–7. Available from: doi:10.1016/j.pep.2009.10.016.</li><br />
<br />
<li>Warren, R.A., Beck, C.F., Gilkes, N.R., Kilburn, D.G., et al. (1986) Sequence conservation and region shuffling in an endoglucanase and an exoglucanase from Cellulomonas fimi. Proteins. 1 (4), 335–341.</li><br />
<br />
<li>Xu, Z., Bae, W., Mulchandani, A., Mehra, R.K., et al. (2002) Heavy Metal Removal by Novel CBD-EC20 Sorbents Immobilized on Cellulose. Biomacromolecules. [Online] 3 (3), 462–465.</li><br />
<br />
<li>Zakeri, B., Fierer, J.O., Celik, E., Chittock, E.C., et al. (2012) Peptide tag forming a rapid covalent bond to a protein, through engineering a bacterial adhesin. Proceedings of the National Academy of Sciences of the United States of America. [Online] 109 (12), E690–E697. Available from: doi:10.1073/pnas.1115485109.</li><br />
</ul><br />
<br />
<br />
<br />
<br />
</section><br />
</div><br />
</body><br />
</html><br />
<br />
{{:Team:Imperial/Templates:footer}}</div>HChughtaihttp://2014.igem.org/Team:Imperial/ResultsTeam:Imperial/Results2014-10-18T03:59:03Z<p>HChughtai: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Results</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#overview">Overview</a><br />
</li><br />
<li><a data-scroll href="#result1"><em>G. xylinus</em></a><br />
</li><br />
<li><a data-scroll href="#result2"><em>E. coli</em></a><br />
</li><br />
<li><a data-scroll href="#result3">Co-Culture</a><br />
</li><br />
<li><a data-scroll href="#result4">Functionalisation</a><br />
</li><br />
<li><a data-scroll href="#result5">Mechanical Testing</a><br />
</li><br />
<li><a data-scroll href="#result6">Water Filtration</a><br />
</li><br />
<li><a data-scroll href="#result7">Water Report</a><br />
</li><br />
<li><a data-scroll href="#result7">i in iGEM</a><br />
</li><br />
<br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<br />
<br><br />
<section id="overview"><br />
<h2>Overview</h2><br />
<ul><br />
<br />
<li>Assembled and demonstrated a functional cellulose-producing system in Escherichia coli based on the high producing Acs operon</li><br />
<br />
<li>Sequenced the previously unknown genomes of <em>G. xylinus</em> ATCC 53582 and <em>G. xylinus</em> igem strains - the first genomes sequenced in the history of iGEM </li><br />
<br />
<li>Developed a set of new and improved protocols for synthetic biology in <em>G. xylinus</em></li><br />
<br />
<li>Developed a novel co-culture system for production of functionalised bacterial cellulose</li><br />
<br />
<li>Characterised three new cellulose binding domains for the registry and used them to functionalise bacterial cellulose with proteins of interest</li><br />
<br />
<li>Thoroughly characterised the properties of our manufactured biomaterial</li><br />
<br />
<li>Manufactured and tested ultrafiltration filters from bacterial cellulose</li><br />
<br />
<li>Demonstrated novel funtionalisation of cellulose filters with fusion proteins to improve binding of particular contaminants</li><br />
<br />
</ul><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
</section><br />
<section id="result1"><br />
<h2 style="color: inherit"><em><a href="https://2014.igem.org/Team:Imperial/Gluconacetobacter">G.xylinus</a></em></h2><br />
<h3>Overview</h3><br />
<p>Bacterial cellulose has great potential in many areas, including water purification, tissue scaffolds, wound dressings, etc., however, until now, all bacterial cellulose-based materials have been created using chemical or physical post-production processing, not genetic engineering. This is due to the lack of well-developed tools and methods for Gluconacetobacter genetic engineering, as well as the lack of genome sequence of the highest cellulose-producing strain ATCC 53582. We have overcome the numerous difficulties associated with G.xylinus genetic engineering, and turned G.xylinus KI and ATCC 53852 strains into new platforms for the production of cellulose-based biomaterials by sequencing the genomes of ATCC 53582 and KI, creating a genetic toolbox of consisting of five new plasmid backbones and around 40 widely used genes, and developing a set of new and improved protocols for G.xylinus genetic engineering.</p><br />
<h3>Key Achievements</h3><br />
<ul><br />
<li>Isolated a new strain of <em>Gluconacetobacter</em> (named <em>G. xylinus</em> igem) from Kombucha tea and characterized its properties fully.</li><br />
<li>Sequenced the previously unknown genomes of <em>G. xylinus</em> ATCC 53582 and <em>G. xylinus</em> igem strains - the first genomes sequenced in the history of iGEM </li><br />
<li>Discovered four new plasmids capable of replication in <em>Gluconacetobacter</em> species - pSEVA321, pSEVA331, pSEVA351 and pBAV1K, which replicate both in <em>G. xylinus</em> ATCC 53582 and igem strains as well as in <em>E. coli</em></li><br />
<li>Were the first in science to create transgenic cells of <em>G.xylinus</em> igem strain </li><br />
<li>Using our discovered plasmids, created a genetic toolbox consisting of 40 genes for <em>G. xylinus</em> engineering and expressed them in the ATCC 53582 and igem</li> <br />
<br />
<li>Developed a set of new and improved protocols for efficient genetic engineering of <em>G. xylinus</em></li><br />
<li>In summary, turned <em>G. xylinus</em> ATCC 53582 and igem strains into new model organisms and developed the necessary tools to create a powerful platform for the synthesis of new cellulose-based biomaterials and water filters</li><br />
<br />
<br />
<br />
<br />
<br />
</ul><br />
<br />
</section><br />
<section id="result2"><br />
<h2 style="color: inherit"><em><a href="https://2014.igem.org/Team:Imperial/EColi">E. coli</a></em></h2><br />
<h3>Overview</h3><br />
<p><em>Escherichia coli</em> is the organism of choice for synthetic biology. It is thoroughly characterised, easy to engineer and has numerous parts, control circuits and complex constructs tested in this host.</p><br />
<p>Some <em>E. coli</em> strains have evolved to produce low amounts of cellulose but the machinery under specific regulatory control (its secretion is generally linked to biofilm formation and stress situations). In order to expand the use of bacterial cellulose as a functional biomaterial that is cost effective to produce, it is desirable for its production machinery to be implemented in an organisms that is easy to engineer and has proven success in large scale bioreactors.</p><br />
<p>Here, we confirm that the high output cellulose production machinery of <em>Gluconacetobacter Xylinus</em> can be transferred into other organisms. We have proven function of the Acs cellulose producing operon in <em>Escherichia coli</em> using Congo Red binding assays.<br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Contributed an optimised Asc cellulose production operon to Registry of Standard Parts.</li><br />
<li>Proved the portability of <em>Gluconacetobacter xylinus</em> operon.</li><br />
<li>Assembled a fully synthetic, functional, cellulose-producing system in <em>Escherichia coli</em></li><br />
<li>Demonstrated the synthesis operon in a two plasmid system for separate induction of genes</li><br />
<br />
<br />
</ul><br />
<br />
</section><br />
<section id="result3"><br />
<h2 style="color: inherit"><a href="https://2014.igem.org/Team:Imperial/coculture">RFP Co-Culture</a></h2><br />
<h3>Overview</h3><br />
<p>Based on the hypothesis of <em>E. coli</em> BL21D3 operating anaerobically and <em>G. xylinus</em> replicating aerobically, a co-culture experiment for bacterial cellulose was attempted. Initially, the best possible carbon source among 5 available was found experimentally. This data was used to inform the choice of glycerol and glucose as the carbon feedstock. With these carbon feedstocks, <em>E. coli</em> with RFP expressed were successfully embedded in the bacterial cellulose, and RFP was clearly visible. </p><br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Experimentally determined the optimum carbon feedstocks for a HS media based co-culture of <em>E. coli</em> and <em>G. xylinus</em>. </li><br />
</ul><br />
<br />
</section><br />
<section id="result4"><br />
<h2 style="color: inherit"><a href="https://2014.igem.org/Team:Imperial/Functionalisation">Functionalisation</a></h2><br />
<h3>Overview</h3><br />
<p>Attaching functional proteins to cellulose can expand the properties of cellulose and allow us to selectivity capture specific contaminants in water. By creating fusion proteins of sfGFP and metal-binding proteins with five different cellulose binding domains, three of which are new to the registry, we were able to characterise the relative affinities of the CBDs and show proof-of-concept removal of contaminants from water.</p><br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Added three new cellulose binding domains to the registry</li><br />
<li>Performed an assay with sfGFP-fusions to determine the strongest potential binders which could be carried forward for further testing</li><br />
<li>Identified potential metal binding proteins to bind heavy metals from wastewater, including the addition of a new promising polypeptide phytochelatin EC20</li><br />
<li>Tested metal ion capture ability of the CBD-phytochelatin fusion constructs when attached to cellulose</li><br />
<br />
</ul><br />
<br />
</section><br />
<section id="result5"><br />
<h2 style="color: inherit"><a href="https://2014.igem.org/Team:Imperial/Mechanical_Testing">Mechanical Testing</a></h2><br />
<h3>Overview</h3><br />
<p>To check the feasibility of using our bacterial cellulose as a customisable ultrafiltration membrane, the mechanical properties were tested. For this to work, we checked the tensile strength of our filter, calculated the shear stress and estimated the processing method that produces membrane with the longest life-time. Our ultimate tensile stress calculated matched with literature values of bacterial cellulose within standard deviation, and the data analysis provided the insight to use non-blended cellulose rather than blended..</p><br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Introduced a new aspect to the manufacturing track in terms of quantitatively characterising the mechanical properties of our product, bacterial cellulose<br />
</li><br />
<li>Quantified the tensile stress-strain properties of our bacterial cellulose.<br />
</li><br />
<li>Discovered that our bacterial cellulose can sustain an order of magnitude higher water pressures than those typically used for ultrafiltration membranes.<br />
</li><br />
<li>Established that non-blended compared to blended bacterial cellulose was significantly more ductile, and would have longer life time as a water filter, which informed the choice of cellulose for the final product.<br />
</li><br />
<li>Tested and analysed 20 samples of bacterial cellulose test pieces.<br />
</li><br />
<li>Created a size and quality optimised gif for visualisation of the experiment and written a protocol for future iGEM teams to do the same.<br />
</li><br />
<br />
<br />
<br />
</ul><br />
</section><br />
<br />
<section id="result5"><br />
<h2 style="color: inherit"><a href="https://2014.igem.org/Team:Imperial/Water_Filtration">Water filtration</a></h2><br />
<h3>Overview</h3><br />
<p>By attaching functional proteins to cellulose we can expand it's properties and selectivity capture specific contaminants in water. We used five different cellulose binding domains and fused them to different metal binding proteins, and sfGFP. We performed assays to test the binding of the CBD fusions to our cellulose.</p><br />
</div><br />
<div class="pure-u-1-1"><br />
<h3>Key Achievements </h3><br />
<ul><br />
<li> Synthesized and characterised cellulose binding domains (CBD) and their phytochelatin fusions. </li><br />
<li>Proved that cellulose can be functionalised with CBD-phytochelatins.</li> <br />
<li>Showed that bacterial cellulose in itself can successfully filter metal out of solution.</li><br />
<li>Successfully demonstrated filtration of turbid water. </li><br />
<li>Captured Nickel ions on our customisable cellulose filter. </li><br />
<li>Functionalised our homegrown bacterial cellulose with our fusion proteins. </li><br />
</ul><br />
<br />
<section id="result6"><br />
<h2 style="color: inherit"><a href="https://2014.igem.org/Team:Imperial/Water_Report">Water Report</a></h2><br />
<h3>At a glance</h3><br />
<ul><br />
<br />
<li>Growing population, development and urbanisation make water shortages increasingly severe</li><br />
<li>Beyond public health implications, water shortages cause conflict and social issues throughout the world</li><br />
<li>Decentralisation of water treatment systems is necessary to increase resilience and adapt to changing demand</li><br />
<li>Wastewater recycling is increasingly essential but has technical and social hurdles to overcome</li><br />
<li>Innovative solutions for cost effective, decentralised water recycling are desperately needed</li><br />
</ul><br />
<br />
<br />
<br />
<br />
</section><br />
<br />
<section id="result7"><br />
<h2 style="color: inherit"><a href="https://2014.igem.org/Team:Imperial/The_i_in_iGEM">The i in iGEM</a></h2><br />
<br />
<h3>Overview</h3><br />
<p>As an international competition, every year iGEM welcomes teams from a great range of countries, with a variety of languages spoken amongst its teams and judges. This part of our Policy & Practices seeks to understand the effect of English as the <em>lingua franca</em> of science on the participation and outcome of the competition. In order to achieve this we have looked into the different nationalities of the teams and finalists and the different lingual backgrounds of teams and finalists over the years. We derived our conclusions by comparing this data with factors such as academic output and impact of their countries of origins, the lingual background of the iGEM judges, the international rankings of their universities and the English Proficiency Index of their countries of origin.</p><br />
<br />
<h3>Key Findings </h3><br />
<ul><br />
<li>The majority of iGEM finalists come from either English speaking countries or countries with high English Proficiency Index.</li><br />
<li>China is the country with the highest increase in participation over the last five years and is now second in participation only to the US.</li><br />
<li>Around 40% of the judges in championships can speak at least 1 more language other than English. Those languages are usually French and Mandarin.</li><br />
<li>The same percentage in the non-English speaking teams is now 64% and has risen by 10% in the last 5 years.</li><br />
<br />
<br />
</ul><br />
<br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>HChughtaihttp://2014.igem.org/Team:Imperial/FunctionalisationTeam:Imperial/Functionalisation2014-10-18T03:56:22Z<p>HChughtai: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Functionalisation</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#introduction">Introduction</a><br />
</li><br />
<li><a data-scroll href="#aim">Aims</a><br />
</li><br />
<li><a data-scroll href="#CBDs">CBDs</a><br />
</li><br />
<li><a data-scroll href="#binding-partners">Functionalisation proteins</a><br />
</li><br />
<br />
<li><a data-scroll href="#results">Results</a><br />
</li><br />
<li><a data-scroll href="#references">References</a><br />
</li><br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
</div><br />
</div><br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p>Attaching functional proteins to cellulose can expand the properties of cellulose and allow us to selectivity capture specific contaminants in water. By creating fusion proteins of sfGFP and metal-binding proteins with five different cellulose binding domains, three of which are new to the registry, we were able to characterise the relative affinities of the CBDs and show proof-of-concept removal of contaminants from water.</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>Key Achievements </h2><br />
<ul><br />
<li>Added three new cellulose binding domains to the registry</li><br />
<li>Performed an assay with sfGFP-fusions to determine the strongest potential binders which could be carried forward for further testing</li><br />
<li>Identified potential metal binding proteins to bind heavy metals from wastewater, including the addition of a new promising polypeptide phytochelatin EC20</li><br />
<li>Tested metal ion capture ability of the CBD-phytochelatin fusion constructs when attached to cellulose</li><br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<section id="introduction"><br />
<h2>Introduction</h2><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/a/a0/IC14-func-strategy-both-pursue.png"><br />
<figcaption>Figure 1. Pictorial summary showing the two cellulose functionalization approaches considered in our project. Strategy 1: Cellulose binding domains are expressed as fusions with the protein of interest, separated optionally by a linker sequence. The cellulose binding domains attach to the cellulose by hydrophobic interactions. Strategy 2: Curli fibrils are expressed in parallel with cellulose to form a composite material. The curli fibres coding sequence is modified to contain a ‘SpyTag’ peptide (Zakeri <i>et al</i> 2012) which binds specifically via a covalent isopeptide bond to its protein partner, ‘SpyCatcher’. This SpyCatcher is fused to the proteins of interest. In our project we only had time to pursue strategy 1 but are still excited about the potential of strategy 2 in the future.</figcaption><br />
</figure><br />
<p>Bacterial cellulose is already a useful biomaterial as is due its attractive mechanical properties, with research on applications from loudspeaker diaphragms to protective packaging and wound dressings (Lee 2014). However, our project also aims to extend the properties of cellulose by conjugating functional proteins and peptides to it. This allows us to target specific contaminants in water which can not be filtered by size exclusion alone. (See <a href="https://2014.igem.org/Team:Imperial/Water_Report">water report</a> and <a href="https://2014.igem.org/Team:Imperial/Informing_Design">informing design</a> sections).</p><br />
<br />
<p>We considered two ways of functionalising cellulose (figure 1) but continued to work fully on the cellulose-binding domain (CBD) method. The curli-fibre method would be an exciting avenue to explore in the future; it is feasible since there has already been research into making a “programmable” biomaterial from curli fibres using a peptide tag approach (Nguyen <i>et al</i> 2014), and in combination with cellulose could produce a composite with robust mechanical properties as well.<br />
</p><br />
<br />
</section><br />
<section id="aim"><br />
<h2>Aims</h2><br />
<br />
<p>We aimed to make and characterise new cellulose binding domains, and fuse them to functional proteins. (Incomplete)</p><br />
<br />
<br />
</section><br />
<section id="CBDs"><br />
<h2>Cellulose Binding Domains (CBDs)</h2><br />
<p>The cellulose binding domain (CBD) is the link between our functional proteins and the cellulose. Therefore, we wanted to use a CBD which had high affinity and strong binding to cellulose. However, weaker CBDs may still be useful since they could have the potential be controllably eluted under specific conditions, thereby enabling regeneration of the filter when saturated, and controlled disposal of the collected contaminants (refer to water report if relevant?).<br />
</p><br />
<p>We started our search by looking into the <a href="http://parts.igem.org/">parts registry</a> and found two CBDs already existed in the registry: CBDclos (<a href="http://parts.igem.org/Part:BBa_K863111">BBa_K863111</a>) and CBDcex (<a href="http://parts.igem.org/Part:BBa_K863101">BBa_K863101</a>). We also made three new CBDs to contribute to the registry: dCBD, CBDcipA, and CBDcenA. All the CBDs are in RFC(25) freiberg fusion format to allow for ease of use in protein fusions.</p><br />
<br />
<div class="accordion"><br />
<h3>CBDclos and CBDcex</h3><br />
<div><br />
<p>These parts were biobricked by <a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/cbc">Bielefeld 2012</a>, please see their part pages (<a href="http://parts.igem.org/Part:BBa_K863111">BBa_K863111</a>a and <a href="http://parts.igem.org/Part:BBa_K863101">BBa_K863101</a>) for detailed information. CBDclos is from the cellulolytic bacterium <em>Clostridium cellulovorans</em> and CBDcex originates from the cellulolytic bacterium <em>Cellulomonas fimi</em>. This is the same organism as for CBDcenA; cex is from the exoglucanase gene and cen is from the endoglucanase gene.</p><br />
</div><br />
<h3>Double CBD (dCBD) with N-terminal linker</h3><br />
<div><br />
<p>This part, <a href="http://parts.igem.org/Part:BBa_K1321340">BBa_K1321340</a> is based on the double cellulose-binding domain construct synthesised and characterised by Linder <i>et al</i>1996, who found that this double CBD had higher affinity for cellulose than either of the two CBDs on their own. The main difference is that our part contains an additional linker sequence on the N-terminus of the protein.<br />
</p><br />
<p>The two CBDs are from the fungus <i>Trichoderma reesei</i> (<i>Hypocrea jecorina</i>) Exocellobiohydrolase (Exoglucanase) I (cbh1), uniprot ID P62694; and Exocellobiohydrolase (Exoglucanase) II, uniprot ID P07987 (cbh2); with a linker peptide between the two CBDs and at the N-terminus of the protein. Both linkers are the same amino acid sequence and are based on the endogenous linker sequences that exists in cbh1 and cbh2 genes. The linker sequence is PGANPPGTTTTSRPATTTGSSPGP which is the same as used by Linder <i>et al</i> 1996. The first three amino acids are from the cbh2 endogenous linker, and the rest is from the cbh1 endogenous linker. CBDcbh1 is placed C-terminal to CBDcbh2 because naturally CBDcbh1 is a C-terminal domain and CBDcbh2 is an N-terminal domain. Both CBDs are from the <a class='iframe' href="http://www.cazy.org/CBM1.html">CBM family 1</a>. The precise location of the CBD within the cbh genes was slightly different according to the uniprot annotations and the sequence used by Linder <i>et al</i> 1996; we chose to use the sequence from the paper since the protein was expressed and characterised successfully.</p><br />
<br />
</div><br />
<h3>CBDcipA with N and C-terminal linker</h3><br />
<div><br />
<p>This CBD is from the Cellulosomal -scaffolding protein A (cipA) of Clostridium thermocellum including the endogenous linker sequences at the N and C-terminus (<a class='iframe' href="http://www.uniprot.org/uniprot/Q06851">UniProt ID Q06851</a>). It is in RFC25 format to allow for easy use in protein fusions.</p><br />
<br />
<p>The CBD is part of the <a class='iframe' href="http://www.cazy.org/CBM3.html">CBM3 family</a> . This CBD has been used in many application: in fusions with cell adhesion peptides to enhance the properties of cellulose as a cell-growth matrix (Andrade <i>et al </i> 2010a, Andrade <i>et al </i> 2010b), fused to enzymes to remove contaminants from water (Kauffmann <i> et al </i> 2000) and fused to an antimicrobial peptide (Ramos, Domingues & Gama 2010).</p><br />
<br />
<p>At present the cloning for these constructs is still in progress to correct an illegal EcoRI site which was identified in the parts with this CBD. This can be achieved with a silent mutation via site-directed mutagenesis and we aim to send these parts to the registry once thi<br />
</p><br />
<br />
</div><br />
<h3>CBDcenA with C-terminal linker</h3><br />
<div><br />
<p>This CBD is from the Endoglucanase A (cenA) gene from <i>Cellulomonas fimi</i> and also contains an endogenous C-terminal linker. The cellulose binding domain region occurs at the N-terminus of the cenA gene (UniProt P07984 link to http://www.uniprot.org/uniprot/P07984) and is from the <a class='iframe' href="http://www.cazy.org/CBM2.html">CBM family 2</a><br />
</p><br />
<p>The linker sequence (PTTSPTPTPTPTTPTPTPTPTPTPTPTVTP) is Pro-Thr box which has an extended conformation and acts as a hinge region (Gilkes <i>et al</i> 1989). The endoglucanase CBDcenA has 50% homology to the exoglucanase CBDcex (<a class="iframe" href="http://parts.igem.org/Part:BBa_K863101">BBa_K863101</a>) and the linker is highly conserved in both, but the order of the catalytic, linker and cellulose-binding regions is reversed (Warren <i>et al</i> 1986). It has been shown that CBDcenA has the highest binding affinity for crystalline cellulose out of the <i>C. fimi</i> CBDs (Kim <i>et al</i> 2013).<br />
</p><br />
</div><br />
</div><br />
</section><br />
<br />
<br />
</section><br />
<section id="binding-partners"><br />
<h2>Functionalisation proteins: Binding partners</h2><br />
<h3>Superfolder Green Fluorescent Protein (sfGFP) </h3><br />
<figure class="content-image image-right"> <br />
<img class="image-full" src=https://static.igem.org/mediawiki/2014/8/85/IC14-sfGFP-part-table.PNG> <br />
<figcaption>sfGFP-CBD fusion parts</figcaption> <br />
</figure> <p> sfGFP is a more stable mutant of <a href="http://parts.igem.org/Parts:BBa_E0040">mut3GFP</a> and we chose to use this as a robust, easily visible protein to initially fuse to our CBDs. We also designed one of our assays [insert link on 'one of our assays'] for characterising CBD binding using the sfGFP fusion constructs. sfGFP already existed in the registry (<a href="http://parts.igem.org/Part:BBa_I746916">BBa_I746916</a>), detailed information on sfGFP properties is included in this part description) however since we needed to make fusion proteins with our CBDs we modified the part and submitted it in RFC[25] Freiberg fusion format (<a href="http://parts.igem.org/Parts:BBa_K1321337">K1321337</a>). We created the following fusion parts with sfGFP: <br />
<br />
<br />
<br />
</p><br />
<br />
<h3> Metal Binding Proteins </h3><br />
<p>One of the contaminants we can filter out which current size-exclusion technologies can not target, are <a href="https://2014.igem.org/Team:Imperial/Water_Report">heavy metals</a>. We have worked with four different metal binding proteins: the metallothioneins SmtA and fMT, a histidine-rich nickel binding protein (NiBP) from the bacterium <i>Heliobacter pylori</i> and a synthetic phytochelatin (PC) EC20.<br />
</p><br />
<div class="accordion"><br />
<h3>SmtA and fMT metallothioneins</h3><br />
<div><br />
<p>These two parts already existed in the BioBrick registry, but since we needed to use them as fusions with the CBDs we improved the parts by making them compatible with the <a class="iframe" href="http://parts.igem.org/Assembly_standard_25">RFC(25) Frieburg Fusion BioBrick standard.</a></p><br />
<p>Metallothioneins (MTs) are genetically encoded cysteine-rich peptides which serve a role in the detoxification of heavy metals in plants, animals and some prokaryotes (Cobbett, 2002). They have a similar structure and function to phytochelatins, but are produced by different mechanisms (Cobbett, 2002). SmtA is from the cyanobacteria <i>Synechococcus sp.</i> and was used by the <a target="_blank" href="https://2011.igem.org/Team:Tokyo-NoKoGen">Tokyo-NoKoGen 2011</a> iGEM team (who submitted the RFC10 part originally, <a class="iframe" href="http://parts.igem.org/Part:BBa_K519010">BBa_K519010</a>) to confer cadmium (Cd2+) tolerance to <em>E. coli</em> cells when expressed. fMT originates from the seaweed <i>Fucus vesiculosus</i> and was submitted by <a target="_blank" href="https://2009.igem.org/Team:Groningen">Groningen 2009 iGEM team </a> and detailed information can be found on the original part page (<a class="iframe" href="http://parts.igem.org/Part:BBa_K190019">BBa_K190019</a>).</p><br />
<p>We successfully <a href="https://2014.igem.org/Team:Imperial/Protocols#general">cloned</a> the following CBD fusion constructs: </p><br />
<br />
<figure class="content-image image-right image-small"> <br />
<img class="image-full" src=https://static.igem.org/mediawiki/2014/a/ac/IC14-SmtA-part-table.PNG> <br />
<figcaption>SmtA-CBD fusion parts</figcaption> <br />
</figure> <br />
<br />
<figure class="content-image image-left image-small"> <br />
<img class="image-full" src=https://static.igem.org/mediawiki/2014/6/62/IC14-fMT-part-table.PNG> <br />
<figcaption>fMT-CBD fusion parts</figcaption> <br />
</figure> <br />
<br />
<br />
<br />
<br />
</div><br />
<h3>Nickel binding protein (NiBP)</h3><br />
<div><br />
<figure class="content-image image-right"> <br />
<img class="image-full" src=https://static.igem.org/mediawiki/2014/f/f6/IC14-NiBP-part-table.PNG> <br />
<figcaption>NiBP-CBD fusions parts</figcaption> <br />
</figure><br />
<p><br />
This protein is the histidine-rich nickel-binding protein from <i>Heliobacter pylori</i> (GenBank accession ACX98466.1), and already existed as a BioBrick in the registry (<a class="iframe" href="http://parts.igem.org/Part:K1151001">K1151001</a>). Since we needed to use this part in fusion proteins we improved the part by submitting it as a basic part in RFC(25) (link) Freiberg fusion format (<a class="iframe" href="http://parts.igem.org/Part:K1321009">K1321009</a>).<br />
</p><br />
<p>We successfully <a href="https://2014.igem.org/Team:Imperial/Protocols#general">cloned</a> the following CBD fusion constructs with NiBP:<br />
<br />
</p><br />
<p>However we discovered late on in the project that the DNA sequence of the NiBP protein in the registry is out of frame, leading to an incorrect protein translation and read-through of the stop codon (figure 2).</p><br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/8/80/IC14-NiBP-protein-alignment.PNG"><br />
<figcaption>Figure 2. Alignment of BBa_K1151001 NiBP in the registry to the , showing incorrect amino-acid sequence in red compared to <a target="_blank" href="http://www.ncbi.nlm.nih.gov/protein/261838700">native <i>H.pylori</i></a> sequence.<br />
</figcaption><br />
</figure><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/e/e1/IC14-NiBP-DNA-alignment.PNG"><br />
<figcaption>Figure 3. Single nucleotide deletion in BBa_K1151001 compared to native <i>H.pylori</i> sequence (<a target="_blank" href="http://www.ncbi.nlm.nih.gov/nuccore/261837457">GenBank CP000012.1</a> (link ) bp1391851-1392033, reverse complement) resulting in any downstream nucleotides being out of frame.</figcaption><br />
</figure><br />
<br />
<p>Further investigation into the error let us to identify a single nucleotide deletion in <a class="iframe" href="http://parts.igem.org/Part:BBa_K1151001">BBa_K1151001</a> compared to the native <i>H.pylori</i> DNA sequence (<a target="_blank" href="http://www.ncbi.nlm.nih.gov/nuccore/261837457">GenBank CP000012.1</a> bp1391851-1392033, reverse complement strand). As seen in Figure 3 the deletion is a ‘C’ at bp 53 of the native sequence. This error was propagated through all our NiBP constructs and means that any subsequent C-terminal fusions are also out of frame and we were unable to express and characterise these constructs. We have noted this on the description pages for each of the parts and hope that in the future they will still be useful, since the error could be corrected relatively easily by a team who wishes to use them by site-directed-mutagenesis PCR to insert the missing nucleotide. </p><br />
<br />
<br />
<br />
</div><br />
<h3>Synthetic phytochelatin EC20</h3><br />
<div><br />
<p>This is our new contribution of a metal-binding protein to the parts registry. Synthetic phytochelatins are analogues of phytochelatins (PCs); cysteine-rich peptides of the general structure (γ-GluCys)n-Gly (n~2-5) which bind and sequester heavy metals, with a role in detoxification (Cobbett & Goldsbrough 2002). PCs are found mainly in plants but also in other organisms including diatoms, fungi, algae (including cyanobacteria) and some invertebrates (Cobbett & Goldsbrough 2002, Rea 2012). Natively, the PCs are enzymatically synthesized by phytochelatin synthase (PCS) from a glutathione (GSH) precursor and the amino acids in the resulting peptide are linked by the non-standard gamma peptide bonds (Cobbett & Goldsbrough 2002, Rea 2012). However, genetically encoded analogues (containing normal alpha-peptide bonds) of different number Glu-Cys (EC) repeats have been characterised, with the EC20 having the highest binding (Bae <i>et al</i> 2000).<br />
</p><br />
<br />
<br />
<figure class="content-image image-right image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/1/18/IC14-Biondo-et-al-2012-ion-table.PNG"><br />
<figcaption>Table 1. Metal ion adsorption increase of C. metallidurans cells with PC EC20 displayed on cell surface, compared to negative control. Taken from Biondo <i>et al</i> 2012</figcaption><br />
</figure><br />
<p>The main metal PCs confer tolerance to is Cadmium (Cobbett & Goldsbrough 2002) with a reported stoichiometry of 10 Cd2+ per peptide (Bae <i>et al</i>, . EC20 peptide has still showed good metal ion binding whilst fused to a cellulose binding domain (CBD) for water purification (Xu <i>et al</i> 2002) and when anchored to bacterial cell membrane to confer Cd2+ tolerance (Bae <i>et al</i> 2000, Chaturvedi & Archana 2014). PC EC20 has also been shown to bind many more heavy metals. For example, when displayed on the surface of Cupriavidus metallidurans, the cells capacity to adsorb ions increased by 31 to 219% depending on the ion (table 1, Biondo <i>et al</i> 2012). These binding properties of PC EC20 have been utilised in applications including a regeneratable biosensor of Hg2+, Cd2+, Pb2+, Cu2+ and Zn2+ ions to 100 fM–10 mM (Bontidean <i>et al</i> 2003), and to target CdSe/ZnS quantum dots to streptavidin expressing HeLa cells when biotinylated (Pinaud <i>et al</i> 2004). INSERT TABLE OF THE IONS FROM THE PAPER<br />
</p><br />
<p>We used this part to <a href="https://2014.igem.org/Team:Imperial/Protocols#general">clone</a> a library of different cellulose-binding domains fused to phytochelatin:<figure class="content-image"> <br />
<img class="image-full" src=https://static.igem.org/mediawiki/2014/4/40/IC14-PC-part-table.PNG > <br />
<figcaption>Phytochelatin-CBD fusion parts. </figcaption> <br />
</figure> <br />
</p><br />
</div><br />
<br />
</div><br />
<br />
<br />
<br />
<h3> Other potential proteins </h3><br />
<p>During our research we also explored other functional proteins to fuse to the CBDs.<br />
<div class="accordion"><br />
<h3>Laccases</h3><br />
<div><br />
<p>Laccases are enzymes which can break down aromatic and phenolic compounds such as modified estrogens which can end up unfiltered in the water supply with unknown consequences (Auriol <i>et al</i> 2008). This method of treating estrogen in water was explored by <a target="_blank" href="https://2012.igem.org/Team:Bielefeld-Germany">Bielefeld 2012 iGEM team</a>, and our system also has potential to address this.<br />
</p><br />
</div><br />
<br />
<h3>Nanobodies</h3><br />
<div><br />
<p>Nanobodies are fragments of camelid antibodies which can be generated against a variety of antigens and can be easily expressed by organisms such as <i>E. coli </i>. Nanobodies could be used to target viruses, which are often too small to be filtered by size exclusion. For example there are already nanobodies which can bind to <i> Vaccinia </i> virus, ricin, <i>Cholera</i> toxin, Stephylococcal enterotoxin B and H5N1 Influenza (Goldman <i>et al </i> 2006, Ibanez <i>et al </i> 2011) to name a few. Additionally, nanobodies are stable and can be selected to resist proteolytic attach (Harmsen <i>et al </i> 2006). Nanobodies can also be functional when as fusions or conjugates to other proteins for example to target enzymes to specific cells (Cortez-Retamozo 2004), so there is much potential for targeting a wide array of contaminants when fused to cellulose binding domains.<br />
<br />
</p><br />
</div><br />
</div><br />
<br />
</section><br />
<br />
<br />
<section id="results"><br />
<h2>Results</h2><br />
<p>The assay for strength of CBD binding utilised our sfGFP-CBD fusion proteins. Strength of binding was assayed between the CBDs by assuming it will be proportional to the level of fluorescence which remains after washing of cellulose coated plates(link to plates protocol)<br />
<div class="accordion"><br />
<h3>Preliminary Assay</h3><br />
<div><br />
<p>text</p><br />
</div><br />
<h3>Full Assay</h3><br />
<div><br />
<figure class="content-image image-full"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/4/44/IC14-Etoh.png"><br />
<figcaption>Figure: </figcaption><br />
</figure><br />
<figure class="content-image image-full"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/d/da/IC14-Water.png"><br />
<figcaption>Figure: </figcaption><br />
</figure><br />
<p>text</p><br />
</div><br />
</div><br />
</section><br />
<br />
<section id="references"><br />
<h2>References</h2><br />
<br />
<ul><br />
<li>Andrade, F.K., Costa, R., Domingues, L., Soares, R., et al. (2010) Improving bacterial cellulose for blood vessel replacement: Functionalization with a chimeric protein containing a cellulose-binding module and an adhesion peptide. Acta biomaterialia. [Online] 6 (10), 4034–4041. Available from: doi:10.1016/j.actbio.2010.04.023.</li><br />
<br />
<li>Andrade, F.K., Moreira, S.M.G., Domingues, L. & Gama, F.M.P. (2010) Improving the affinity of fibroblasts for bacterial cellulose using carbohydrate-binding modules fused to RGD. Journal of biomedical materials research. Part A. [Online] 92 (1), 9–17. Available from: doi:10.1002/jbm.a.32284.</li><br />
<br />
<li>Auriol, M., Filali-Meknassi, Y., Adams, C.D., Tyagi, R.D., et al. (2008) Removal of estrogenic activity of natural and synthetic hormones from a municipal wastewater: efficiency of horseradish peroxidase and laccase from Trametes versicolor. Chemosphere. [Online] 70 (3), 445–452. Available from: doi:10.1016/j.chemosphere.2007.06.064.</li><br />
<br />
<li>Bae, W., Chen, W., Mulchandani, A. & Mehra, R.K. (2000) Enhanced bioaccumulation of heavy metals by bacterial cells displaying synthetic phytochelatins. Biotechnology and bioengineering. 70 (5), 518–524.</li><br />
<br />
<li>Biondo, R., da Silva, F.A., Vicente, E.J., Souza Sarkis, J.E., et al. (2012) Synthetic phytochelatin surface display in Cupriavidus metallidurans CH34 for enhanced metals bioremediation. Environmental science & technology. 46 (15), 8325–8332.</li><br />
<br />
<li>Bontidean, I., Ahlqvist, J., Mulchandani, A., Chen, W., et al. (2003) Novel synthetic phytochelatin-based capacitive biosensor for heavy metal ion detection. Biosensors and Bioelectronics. 18 (5-6), 547–553.</li><br />
<br />
<li>Chaturvedi, R. & Archana, G. (2014) Cytosolic expression of synthetic phytochelatin and bacterial metallothionein genes in Deinococcus radiodurans R1 for enhanced tolerance and bioaccumulation of cadmium. Biometals : an international journal on the role of metal ions in biology, biochemistry, and medicine. 27 (3), 471–482.</li><br />
<br />
<br />
<li>Cobbett, C. & Goldsbrough, P. (2002) Phytochelatins and metallothioneins: roles in heavy metal detoxification and homeostasis. Annual review of plant biology. [Online] 53159–182. Available from: doi:10.1146/annurev.arplant.53.100301.135154.</li><br />
<br />
<li>Cortez-Retamozo, V. (2004) Efficient Cancer Therapy with a Nanobody-Based Conjugate. Cancer Research. [Online] 64 (8), 2853–2857. Available from: doi:10.1158/0008-5472.CAN-03-3935.</li><br />
<br />
<li>Gilkes, N.R., Kilburn, D.G., Miller, R.C. & Warren, R.A. (1989) Structural and functional analysis of a bacterial cellulase by proteolysis. The Journal of biological chemistry. 264 (30), 17802–17808.</li><br />
<br />
<li>Harmsen, M.M., van Solt, C.B., van Zijderveld-van Bemmel, A.M., Niewold, T.A., et al. (2006) Selection and optimization of proteolytically stable llama single-domain antibody fragments for oral immunotherapy. Applied microbiology and biotechnology. [Online] 72 (3), 544–551. Available from: doi:10.1007/s00253-005-0300-7.</li><br />
<br />
<li>Kauffmann, C., Shoseyov, O., Shpigel, E., Bayer, E.A., et al. (2000) Novel Methodology for Enzymatic Removal of Atrazine from Water by CBD-Fusion Protein Immobilized on Cellulose. Environmental Science & Technology. [Online] 34 (7), 1292–1296. Available from: doi:10.1021/es990754h.</li><br />
<br />
<li>Kim, H.-D., Choi, S.-L., Kim, H., Sohn, J.H., et al. (2013) Enzyme-linked assay of cellulose-binding domain functions from Cellulomonas fimi on multi-well microtiter plate. Biotechnology and Bioprocess Engineering. 18 (3), 575–580.</li><br />
<br />
<li>Lee, K.-Y., Buldum, G., Mantalaris, A. and Bismarck, A. (2014), More Than Meets the Eye in Bacterial Cellulose: Biosynthesis, Bioprocessing, and Applications in Advanced Fiber Composites. Macromol. Biosci., 14: 10–32. doi: 10.1002/mabi.201300298</li><br />
<br />
<li>Linder, M.; Salovuori, I.; Ruohonen, L.; Teeri, T.T., 1996. Characterization of a Double Cellulose-binding Domain. SYNERGISTIC HIGH AFFINITY BINDING TO CRYSTALLINE CELLULOSE. Journal of Biological Chemistry, 271(35), pp.21268–21272. Available at: http://www.jbc.org/content/271/35/21268.full</li><br />
<br />
<li>Nguyen, P.Q., Botyanszki, Z., Tay, P.K.R. & Joshi, N.S. (2014) Programmable biofilm-based materials from engineered curli nanofibres. Nature communications. [Online] 54945. Available from: doi:10.1038/ncomms5945.</li><br />
<br />
<li>Pinaud, F., King, D., Moore, H.-P. & Weiss, S. (2004) Bioactivation and cell targeting of semiconductor CdSe/ZnS nanocrystals with phytochelatin-related peptides. Journal of the American Chemical Society. 126 (19), 6115–6123.</li><br />
<br />
<br />
<li>Ramos, R., Domingues, L. & Gama, M. (2010) Escherichia coli expression and purification of LL37 fused to a family III carbohydrate-binding module from Clostridium thermocellum. Protein expression and purification. [Online] 71 (1), 1–7. Available from: doi:10.1016/j.pep.2009.10.016.</li><br />
<br />
<li>Warren, R.A., Beck, C.F., Gilkes, N.R., Kilburn, D.G., et al. (1986) Sequence conservation and region shuffling in an endoglucanase and an exoglucanase from Cellulomonas fimi. Proteins. 1 (4), 335–341.</li><br />
<br />
<li>Xu, Z., Bae, W., Mulchandani, A., Mehra, R.K., et al. (2002) Heavy Metal Removal by Novel CBD-EC20 Sorbents Immobilized on Cellulose. Biomacromolecules. [Online] 3 (3), 462–465.</li><br />
<br />
<li>Zakeri, B., Fierer, J.O., Celik, E., Chittock, E.C., et al. (2012) Peptide tag forming a rapid covalent bond to a protein, through engineering a bacterial adhesin. Proceedings of the National Academy of Sciences of the United States of America. [Online] 109 (12), E690–E697. Available from: doi:10.1073/pnas.1115485109.</li><br />
</ul><br />
<br />
<br />
<br />
<br />
</section><br />
</div><br />
</body><br />
</html><br />
<br />
{{:Team:Imperial/Templates:footer}}</div>HChughtaihttp://2014.igem.org/Team:Imperial/EColiTeam:Imperial/EColi2014-10-18T03:51:55Z<p>HChughtai: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1><em>E. coli</em></h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#introduction">Introduction</a><br />
</li><br />
<li><a data-scroll href="#aim">Aims</a><br />
</li><br />
<li><a data-scroll href="#engineering">Engineering</a><br />
</li><br />
<li><a data-scroll href="#methods">Materials and Methods</a><br />
</li><br />
<br />
<li><a data-scroll href="#results">Results</a><br />
</li><br />
<li><a data-scroll href="#future">Future Work</a><br />
</li><br />
<li><a data-scroll href="#references">References</a><br />
</li><br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p><em>Escherichia coli</em> is the organism of choice for synthetic biology. It is thoroughly characterised, easy to engineer and has numerous parts, control circuits and complex constructs tested in this host.</p><br />
<p>Some <em>E. coli</em> strains have evolved to produce low amounts of cellulose but the machinery under specific regulatory control (its secretion is generally linked to biofilm formation and stress situations). In order to expand the use of bacterial cellulose as a functional biomaterial that is cost effective to produce, it is desirable for its production machinery to be implemented in an organisms that is easy to engineer and has proven success in large scale bioreactors.</p><br />
<p>Here, we confirm that the high output cellulose production machinery of <em>Gluconacetobacter Xylinus</em> can be transferred into other organisms. We have proven function of the Acs cellulose producing operon in <em>Escherichia coli</em> using Congo Red binding assays.<br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>Key Achievements </h2><br />
<ul><br />
<li>Contributed an optimised Asc cellulose production operon to Registry of Standard Parts.</li><br />
<li>Proved the portability of <em>Gluconacetobacter xylinus</em> operon.</li><br />
<li>Assembled a fully synthetic, functional, cellulose-producing system in <em>Escherichia coli</em></li><br />
<li>Demonstrated the synthesis operon in a two plasmid system for separate induction of genes</li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<br />
<br/><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<figure class="content-image image-full"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/2/20/IC14-ecoli-fig1.jpg"><br />
<figcaption>Figures 1 & 2: Congo red staining of microbial cellulose in <em>E. coli</em></figcaption><br />
</figure><br />
</div><br />
<br />
<br />
<div class="pure-u-1-2"><br />
<figure class="content-image image-full"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/a/ad/IC14-ecoli-fig3.jpg"><br />
<figcaption></figcaption><br />
</figure><br />
</div><br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<section id="Aims"><br />
<h2>Aims</h2><br />
<br />
<p>By transferring the cellulose production operon from its native organism <em>Gluconacetobacter xylinus</em> into the lab and industrially friendly host <em>Escherichia coli</em>, we aim to improve cellulose production per unit time to achieve more cost effective pellicle growth and to encourage further synthetic biology with microbial cellulose. <em>E. coli</em> grows considerably faster plus tolerates higher temperatures and more vigorous aeration. The ease of genetic engineering and the wealth of other characterized Biobricks increases the potential for exciting future projects</p><br />
<br />
<br />
</section><br />
<section id="engineering"><br />
<h2>Engineering</h2><br />
<p>The cellulose production operon in <em>Gluconacetobacter xylinus</em> is a 10kb genomic region, consisting of four main elements:</p><br />
<ul><br />
<li>acsAB, known as cellulose synthase, is made up of two domains: acsA being the catalytic domain, and acsB being the cyclic-di-GMP-binding domain. This modular enzyme requires the second messenger cyclic-di-GMP in order to carry out efficient catalysis.</li><br />
<li>acsC codes for an oligomeric element that gets embedded in the extracellular membrane and allows transport of the growing polymer across the cell membrane into the extracellular environment.</li><br />
<li>acsD is believed to be a non-essential element, although it is a key player in the control of cellulose crystallinity and required for maximal cellulose productivity.</li><br />
</ul><br />
<p>The native operon is highly regulated at transcriptional, translational and post-translational levels. Cellulose production responds to a wide set of internal signals and environmental cues. The native ribosomal binding sites (RBS) are predicted to be weak by translation rate calculators (The <a href="https://salis.psu.edu/software/"> Salis Lab RBS calculator </a> and <a href="http://sbi.postech.ac.kr/utr_designer"> Postech UTR designer </a>). This is perhaps to reduce noise in gene expression (strong promoter, weak RBS is less noisy that weak promoter strong RBS). The promoter region has not yet been characterized in <em>Gluconacetobacter xylinus</em>, however.</p><br />
<br />
<p>The first step of our computational design engineering was to identify the coding sequences and extract them from NCBI. We removed some native regulation by codon-optimizing the sequences for expression in <em>E.coli</em> and replaced the native RBS’s with the strong B0034 sequence. The 6 base pairs either side of the B0034 RBS were edited with the Salis Lab RBS calculator design function to tune RBS strength output to better preserve the natural stoichiometry.</p><br />
<br />
<p>Finally, in order to allow for even more customizable fine-tuning of the system, the operon was divided and cloned into two separate expression vectors: the AcsAB element was cloned under the control of the inducible pBAD promoter contained within pSB1C3, a high copy plasmid that would contribute to higher expression of Cellulose Synthase. Alternatively, AcsC and AcsD, believed to be expressed at lower levels in <em>G.xylinus</em>, was put under the control of the pLAC promoter and was transferred into a low copy plasmid, pSB3K3 so as to maintain lower levels of expression. This approach provided the following advantages:</p><br />
<ul><br />
<li>Reducing the size of the final expression vector avoids complications during assembly and vector take-up, and it also prevents a large construct from becoming a burden for cell growth and vector propagation.</li><br />
<li>By expressing the cellulose production machinery from two separate expression vectors, the following levels of control become available to us: the first being the changes in vector copy number, which directly affects gene expression levels throughout induction, and the second being the ability to activate the system using two different inducers. These key features of our system allow for a larger scope for fine-tuning and optimization of cellulose production levels.</li><br />
<br />
</ul><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/5/55/IC14-ecoli-pBAD-pLAC-CD.png"><br />
<figcaption>Figure 3: pSB-pBAD-AB and pLAC-CD</figcaption><br />
</figure><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/e/e7/IC14-ecoli-ABCDfragments.jpg.png"><br />
<figcaption>Figure 4: acsABCD fragments</figcaption><br />
</figure><br />
<p>With this approach, we allow for our system to be implemented in new range of hosts because a larger set of growth conditions, inducer concentrations and growth phases can be tested in order to achieve the required stoichiometry for the system to become functional.</p><br />
<br />
<br />
<p>In order to ease synthesis, the operon sequence was split into 4 fragments of similar sizes. We took advantage of the presence of two restriction sites: An NcoI present within the AcsAB sequence, and a PvuII site contained within AcsC. Furthermore, the BioBrick prefix and suffix were included and any additional sites removed elsewhere.</p><br />
<br />
<p>By standard cloning, these fragments could easily be put together to yield the following constructs:</p><br />
<figure class="content-image image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/f/ff/IC14-ecoli-AB-CD-constructs.png"><br />
<figcaption>Figure 5: acsAB and acsCD constructs</figcaption><br />
</figure><br />
<br />
<p>Gene Designer served as a very useful tool for assembling constructs and predicting cloning outcomes before proceeding with the experimental procedure. Find above the plasmid maps of our resulting constructs, and refer to Materials and Methods for a deeper insight into the assembly process.</p><br />
<br />
</section><br />
<section id="methods"><br />
<h2>Materials and Methods</h2><br />
<div class="accordion"><br />
<h3>1.0 Cell Strains and Media Components</h3><br />
<div><br />
<p><em>Escherichia coli</em> strain DH10B were made chemically competent following a standard protocol and were used to clone the pSB-AraC-pBAD and pSB-LacI-pLAC elements. Additionally, High Efficiency chemically competent DH10B <em>Escherichia coli</em> were purchased from New England Biolabs for assembly of the Acs cellulose-producing operon, which was codon-optimized for expression in E.coli and synthesized by GeneArt. Both strains were grown overnight in liquid cultures (supplemented with specific antibiotics), or on semi-solid LB-Agar plates, provided with the specific antibiotic, as listed on the table below.</p><br />
<br />
<p>Luria Broth Miller (LB) and LB Agar were purchased from VWR, prepared using standard protocols and used throughout the experimental procedure. During characterization, Acs-containing strains were supplemented with 1% D-glucose, 0.1% Arabinose and 0.5mM IPTG.<br />
</p><br />
<br />
<figure class="content-image"><br />
<table class="tg image-full"><br />
<tr><br />
<th class="tg-e3zv">Plasmid name</th><br />
<th class="tg-e3zv">Vector backbone</th><br />
<th class="tg-e3zv">Antibiotic concentration (ug/ml)</th><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AraC-pBAD</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-LacI-pLAC</td><br />
<td class="tg-031e">pSB3K3</td><br />
<td class="tg-031e">Kanamycin 25</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AcsAB</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AcsCD</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AraC-pBAD-AcsAB</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-LacI-pLAC-CD</td><br />
<td class="tg-031e">pSB3K3</td><br />
<td class="tg-031e">Kanamycin 25</td><br />
</tr><br />
</table><br />
<figcaption>Figure 6: List of antibiotics used, in relation to their respective constructs</figcaption><br />
</figure><br />
<br />
</div><br />
<h3>2.0 Chemicals </h3><br />
<div><br />
<p>Congo Red was purchased from Sigma Aldrich (Steiheim, Germany) and diluted in 1x PBS to a concentration of 350 uM. The final Congo Red concentration used during system characterization steps was 20 uM. This was also used, also at a concentration of 20 uM, to make LB Agar Congo Red Assay plates.</p><br />
</div><br />
<h3>3.0 Construct Assembly</h3><br />
<div><br />
<h4>3.1 Cloning of pSB-AraC-pBAD</h4><br />
<div><br />
<p>The AraC and pBAD elements were obtained by PCR, using the Biobricks BBa_K325108, BBa_K325218 and BBa_K325219 as DNA templates, all of which follow the standard structure showed on figure 7. The primers used during this procedure were as follows:<br />
</p><br />
<ul><br />
<li>Forward: TACTAGTAGCGGCCGCTGCAG</li><br />
<li>Reverse: GCTAGCCCAAAAAAACGGGTATGGAG</li><br />
</ul><br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/d/d4/IC14-ecoli-AraC-pBAD.png"><br />
<figcaption>Figure 7 - Plasmid maps describing both the original (left) and engineered (right) AraC-pBAD-containing parts, including all relevant elements. These were designed and cloned in silico on GeneDesigner.</figcaption><br />
</figure><br />
</div><br />
<p>The amplified elements were DpnI-treated following a standard procedure (New England Biolabs), and were subsequently submitted to a purification step (Qiaquick PCR clean up, Qiagen) prior to self-ligation. Three different template concentrations were tested during ligation (specifically 3 ng, 7.5 ng and 15 ng), and were incubated at room temperature for 1h+. The ligation mix was then transformed into chemically competent DH10B Escherichia coli using a standard chemical transformation protocol and plated out on Chloramphenicol-specific LB plates.</p><br />
<h4>3.2 Cloning of pSB3K3-LacI-pLAC</h4><br />
<p>A compatible plasmid and induction system was cloned to allow expression of the operon in two parts. The medium/strong promoter J23110 was cloned in front of the quad part inverter Q01121. The inverter has an RBS, the LacI repressor followed by a double terminator then a Lac inducible promoter. The composite part created give constitutive expression of the Lac repressor allowing for induction by IPTG. The parts were then moved into the pSB3k3 backbone to be compatible with pSB1C3.</p><br />
<div><br />
<br />
</div><br />
<h4>3.3 Assembly of AcsAB and AcsCD </h4><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/3/3c/IC14-ecoli-construct-assembly.jpg"><br />
<figcaption>Figure 8:</figcaption><br />
</figure><br />
<p>The AcsABCD operon was designed in silico as described in the previous section. It was ordered for synthesis at GenArt in the form of four separate elements of similar sizes, named AcsA, AcsB, AcsC and AcsD, respectively. After synthesis, the constructs were directly transformed into DH10B <em>E.coli</em> using a standard chemical transformation protocol and plated overnight supplied with 50 ug/ml Kanamycin. 5ml LB were inoculated with a freshly growing colony and grown overnight at 37 C, under shaking conditions. Glycerol stocks were produced prior to proceeding with the assembly process.</p><br />
<p>In order to meet the Registry standards, we aimed to clone these elements into pSB1C3. To do so, we proceeded as described on figure 8. Two separate rounds of digestion were carried out using EcoRI, NcoI, PvuII and PstI to, and the resulting fragments (AcsA, AcsB, AcsC and AcsD and linearized pSB1C3) were submitted to a three-part ligation after dephosphorylation of the vector backbone (rAPid desphosphorylation, Roche). An equimolar ratio amongst all three parts was established during the ligation procedure, which in turn proceeded at 4 degrees overnight. The NEB High Efficiency Transformation protocol was used on NEB 10B cells (New England Biolabs) to propagate the resulting plasmid. Transformed cells were plated and incubated overnight at 37 C. 5 ml LB supplied with 50 ug/ml Chloramphenicol were inoculated with a selection of colonies for further analysis (refer to Results for additional information).</p><br />
<br />
<h4>3.4 Assembly of pSB-AraC-pBAD-AcsAB</h4><br />
<p>AcsAB was cloned into pSB-AraC-pBAD by Biobrick cloning. The destination vector was linearized using SpeI and PstI (New England Biolabs), and AcsAB (previously digested with XbaI and PstI, and gel extracted using the Minelute Gel Extraction Kit, by Qiagen) was ligated at a 1:1 ratio throughout an overnight ligation at room temperature. The resulting part was transformed into chemically competent DH10B Escherichia coli and plated on LB Agar+Chloramphenicol plates, grown overnight at 37 C. 5 ml LB falcons supplied with 50 ug/ml Chloramphenicol were inoculated with a selection of freshly grown colonies for further restriction analysis (refer to Results for additional information)</p><br />
<br />
<h4>3.5 Assembly of pSB-LacI-pLAC-CD</h4><br />
<p>Similarly to 3.4, AcsCD was cloned by BioBrick cloning into the pSB3K3 low copy expression vector containing the LacI-pLAC regulatory elements. Vector and insert were ligated at a 1:1 ratio overnight at room temperature. After transformation and plating on LB Agar+Kanamycin (25 ug/ml), colonies were screened by Greentaq colony PCR, and were further confirmed during the Congo Red Assay.</p><br />
</div><br />
<h3>Electroporation of pSB-pLAC-CD into electrocompetent AcsAB-containing DH10B cells</h3> <br />
<div><br />
<p>DH10B E.coli already containing the AcsAB construct were made electrocompetent using a standard protocol, which can be found in the Protocols section. A second round of transformation was carried out to insert pLAC-AcsCD. 5ul of miniprepped pSB-pLAC-CD (diluted in ddH2O) were added into 50ul electrocompetent DH10B cells already containing the pBAD-inducible AcsAB element. Electroporation was carried out in in 10mm electrocuvettes at 1.8 kV, 200 Ohm resistance and 25 mF capacitance. 500ul SOC medium was added to the electroporated samples and these were recovered at 37 °C for 1h before plating on Kanamycin25 + Chloramphenicol 50 LB Agar plates.</p><br />
</div><br />
<h3>Congo Red Characterization</h3><br />
<div><br />
<p>LB Agar Congo Red assay plates were prepared with a final Congo Red concentration of 20uM, and they were supplied with 0.1% Arabinose, 0.5mM IPTG, 50 ug/mL Chloramphenicol, 25 ug/mL Kanamycin and 1% Glucose. Transformed cells containing both AcsAB and AcsCD were plated on Congo Red assay plates and incubated at 37 °C. They were qualitatively assayed after 24h and 48h for cellulose production. Finally, 5 mL LB supplied with 0.1% Arabinose, 0.5mM IPTG, 50 ug/mL Chloramphenicol, 25 ug/mL Kanamycin and 1% Glucose were inoculated with freshly grown, cellulose-producing colonies and were grown for 16h at 30 °C, 180 rpm. An empty vector control was also grown overnight for comparative analysis. These liquid cultues were supplied with Congo Red, to yield a final concentration of 20uM. They were incubated under static conditions for 2h at room temperature, and were later pelleted down to allow for qualitative analysis of Congo Red binding.</p><br />
<br />
<p>AcsAB functionality was assayed by inducing AcsAB-containing cells with 0.1% Arabinose in 5mL LB supplied with 1% Glucose and Chloramphenicol. Overnight incubations were set up at 30 °C and 37 °C, and both empty vector controls and un-induced controls were also assayed. Cells were pelleted at 4000rpm for 10 minutes and the supernatant was kept for further analysis. Cells were resuspended in 1xPBS and sonicated for 3 minutes as on/off cycles of 15 seconds. Both the membrane and soluble samples produced after centrifugation were kept for further analysis. Congo Red was then added to the LB, soluble and membrane samples up to a final concentration of 20uM, and no Congo Red samples were also kept for further inspection. Samples were incubated for 2h at static conditions and at room temperature to allow for Congo Red binding. 96-well plates were inoculated for further absorbance measurements at 490nm.</p><br />
</div><br />
<br />
<br />
</div><br />
</section><br />
<br />
<br />
<section id="results"><br />
<h2>Results</h2><br />
<div class="accordion"><br />
<h3>Constructs</h3><br />
<div><br />
<p>All constructs were assembled as described in Materials and Methods. As a preliminary verification step, restriction analyses were carried out using the corresponding restriction enzymes (refer to figure legends for more details) and results were visualized on 0.7-1% agarose gels. Final confirmation was obtained by gene sequencing, during which the BioBrick Verification Primers and walking primers were used. These are shown on the table below, please refer to the Registry for further information.</p><br />
<br />
<figure class="content-image"><br />
<table class="tg image-full"><br />
<tr><br />
<th </th><br />
<th </th><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AraC-pBAD</td><br />
<td class="tg-031e">Forward: TACTAGTAGCGGCCGCTGCAG<br />
<br>Reverse: GCTAGCCCAAAAAAACGGGTATGGAG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">BioBrick Verification Primers</td><br />
<td class="tg-031e">Forward: TGCCACCTGACGTCTAAGAA<br />
<br>Reverse: ATTACCGCCTTTGAGTGAGC</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 1</td><br />
<td class="tg-031e">TCT GAA TTA TGC CAT TGG TCA TAC CG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 2</td><br />
<td class="tg-031e">ATA TGT TTC ATG CAG TTG GCA CC</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 3</td><br />
<td class="tg-031e">GAT GCA TGG GTT GAT TGG GG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 4</td><br />
<td class="tg-031e">ATC CAG CAC ATC CGA CCT TTG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 5</td><br />
<td class="tg-031e">GTT ACC GCA AGT AAA CTG CAA G</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 6</td><br />
<td class="tg-031e">GAT GGT CTG ATT CGT CTG GTT A</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 7</td><br />
<td class="tg-031e">ACG CAG CAC AGG TCA GAC CGG TGA A</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 8</td><br />
<td class="tg-031e">ATA TTG ATC TGA CCA CCG AACA</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 9</td><br />
<td class="tg-031e">TGC ACC GCC TGG TGA AAA TGG TT</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 10</td><br />
<td class="tg-031e">GTG GCT ATG CAA TTC AGA CAG GT</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 11</td><br />
<td class="tg-031e">TTC ATT CCC AGC GGT CGG TCG AT</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 12</td><br />
<td class="tg-031e">GTT TGC GTG GTG ATC TTT TT</td><br />
</tr><br />
</table><br />
<figcaption>Figure 9 - List of primers used by Team E.coli during the experimental procedure</figcaption><br />
</figure><br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/f/f8/IC14-ecoli-gel-pSB-AcsAB.jpg"><br />
<figcaption>Figure 10: Restriction Analysis results of AcsAB. Samples were submitted to an XbaI/PstI double digest, which flank the AcsAB construct. Two bands were displayed as expected: a ~5kb band corresponding to the AcsAB insert, and a ~2kb band corresponding to the pSB1C3 vector backbone. </figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/c/c1/IC14-ecoli-gel-pSB-AcsCD.jpg"><br />
<figcaption>Figure 11: Restriction analysis results of AcsCD. Samples were submitted to an XbaI/SpeI double restriction. Positive samples displayed a 4.4kb band corresponding to the AcsCD insert, in addition to a 2kb band that corresponded to the pSB1C3 plasmid backbone. </figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/b/b9/IC14-ecoli-gel-pSB-AraC-pBAD.jpg"><br />
<figcaption>Figure 12: Restriction Analysis results of AraC-pBAD. Samples were submitted to an XbaI/PstI double digest. A 2-band pattern was obtained, indicating the presence of a ~2kb DNA fragment corresponding to the pSB1C3 vector backbone, and a ~1kb fragment corresponding to the AraC and pBAD elements being cloned. </figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/e/e7/IC14-ecoli-gel-pSB-AraC-pBAD-AcsAB-pSB-LacI-AcsAB.jpg"><br />
<figcaption>Figure 13: Restriction Analysis results of AraC-pBAD. Samples were submitted to an XbaI/PstI double digest. A 2-band pattern was obtained, indicating the presence of a ~2kb DNA fragment corresponding to the pSB1C3 vector backbone, and a ~1kb fragment corresponding to the AraC and pBAD elements being cloned. </figcaption><br />
</figure><br />
</div><br />
<br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/4/4a/IC14-ecoli-gel-colony1.jpg"><br />
<figcaption>Figure 14: pLAC-AcsCD colony PCR results. Further details on the procedure can be found on the Methods and Materials section. Those colonies that we testes further have been highlighted with numbers on the pictures. Specifically, colony A1 was used for subcloning into AcsAB containing E.coli DH10B. <br />
Plates A and B were generated <br />
</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/1/10/IC14-ecoli-gel-colony2.jpg"><br />
<figcaption>Figure 15: pLAC-AcsCD colony PCR results. Further details on the procedure can be found on the Methods and Materials section. Those colonies that we testes further have been highlighted with numbers on the pictures. Specifically, colony A1 was used for subcloning into AcsAB containing E.coli DH10B. <br />
Plates A and B were generated <br />
</figcaption><br />
</figure><br />
</div><br />
</div><br />
<br />
<br />
<br />
</div><br />
<h3>Characterising Cellulose Production</h3><br />
<div><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/f/fe/IC14-ecoli-fig2.png"><br />
<figcaption>Figure 16:</figcaption><br />
</figure><br />
<p>Cellulose Production can be easily assayed using the diazo dye Congo Red. Congo Red specifically binds cellulostic fibrils, and this binding can be measured by spectral analysis, because it causes a shift on the spectral properties of the dye, which can be monitored with a spectrophotometer (Klunk et al., 1999). In addition to this, Congo Red also allows for visual, qualitative analysis: it causes a color change of any cellulose-producing colonies by binding to the growing fibres. Therefore, cellulose production can be easily detected by eye on LB Agar plates and liquid cultures (Jolanta Sereikaite and Vladas-Algirdas Bumelis, 2006).</p><br />
<br />
<p>We assayed cellulose production on LB Agar Congo Red assay plates. Colonies containing the refactored cellulose production machinery turned red within 24h, and presented a rougher composition and brighter red color after 48h. In contrast to this, colonies presenting empty vector (negative controls), presented no color changes and maintained the characteristics of standard <em>Escherichia coli</em> colonies (smoother composition and standard yellow colour).</p><br />
<br />
<p>To confirm this qualitative assay, a second qualitative assay was carried out, also based on Congo Red binding. This second analysis consisted of incubating overnight cultures (both cellulose producers and empty vector controls) with Congo Red as described in Materials and Methods. Cellulose producers will present growing cellulose fibres on their extracellular surface, hence will dye red in the presence of Congo Red, unlike non-cellulose-producing cells. After spinning down the cells, a red pellet was observed that corresponded to the cellulose producing colonies. In contrast to this, negative controls did not bind Congo Red and hence maintained the standard E.coli characteristics. We consider that this qualitative data supports our design and confirms that the cellulose production operon has been successfully refactored and transferred into <em>Escherichia coli</em>.</p><br />
<br />
<p>In order to gain a better understanding of the activity of the Acs elements in Escherichia coli, it was of interest to explore whether the AcsAB element alone would be enough to achieve cellulose production. AcsAB is embedded in the cytoplasmic membrane and transports the growing polymer through the membrane as it attaches the glucose monomers in the cytoplasm. In the absence of AcsC and AcsD, no cellulose can be secreted into the environment and as a result, it was assumed that it would instead become accumulated in the cell’s periplasm. For this reason, during characterization we required sonication in order to get the cellulose (if any at all) out of the cells.</p><br />
<br />
<p>To widen our screening, we set up induced samples and uninduced controls and assayed samples at different temperatures (30°C versus 37°C) and different conditions (shaking versus static) in the presence or absence of 1% D-Glucose. Furthermore, 2 Biological replicates were assayed, and technical triplicates were also set up during plate reading to support any statistically relevant findings. Although we expected no cellulose to be accumulating in the medium, we still analysed all fractions originating throughout the procedure: LB fractions, soluble fractions and non-soluble fractions (called membrane fractions throughout this study).</p><br />
<br />
<p>All fractions were incubated in the presence of Congo Red (as described in Materials and Methods) and were later inoculated into a 96-well plate for absorbance measurements at 490nm. Free Congo Red has a maximal absorption at such wavelength. By setting up a control sample, containing solvent (PBS)+ Congo Red, it is possible to measure the total absorbance of the molecule whilst free in solution. When cellulolytic samples are incubated in the presence of Congo Red, less azodye molecules becomes available in the medium due to binding, hence absorbance levels will decrease. The total Congo Red bound will equal the absorbance of Congo Red Control minus the absorbance of our samples of interest. This approach gives you an idea of the amount of Congo Red that may have bound to the cellulositic fibres, but it does not provide exact values of cellulose present.</p><br />
<br />
<figure class="content-image image-half"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/7/76/IC14-congo.png"><br />
<figcaption>Figure 17: LB fraction - Congo Red Binding</figcaption><br />
</figure><br />
<p>As expected, LB fractions all presented similar, non-cellulolytic composition and hence displayed no changes in absorbance, indicating no CR binding. </p><br />
<figure class="content-image image-half"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/b/bb/IC14-Membrane_fraction.png"><br />
<figcaption>Figure 18: Membrane Fraction - Induction of the pBAD-AcsAB</figcaption><br />
</figure><br />
<p>It was observed that interestingly, membrane fractions that had been previously incubated at 30 C presented a dramatic change in Congo Red binding. This proves not only that the AcsAB is active (at least to some extent) in the absence of AcsC and AcsD, but also that it may be optimal for the cellulose synthase to be folded and functional at lower temperatures, as it occurs in the native host G.xylinus. </p><br />
<br />
</div><br />
<br />
<br />
</section><br />
<br />
<br />
<br />
<section id="references"><br />
<h2>References</h2><br />
<ol><br />
<li>Lee, K.Y; Guldum, G.; Mantalaris, A.; Bismarck, A.; (2014) “More than meets the eye in Bacterial Cellulose: Biosynthesis, Bioprocessing and Applications in Advanced Fiber Composites” <a href="http://onlinelibrary.wiley.com/store/10.1002/mabi.201300298/asset/mabi201300298.pdf?v=1&t=i1ef935d&s=482503feebacfa4a7a977e554b9f410fa6d22a5f&systemMessage=Wiley+Online+Library+will+be+disrupted+on+the+18th+October+from+10%3A00+BST+%2805%3A00+EDT%29+for+essential+maintenance+for+approximately+two+hours+as+we+make+upgrades+to+improve+our+services+to+you">Available here</a> </li><br />
<li>P. Ross, R. Mayer, and M. Benziman (1991) "Cellulose biosynthesis and function in bacteria," Microbiol Mol Biol Rev, vol. 55, no. 1, pp. 35-58, Mar</li><br />
<li>Sereikaite, J.; Bumelis, V.A. (2006) Congo Red Interactions with alpha-proteins. Available on: http://www.actabp.pl/pdf/1_2006/87.pdf</li><br />
<li>W. E. Klunk, R. F. Jacob, and R. P. Mason, “Quantifying amyloid by congo red spectral shift assay,” Methods in Enzymology, vol. 309, pp. 285–305, 1999.</li><br />
<li>https://2013.igem.org/Team:Toronto/Project/Assays</li><br />
<li>https://2010.igem.org/Team:Tokyo_Metropolitan/Project/Fiber/Protocol</li><br />
<br />
<br />
<br />
<br />
<br />
</ol><br />
</section><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
<br />
{{:Team:Imperial/Templates:footer}}</div>HChughtaihttp://2014.igem.org/Team:Imperial/EColiTeam:Imperial/EColi2014-10-18T03:51:08Z<p>HChughtai: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1><em>E. coli</em></h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#introduction">Introduction</a><br />
</li><br />
<li><a data-scroll href="#aim">Aims</a><br />
</li><br />
<li><a data-scroll href="#engineering">Engineering</a><br />
</li><br />
<li><a data-scroll href="#methods">Materials and Methods</a><br />
</li><br />
<br />
<li><a data-scroll href="#results">Results</a><br />
</li><br />
<li><a data-scroll href="#future">Future Work</a><br />
</li><br />
<li><a data-scroll href="#references">References</a><br />
</li><br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p><em>Escherichia coli</em> is the organism of choice for synthetic biology. It is thoroughly characterised, easy to engineer and has numerous parts, control circuits and complex constructs tested in this host.</p><br />
<p>Some <em>E. coli</em> strains have evolved to produce low amounts of cellulose but the machinery under specific regulatory control (its secretion is generally linked to biofilm formation and stress situations). In order to expand the use of bacterial cellulose as a functional biomaterial that is cost effective to produce, it is desirable for its production machinery to be implemented in an organisms that is easy to engineer and has proven success in large scale bioreactors.</p><br />
<p>Here, we confirm that the high output cellulose production machinery of <em>Gluconacetobacter Xylinus</em> can be transferred into other organisms. We have proven function of the Acs cellulose producing operon in <em>Escherichia coli</em> using Congo Red binding assays.<br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>Key Achievements </h2><br />
<ul><br />
<li>Contributed an optimised Asc cellulose production operon to Registry of Standard Parts.</li><br />
<li>Proved the portability of <em>Gluconacetobacter xylinus</em> operon.</li><br />
<li>Assembled a fully synthetic, functional, cellulose-producing system in <em>Escherichia coli</em></li><br />
<li>Demonstrated the synthesis operon in a two plasmid system for separate induction of genes</li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<br />
<br/><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<figure class="content-image image-full"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/2/20/IC14-ecoli-fig1.jpg"><br />
<figcaption>Figures 1 & 2: Congo red staining of microbial cellulose in <em>E. coli</em></figcaption><br />
</figure><br />
</div><br />
<br />
<br />
<div class="pure-u-1-2"><br />
<figure class="content-image image-full"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/a/ad/IC14-ecoli-fig3.jpg"><br />
<figcaption></figcaption><br />
</figure><br />
</div><br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<section id="Aims"><br />
<h2>Aims</h2><br />
<br />
<p>By transferring the cellulose production operon from its native organism <em>Gluconacetobacter xylinus</em> into the lab and industrially friendly host <em>Escherichia coli</em>, we aim to improve cellulose production per unit time to achieve more cost effective pellicle growth and to encourage further synthetic biology with microbial cellulose. <em>E. coli</em> grows considerably faster plus tolerates higher temperatures and more vigorous aeration. The ease of genetic engineering and the wealth of other characterized Biobricks increases the potential for exciting future projects</p><br />
<br />
<br />
</section><br />
<section id="engineering"><br />
<h2>Engineering</h2><br />
<p>The cellulose production operon in <em>Gluconacetobacter xylinus</em> is a 10kb genomic region, consisting of four main elements:</p><br />
<ul><br />
<li>acsAB, known as cellulose synthase, is made up of two domains: acsA being the catalytic domain, and acsB being the cyclic-di-GMP-binding domain. This modular enzyme requires the second messenger cyclic-di-GMP in order to carry out efficient catalysis.</li><br />
<li>acsC codes for an oligomeric element that gets embedded in the extracellular membrane and allows transport of the growing polymer across the cell membrane into the extracellular environment.</li><br />
<li>acsD is believed to be a non-essential element, although it is a key player in the control of cellulose crystallinity and required for maximal cellulose productivity.</li><br />
</ul><br />
<p>The native operon is highly regulated at transcriptional, translational and post-translational levels. Cellulose production responds to a wide set of internal signals and environmental cues. The native ribosomal binding sites (RBS) are predicted to be weak by translation rate calculators (The <a href="https://salis.psu.edu/software/"> Salis Lab RBS calculator </a> and <a href="http://sbi.postech.ac.kr/utr_designer"> Postech UTR designer </a>). This is perhaps to reduce noise in gene expression (strong promoter, weak RBS is less noisy that weak promoter strong RBS). The promoter region has not yet been characterized in <em>Gluconacetobacter xylinus</em>, however.</p><br />
<br />
<p>The first step of our computational design engineering was to identify the coding sequences and extract them from NCBI. We removed some native regulation by codon-optimizing the sequences for expression in <em>E.coli</em> and replaced the native RBS’s with the strong B0034 sequence. The 6 base pairs either side of the B0034 RBS were edited with the Salis Lab RBS calculator design function to tune RBS strength output to better preserve the natural stoichiometry.</p><br />
<br />
<p>Finally, in order to allow for even more customizable fine-tuning of the system, the operon was divided and cloned into two separate expression vectors: the AcsAB element was cloned under the control of the inducible pBAD promoter contained within pSB1C3, a high copy plasmid that would contribute to higher expression of Cellulose Synthase. Alternatively, AcsC and AcsD, believed to be expressed at lower levels in <em>G.xylinus</em>, was put under the control of the pLAC promoter and was transferred into a low copy plasmid, pSB3K3 so as to maintain lower levels of expression. This approach provided the following advantages:</p><br />
<ul><br />
<li>Reducing the size of the final expression vector avoids complications during assembly and vector take-up, and it also prevents a large construct from becoming a burden for cell growth and vector propagation.</li><br />
<li>By expressing the cellulose production machinery from two separate expression vectors, the following levels of control become available to us: the first being the changes in vector copy number, which directly affects gene expression levels throughout induction, and the second being the ability to activate the system using two different inducers. These key features of our system allow for a larger scope for fine-tuning and optimization of cellulose production levels.</li><br />
<br />
</ul><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/5/55/IC14-ecoli-pBAD-pLAC-CD.png"><br />
<figcaption>Figure 3: pSB-pBAD-AB and pLAC-CD</figcaption><br />
</figure><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/e/e7/IC14-ecoli-ABCDfragments.jpg.png"><br />
<figcaption>Figure 4: acsABCD fragments</figcaption><br />
</figure><br />
<p>With this approach, we allow for our system to be implemented in new range of hosts because a larger set of growth conditions, inducer concentrations and growth phases can be tested in order to achieve the required stoichiometry for the system to become functional.</p><br />
<br />
<br />
<p>In order to ease synthesis, the operon sequence was split into 4 fragments of similar sizes. We took advantage of the presence of two restriction sites: An NcoI present within the AcsAB sequence, and a PvuII site contained within AcsC. Furthermore, the BioBrick prefix and suffix were included and any additional sites removed elsewhere.</p><br />
<br />
<p>By standard cloning, these fragments could easily be put together to yield the following constructs:</p><br />
<figure class="content-image image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/f/ff/IC14-ecoli-AB-CD-constructs.png"><br />
<figcaption>Figure 5: acsAB and acsCD constructs</figcaption><br />
</figure><br />
<br />
<p>Gene Designer served as a very useful tool for assembling constructs and predicting cloning outcomes before proceeding with the experimental procedure. Find above the plasmid maps of our resulting constructs, and refer to Materials and Methods for a deeper insight into the assembly process.</p><br />
<br />
</section><br />
<section id="methods"><br />
<h2>Materials and Methods</h2><br />
<div class="accordion"><br />
<h3>1.0 Cell Strains and Media Components</h3><br />
<div><br />
<p><em>Escherichia coli</em> strain DH10B were made chemically competent following a standard protocol and were used to clone the pSB-AraC-pBAD and pSB-LacI-pLAC elements. Additionally, High Efficiency chemically competent DH10B <em>Escherichia coli</em> were purchased from New England Biolabs for assembly of the Acs cellulose-producing operon, which was codon-optimized for expression in E.coli and synthesized by GeneArt. Both strains were grown overnight in liquid cultures (supplemented with specific antibiotics), or on semi-solid LB-Agar plates, provided with the specific antibiotic, as listed on the table below.</p><br />
<br />
<p>Luria Broth Miller (LB) and LB Agar were purchased from VWR, prepared using standard protocols and used throughout the experimental procedure. During characterization, Acs-containing strains were supplemented with 1% D-glucose, 0.1% Arabinose and 0.5mM IPTG.<br />
</p><br />
<br />
<figure class="content-image"><br />
<table class="tg image-full"><br />
<tr><br />
<th class="tg-e3zv">Plasmid name</th><br />
<th class="tg-e3zv">Vector backbone</th><br />
<th class="tg-e3zv">Antibiotic concentration (ug/ml)</th><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AraC-pBAD</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-LacI-pLAC</td><br />
<td class="tg-031e">pSB3K3</td><br />
<td class="tg-031e">Kanamycin 25</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AcsAB</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AcsCD</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AraC-pBAD-AcsAB</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-LacI-pLAC-CD</td><br />
<td class="tg-031e">pSB3K3</td><br />
<td class="tg-031e">Kanamycin 25</td><br />
</tr><br />
</table><br />
<figcaption>Figure 6: List of antibiotics used, in relation to their respective constructs</figcaption><br />
</figure><br />
<br />
</div><br />
<h3>2.0 Chemicals </h3><br />
<div><br />
<p>Congo Red was purchased from Sigma Aldrich (Steiheim, Germany) and diluted in 1x PBS to a concentration of 350 uM. The final Congo Red concentration used during system characterization steps was 20 uM. This was also used, also at a concentration of 20 uM, to make LB Agar Congo Red Assay plates.</p><br />
</div><br />
<h3>3.0 Construct Assembly</h3><br />
<div><br />
<h4>3.1 Cloning of pSB-AraC-pBAD</h4><br />
<div><br />
<p>The AraC and pBAD elements were obtained by PCR, using the Biobricks BBa_K325108, BBa_K325218 and BBa_K325219 as DNA templates, all of which follow the standard structure showed on figure 7. The primers used during this procedure were as follows:<br />
</p><br />
<ul><br />
<li>Forward: TACTAGTAGCGGCCGCTGCAG</li><br />
<li>Reverse: GCTAGCCCAAAAAAACGGGTATGGAG</li><br />
</ul><br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/d/d4/IC14-ecoli-AraC-pBAD.png"><br />
<figcaption>Figure 7 - Plasmid maps describing both the original (left) and engineered (right) AraC-pBAD-containing parts, including all relevant elements. These were designed and cloned in silico on GeneDesigner.</figcaption><br />
</figure><br />
</div><br />
<p>The amplified elements were DpnI-treated following a standard procedure (New England Biolabs), and were subsequently submitted to a purification step (Qiaquick PCR clean up, Qiagen) prior to self-ligation. Three different template concentrations were tested during ligation (specifically 3 ng, 7.5 ng and 15 ng), and were incubated at room temperature for 1h+. The ligation mix was then transformed into chemically competent DH10B Escherichia coli using a standard chemical transformation protocol and plated out on Chloramphenicol-specific LB plates.</p><br />
<h4>3.2 Cloning of pSB3K3-LacI-pLAC</h4><br />
<p>A compatible plasmid and induction system was cloned to allow expression of the operon in two parts. The medium/strong promoter J23110 was cloned in front of the quad part inverter Q01121. The inverter has an RBS, the LacI repressor followed by a double terminator then a Lac inducible promoter. The composite part created give constitutive expression of the Lac repressor allowing for induction by IPTG. The parts were then moved into the pSB3k3 backbone to be compatible with pSB1C3.</p><br />
<div><br />
<br />
</div><br />
<h4>3.3 Assembly of AcsAB and AcsCD </h4><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/3/3c/IC14-ecoli-construct-assembly.jpg"><br />
<figcaption>Figure 8:</figcaption><br />
</figure><br />
<p>The AcsABCD operon was designed in silico as described in the previous section. It was ordered for synthesis at GenArt in the form of four separate elements of similar sizes, named AcsA, AcsB, AcsC and AcsD, respectively. After synthesis, the constructs were directly transformed into DH10B <em>E.coli</em> using a standard chemical transformation protocol and plated overnight supplied with 50 ug/ml Kanamycin. 5ml LB were inoculated with a freshly growing colony and grown overnight at 37 C, under shaking conditions. Glycerol stocks were produced prior to proceeding with the assembly process.</p><br />
<p>In order to meet the Registry standards, we aimed to clone these elements into pSB1C3. To do so, we proceeded as described on figure 8. Two separate rounds of digestion were carried out using EcoRI, NcoI, PvuII and PstI to, and the resulting fragments (AcsA, AcsB, AcsC and AcsD and linearized pSB1C3) were submitted to a three-part ligation after dephosphorylation of the vector backbone (rAPid desphosphorylation, Roche). An equimolar ratio amongst all three parts was established during the ligation procedure, which in turn proceeded at 4 degrees overnight. The NEB High Efficiency Transformation protocol was used on NEB 10B cells (New England Biolabs) to propagate the resulting plasmid. Transformed cells were plated and incubated overnight at 37 C. 5 ml LB supplied with 50 ug/ml Chloramphenicol were inoculated with a selection of colonies for further analysis (refer to Results for additional information).</p><br />
<br />
<h4>3.4 Assembly of pSB-AraC-pBAD-AcsAB</h4><br />
<p>AcsAB was cloned into pSB-AraC-pBAD by Biobrick cloning. The destination vector was linearized using SpeI and PstI (New England Biolabs), and AcsAB (previously digested with XbaI and PstI, and gel extracted using the Minelute Gel Extraction Kit, by Qiagen) was ligated at a 1:1 ratio throughout an overnight ligation at room temperature. The resulting part was transformed into chemically competent DH10B Escherichia coli and plated on LB Agar+Chloramphenicol plates, grown overnight at 37 C. 5 ml LB falcons supplied with 50 ug/ml Chloramphenicol were inoculated with a selection of freshly grown colonies for further restriction analysis (refer to Results for additional information)</p><br />
<br />
<h4>3.5 Assembly of pSB-LacI-pLAC-CD</h4><br />
<p>Similarly to 3.4, AcsCD was cloned by BioBrick cloning into the pSB3K3 low copy expression vector containing the LacI-pLAC regulatory elements. Vector and insert were ligated at a 1:1 ratio overnight at room temperature. After transformation and plating on LB Agar+Kanamycin (25 ug/ml), colonies were screened by Greentaq colony PCR, and were further confirmed during the Congo Red Assay.</p><br />
</div><br />
<h3>Electroporation of pSB-pLAC-CD into electrocompetent AcsAB-containing DH10B cells</h3> <br />
<div><br />
<p>DH10B E.coli already containing the AcsAB construct were made electrocompetent using a standard protocol, which can be found in the Protocols section. A second round of transformation was carried out to insert pLAC-AcsCD. 5ul of miniprepped pSB-pLAC-CD (diluted in ddH2O) were added into 50ul electrocompetent DH10B cells already containing the pBAD-inducible AcsAB element. Electroporation was carried out in in 10mm electrocuvettes at 1.8 kV, 200 Ohm resistance and 25 mF capacitance. 500ul SOC medium was added to the electroporated samples and these were recovered at 37 °C for 1h before plating on Kanamycin25 + Chloramphenicol 50 LB Agar plates.</p><br />
</div><br />
<h3>Congo Red Characterization</h3><br />
<div><br />
<p>LB Agar Congo Red assay plates were prepared with a final Congo Red concentration of 20uM, and they were supplied with 0.1% Arabinose, 0.5mM IPTG, 50 ug/mL Chloramphenicol, 25 ug/mL Kanamycin and 1% Glucose. Transformed cells containing both AcsAB and AcsCD were plated on Congo Red assay plates and incubated at 37 °C. They were qualitatively assayed after 24h and 48h for cellulose production. Finally, 5 mL LB supplied with 0.1% Arabinose, 0.5mM IPTG, 50 ug/mL Chloramphenicol, 25 ug/mL Kanamycin and 1% Glucose were inoculated with freshly grown, cellulose-producing colonies and were grown for 16h at 30 °C, 180 rpm. An empty vector control was also grown overnight for comparative analysis. These liquid cultues were supplied with Congo Red, to yield a final concentration of 20uM. They were incubated under static conditions for 2h at room temperature, and were later pelleted down to allow for qualitative analysis of Congo Red binding.</p><br />
<br />
<p>AcsAB functionality was assayed by inducing AcsAB-containing cells with 0.1% Arabinose in 5mL LB supplied with 1% Glucose and Chloramphenicol. Overnight incubations were set up at 30 °C and 37 °C, and both empty vector controls and un-induced controls were also assayed. Cells were pelleted at 4000rpm for 10 minutes and the supernatant was kept for further analysis. Cells were resuspended in 1xPBS and sonicated for 3 minutes as on/off cycles of 15 seconds. Both the membrane and soluble samples produced after centrifugation were kept for further analysis. Congo Red was then added to the LB, soluble and membrane samples up to a final concentration of 20uM, and no Congo Red samples were also kept for further inspection. Samples were incubated for 2h at static conditions and at room temperature to allow for Congo Red binding. 96-well plates were inoculated for further absorbance measurements at 490nm.</p><br />
</div><br />
<br />
<br />
</div><br />
</section><br />
<br />
<br />
<section id="results"><br />
<h2>Results</h2><br />
<div class="accordion"><br />
<h3>Constructs</h3><br />
<div><br />
<p>All constructs were assembled as described in Materials and Methods. As a preliminary verification step, restriction analyses were carried out using the corresponding restriction enzymes (refer to figure legends for more details) and results were visualized on 0.7-1% agarose gels. Final confirmation was obtained by gene sequencing, during which the BioBrick Verification Primers and walking primers were used. These are shown on the table below, please refer to the Registry for further information.</p><br />
<br />
<figure class="content-image"><br />
<table class="tg image-full"><br />
<tr><br />
<th </th><br />
<th </th><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AraC-pBAD</td><br />
<td class="tg-031e">Forward: TACTAGTAGCGGCCGCTGCAG<br />
<br>Reverse: GCTAGCCCAAAAAAACGGGTATGGAG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">BioBrick Verification Primers</td><br />
<td class="tg-031e">Forward: TGCCACCTGACGTCTAAGAA<br />
<br>Reverse: ATTACCGCCTTTGAGTGAGC</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 1</td><br />
<td class="tg-031e">TCT GAA TTA TGC CAT TGG TCA TAC CG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 2</td><br />
<td class="tg-031e">ATA TGT TTC ATG CAG TTG GCA CC</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 3</td><br />
<td class="tg-031e">GAT GCA TGG GTT GAT TGG GG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 4</td><br />
<td class="tg-031e">ATC CAG CAC ATC CGA CCT TTG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 5</td><br />
<td class="tg-031e">GTT ACC GCA AGT AAA CTG CAA G</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 6</td><br />
<td class="tg-031e">GAT GGT CTG ATT CGT CTG GTT A</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 7</td><br />
<td class="tg-031e">ACG CAG CAC AGG TCA GAC CGG TGA A</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 8</td><br />
<td class="tg-031e">ATA TTG ATC TGA CCA CCG AACA</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 9</td><br />
<td class="tg-031e">TGC ACC GCC TGG TGA AAA TGG TT</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 10</td><br />
<td class="tg-031e">GTG GCT ATG CAA TTC AGA CAG GT</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 11</td><br />
<td class="tg-031e">TTC ATT CCC AGC GGT CGG TCG AT</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 12</td><br />
<td class="tg-031e">GTT TGC GTG GTG ATC TTT TT</td><br />
</tr><br />
</table><br />
<figcaption>Figure 9 - List of primers used by Team E.coli during the experimental procedure</figcaption><br />
</figure><br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/f/f8/IC14-ecoli-gel-pSB-AcsAB.jpg"><br />
<figcaption>Figure 10: Restriction Analysis results of AcsAB. Samples were submitted to an XbaI/PstI double digest, which flank the AcsAB construct. Two bands were displayed as expected: a ~5kb band corresponding to the AcsAB insert, and a ~2kb band corresponding to the pSB1C3 vector backbone. </figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/c/c1/IC14-ecoli-gel-pSB-AcsCD.jpg"><br />
<figcaption>Figure 11: Restriction analysis results of AcsCD. Samples were submitted to an XbaI/SpeI double restriction. Positive samples displayed a 4.4kb band corresponding to the AcsCD insert, in addition to a 2kb band that corresponded to the pSB1C3 plasmid backbone. </figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/b/b9/IC14-ecoli-gel-pSB-AraC-pBAD.jpg"><br />
<figcaption>Figure 12: Restriction Analysis results of AraC-pBAD. Samples were submitted to an XbaI/PstI double digest. A 2-band pattern was obtained, indicating the presence of a ~2kb DNA fragment corresponding to the pSB1C3 vector backbone, and a ~1kb fragment corresponding to the AraC and pBAD elements being cloned. </figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/e/e7/IC14-ecoli-gel-pSB-AraC-pBAD-AcsAB-pSB-LacI-AcsAB.jpg"><br />
<figcaption>Figure 13: Restriction Analysis results of AraC-pBAD. Samples were submitted to an XbaI/PstI double digest. A 2-band pattern was obtained, indicating the presence of a ~2kb DNA fragment corresponding to the pSB1C3 vector backbone, and a ~1kb fragment corresponding to the AraC and pBAD elements being cloned. </figcaption><br />
</figure><br />
</div><br />
<br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/4/4a/IC14-ecoli-gel-colony1.jpg"><br />
<figcaption>Figure 14: pLAC-AcsCD colony PCR results. Further details on the procedure can be found on the Methods and Materials section. Those colonies that we testes further have been highlighted with numbers on the pictures. Specifically, colony A1 was used for subcloning into AcsAB containing E.coli DH10B. <br />
Plates A and B were generated <br />
</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/1/10/IC14-ecoli-gel-colony2.jpg"><br />
<figcaption>Figure 15: pLAC-AcsCD colony PCR results. Further details on the procedure can be found on the Methods and Materials section. Those colonies that we testes further have been highlighted with numbers on the pictures. Specifically, colony A1 was used for subcloning into AcsAB containing E.coli DH10B. <br />
Plates A and B were generated <br />
</figcaption><br />
</figure><br />
</div><br />
</div><br />
<br />
<br />
<br />
</div><br />
<h3>Characterising Cellulose Production</h3><br />
<div><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/f/fe/IC14-ecoli-fig2.png"><br />
<figcaption>Figure 16:</figcaption><br />
</figure><br />
<p>Cellulose Production can be easily assayed using the diazo dye Congo Red. Congo Red specifically binds cellulostic fibrils, and this binding can be measured by spectral analysis, because it causes a shift on the spectral properties of the dye, which can be monitored with a spectrophotometer (Klunk et al., 1999). In addition to this, Congo Red also allows for visual, qualitative analysis: it causes a color change of any cellulose-producing colonies by binding to the growing fibres. Therefore, cellulose production can be easily detected by eye on LB Agar plates and liquid cultures (Jolanta Sereikaite and Vladas-Algirdas Bumelis, 2006).</p><br />
<br />
<p>We assayed cellulose production on LB Agar Congo Red assay plates. Colonies containing the refactored cellulose production machinery turned red within 24h, and presented a rougher composition and brighter red color after 48h. In contrast to this, colonies presenting empty vector (negative controls), presented no color changes and maintained the characteristics of standard <em>Escherichia coli</em> colonies (smoother composition and standard yellow colour).</p><br />
<br />
<p>To confirm this qualitative assay, a second qualitative assay was carried out, also based on Congo Red binding. This second analysis consisted of incubating overnight cultures (both cellulose producers and empty vector controls) with Congo Red as described in Materials and Methods. Cellulose producers will present growing cellulose fibres on their extracellular surface, hence will dye red in the presence of Congo Red, unlike non-cellulose-producing cells. After spinning down the cells, a red pellet was observed that corresponded to the cellulose producing colonies. In contrast to this, negative controls did not bind Congo Red and hence maintained the standard E.coli characteristics. We consider that this qualitative data supports our design and confirms that the cellulose production operon has been successfully refactored and transferred into <em>Escherichia coli</em>.</p><br />
<br />
<p>In order to gain a better understanding of the activity of the Acs elements in Escherichia coli, it was of interest to explore whether the AcsAB element alone would be enough to achieve cellulose production. AcsAB is embedded in the cytoplasmic membrane and transports the growing polymer through the membrane as it attaches the glucose monomers in the cytoplasm. In the absence of AcsC and AcsD, no cellulose can be secreted into the environment and as a result, it was assumed that it would instead become accumulated in the cell’s periplasm. For this reason, during characterization we required sonication in order to get the cellulose (if any at all) out of the cells.</p><br />
<br />
<p>To widen our screening, we set up induced samples and uninduced controls and assayed samples at different temperatures (30°C versus 37°C) and different conditions (shaking versus static) in the presence or absence of 1% D-Glucose. Furthermore, 2 Biological replicates were assayed, and technical triplicates were also set up during plate reading to support any statistically relevant findings. Although we expected no cellulose to be accumulating in the medium, we still analysed all fractions originating throughout the procedure: LB fractions, soluble fractions and non-soluble fractions (called membrane fractions throughout this study).</p><br />
<br />
<p>All fractions were incubated in the presence of Congo Red (as described in Materials and Methods) and were later inoculated into a 96-well plate for absorbance measurements at 490nm. Free Congo Red has a maximal absorption at such wavelength. By setting up a control sample, containing solvent (PBS)+ Congo Red, it is possible to measure the total absorbance of the molecule whilst free in solution. When cellulolytic samples are incubated in the presence of Congo Red, less azodye molecules becomes available in the medium due to binding, hence absorbance levels will decrease. The total Congo Red bound will equal the absorbance of Congo Red Control minus the absorbance of our samples of interest. This approach gives you an idea of the amount of Congo Red that may have bound to the cellulositic fibres, but it does not provide exact values of cellulose present.</p><br />
<br />
<figure class="content-image image-half"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/7/76/IC14-congo.png"><br />
<figcaption>Figure 17: LB fraction - Congo Red Binding</figcaption><br />
</figure><br />
<p>As expected, LB fractions all presented similar, non-cellulolytic composition and hence displayed no changes in absorbance, indicating no CR binding. </p><br />
<figure class="content-image image-half"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/b/bb/IC14-Membrane_fraction.png"><br />
<figcaption>Figure 18: Membrane Fraction - Induction of the pBAD-AcsAB</figcaption><br />
</figure><br />
<p>It was observed that interestingly, membrane fractions that had been previously incubated at 30 C presented a dramatic change in Congo Red binding. This proves not only that the AcsAB is active (at least to some extent) in the absence of AcsC and AcsD, but also that it may be optimal for the cellulose synthase to be folded and functional at lower temperatures, as it occurs in the native host G.xylinus. </p><br />
<br />
</div><br />
<br />
<br />
</section><br />
<br />
<br />
<br />
<section id="references"><br />
<h2>References</h2><br />
<ol><br />
<li>Lee, K.Y; Guldum, G.; Mantalaris, A.; Bismarck, A.; (2014) “More than meets the eye in Bacterial Cellulose: Biosynthesis, Bioprocessing and Applications in Advanced Fiber Composites” <a href="http://onlinelibrary.wiley.com/store/10.1002/mabi.201300298/asset/mabi201300298.pdf?v=1&t=i1ef935d&s=482503feebacfa4a7a977e554b9f410fa6d22a5f&systemMessage=Wiley+Online+Library+will+be+disrupted+on+the+18th+October+from+10%3A00+BST+%2805%3A00+EDT%29+for+essential+maintenance+for+approximately+two+hours+as+we+make+upgrades+to+improve+our+services+to+you">Available here</a> </li><br />
<li>P. Ross, R. Mayer, and M. Benziman (1991) "Cellulose biosynthesis and function in bacteria," Microbiol Mol Biol Rev, vol. 55, no. 1, pp. 35-58, Mar</li><br />
<li>Sereikaite, J.; Bumelis, V.A. (2006) Congo Red Interactions with alpha-proteins. Available on: http://www.actabp.pl/pdf/1_2006/87.pdf</li><br />
<li>W. E. Klunk, R. F. Jacob, and R. P. Mason, “Quantifying amyloid by congo red spectral shift assay,” Methods in Enzymology, vol. 309, pp. 285–305, 1999.</li><br />
<li>https://2013.igem.org/Team:Toronto/Project/Assays</li><br />
<li>https://2010.igem.org/Team:Tokyo_Metropolitan/Project/Fiber/Protocol</li><br />
<li></li><br />
<br />
<br />
<br />
<br />
</ol><br />
</section><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
<br />
{{:Team:Imperial/Templates:footer}}</div>HChughtaihttp://2014.igem.org/Team:Imperial/ResultsTeam:Imperial/Results2014-10-18T03:47:52Z<p>HChughtai: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Results</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#overview">Overview</a><br />
</li><br />
<li><a data-scroll href="#result1"><em>G. xylinus</em></a><br />
</li><br />
<li><a data-scroll href="#result2"><em>E. coli</em></a><br />
</li><br />
<li><a data-scroll href="#result3">Co-Culture</a><br />
</li><br />
<li><a data-scroll href="#result4">Functionalisation</a><br />
</li><br />
<li><a data-scroll href="#result5">Mechanical Testing</a><br />
</li><br />
<li><a data-scroll href="#result6">Water Filtration</a><br />
</li><br />
<li><a data-scroll href="#result7">Water Report</a><br />
</li><br />
<li><a data-scroll href="#result7">i in iGEM</a><br />
</li><br />
<br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<br />
<section id="overview"><br />
<h2>Overview</h2><br />
<ul><br />
<br />
<li>Assembled and demonstrated a functional cellulose-producing system in Escherichia coli based on the high producing Acs operon</li><br />
<br />
<li>Sequenced the previously unknown genomes of <em>G. xylinus</em> ATCC 53582 and <em>G. xylinus</em> igem strains - the first genomes sequenced in the history of iGEM </li><br />
<br />
<li>Developed a set of new and improved protocols for synthetic biology in <em>G. xylinus</em></li><br />
<br />
<li>Developed a novel co-culture system for production of functionalised bacterial cellulose</li><br />
<br />
<li>Characterised three new cellulose binding domains for the registry and used them to functionalise bacterial cellulose with proteins of interest</li><br />
<br />
<li>Thoroughly characterised the properties of our manufactured biomaterial</li><br />
<br />
<li>Manufactured and tested ultrafiltration filters from bacterial cellulose</li><br />
<br />
<li>Demonstrated novel funtionalisation of cellulose filters with fusion proteins to improve binding of particular contaminants</li><br />
<br />
</ul><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
</section><br />
<section id="result1"><br />
<h2><em><a href="https://2014.igem.org/Team:Imperial/Gluconacetobacter">G.xylinus</a></em></h2><br />
<h3>Overview</h3><br />
<p>Bacterial cellulose has great potential in many areas, including water purification, tissue scaffolds, wound dressings, etc., however, until now, all bacterial cellulose-based materials have been created using chemical or physical post-production processing, not genetic engineering. This is due to the lack of well-developed tools and methods for Gluconacetobacter genetic engineering, as well as the lack of genome sequence of the highest cellulose-producing strain ATCC 53582. We have overcome the numerous difficulties associated with G.xylinus genetic engineering, and turned G.xylinus KI and ATCC 53852 strains into new platforms for the production of cellulose-based biomaterials by sequencing the genomes of ATCC 53582 and KI, creating a genetic toolbox of consisting of five new plasmid backbones and around 40 widely used genes, and developing a set of new and improved protocols for G.xylinus genetic engineering.</p><br />
<h3>Key Achievements</h3><br />
<ul><br />
<li>Isolated a new strain of <em>Gluconacetobacter</em> (named <em>G. xylinus</em> igem) from Kombucha tea and characterized its properties fully.</li><br />
<li>Sequenced the previously unknown genomes of <em>G. xylinus</em> ATCC 53582 and <em>G. xylinus</em> igem strains - the first genomes sequenced in the history of iGEM </li><br />
<li>Discovered four new plasmids capable of replication in <em>Gluconacetobacter</em> species - pSEVA321, pSEVA331, pSEVA351 and pBAV1K, which replicate both in <em>G. xylinus</em> ATCC 53582 and igem strains as well as in <em>E. coli</em></li><br />
<li>Were the first in science to create transgenic cells of <em>G.xylinus</em> igem strain </li><br />
<li>Using our discovered plasmids, created a genetic toolbox consisting of 40 genes for <em>G. xylinus</em> engineering and expressed them in the ATCC 53582 and igem</li> <br />
<br />
<li>Developed a set of new and improved protocols for efficient genetic engineering of <em>G. xylinus</em></li><br />
<li>In summary, turned <em>G. xylinus</em> ATCC 53582 and igem strains into new model organisms and developed the necessary tools to create a powerful platform for the synthesis of new cellulose-based biomaterials and water filters</li><br />
<br />
<br />
<br />
<br />
<br />
</ul><br />
<br />
</section><br />
<section id="result2"><br />
<h2><em><a href="https://2014.igem.org/Team:Imperial/EColi">E.coli</a></em></h2><br />
<h3>Overview</h3><br />
<p><em>Escherichia coli</em> is the organism of choice for synthetic biology. It is thoroughly characterised, easy to engineer and has numerous parts, control circuits and complex constructs tested in this host.</p><br />
<p>Some <em>E. coli</em> strains have evolved to produce low amounts of cellulose but the machinery under specific regulatory control (its secretion is generally linked to biofilm formation and stress situations). In order to expand the use of bacterial cellulose as a functional biomaterial that is cost effective to produce, it is desirable for its production machinery to be implemented in an organisms that is easy to engineer and has proven success in large scale bioreactors.</p><br />
<p>Here, we confirm that the high output cellulose production machinery of <em>Gluconacetobacter Xylinus</em> can be transferred into other organisms. We have proven function of the Acs cellulose producing operon in <em>Escherichia coli</em> using Congo Red binding assays.<br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Contributed an optimised Asc cellulose production operon to Registry of Standard Parts.</li><br />
<li>Proved the portability of <em>Gluconacetobacter xylinus</em> operon.</li><br />
<li>Assembled a fully synthetic, functional, cellulose-producing system in <em>Escherichia coli</em></li><br />
<li>Demonstrated the synthesis operon in a two plasmid system for separate induction of genes</li><br />
<br />
<br />
</ul><br />
<br />
</section><br />
<section id="result3"><br />
<h2><a href="https://2014.igem.org/Team:Imperial/coculture">RFP Co-Culture</a></h2><br />
<h3>Overview</h3><br />
<p>Based on the hypothesis of <em>E. coli</em> BL21D3 operating anaerobically and <em>G. xylinus</em> replicating aerobically, a co-culture experiment for bacterial cellulose was attempted. Initially, the best possible carbon source among 5 available was found experimentally. This data was used to inform the choice of glycerol and glucose as the carbon feedstock. With these carbon feedstocks, <em>E. coli</em> with RFP expressed were successfully embedded in the bacterial cellulose, and RFP was clearly visible. </p><br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Experimentally determined the optimum carbon feedstocks for a HS media based co-culture of <em>E. coli</em> and <em>G. xylinus</em>. </li><br />
</ul><br />
<br />
</section><br />
<section id="result4"><br />
<h2><a href="https://2014.igem.org/Team:Imperial/Functionalisation">Functionalisation</a></h2><br />
<h3>Overview</h3><br />
<p>Attaching functional proteins to cellulose can expand the properties of cellulose and allow us to selectivity capture specific contaminants in water. By creating fusion proteins of sfGFP and metal-binding proteins with five different cellulose binding domains, three of which are new to the registry, we were able to characterise the relative affinities of the CBDs and show proof-of-concept removal of contaminants from water.</p><br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Added three new cellulose binding domains to the registry</li><br />
<li>Performed an assay with sfGFP-fusions to determine the strongest potential binders which could be carried forward for further testing</li><br />
<li>Identified potential metal binding proteins to bind heavy metals from wastewater, including the addition of a new promising polypeptide phytochelatin EC20</li><br />
<li>Tested metal ion capture ability of the CBD-phytochelatin fusion constructs when attached to cellulose</li><br />
<br />
</ul><br />
<br />
</section><br />
<section id="result5"><br />
<h2><a href="https://2014.igem.org/Team:Imperial/Mechanical_Testing">Mechanical Testing</a></h2><br />
<h3>Overview</h3><br />
<p>To check the feasibility of using our bacterial cellulose as a customisable ultrafiltration membrane, the mechanical properties were tested. For this to work, we checked the tensile strength of our filter, calculated the shear stress and estimated the processing method that produces membrane with the longest life-time. Our ultimate tensile stress calculated matched with literature values of bacterial cellulose within standard deviation, and the data analysis provided the insight to use non-blended cellulose rather than blended..</p><br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Introduced a new aspect to the manufacturing track in terms of quantitatively characterising the mechanical properties of our product, bacterial cellulose<br />
</li><br />
<li>Quantified the tensile stress-strain properties of our bacterial cellulose.<br />
</li><br />
<li>Discovered that our bacterial cellulose can sustain an order of magnitude higher water pressures than those typically used for ultrafiltration membranes.<br />
</li><br />
<li>Established that non-blended compared to blended bacterial cellulose was significantly more ductile, and would have longer life time as a water filter, which informed the choice of cellulose for the final product.<br />
</li><br />
<li>Tested and analysed 20 samples of bacterial cellulose test pieces.<br />
</li><br />
<li>Created a size and quality optimised gif for visualisation of the experiment and written a protocol for future iGEM teams to do the same.<br />
</li><br />
<br />
<br />
<br />
</ul><br />
</section><br />
<br />
<section id="result6"><br />
<h2>Water filtration</h2><br />
<h3>Overview</h3><br />
<p>By attaching functional proteins to cellulose we can expand it's properties and selectivity capture specific contaminants in water. We used five different cellulose binding domains and fused them to different metal binding proteins, and sfGFP. We performed assays to test the binding of the CBD fusions to our cellulose.</p><br />
</div><br />
<div class="pure-u-1-1"><br />
<h3>Key Achievements </h3><br />
<ul><br />
<li> Synthesized and characterised cellulose binding domains (CBD) and their phytochelatin fusions. </li><br />
<li>Proved that cellulose can be functionalised with CBD-phytochelatins.</li> <br />
<li>Showed that bacterial cellulose in itself can successfully filter metal out of solution.</li><br />
<li>Successfully demonstrated filtration of turbid water. </li><br />
<li>Captured Nickel ions on our customisable cellulose filter. </li><br />
<li>Functionalised our homegrown bacterial cellulose with our fusion proteins. </li><br />
</ul><br />
<br />
<section id="result6"><br />
<h2>Water Report</h2><br />
<h3>At a glance</h3><br />
<ul><br />
<br />
<li>Growing population, development and urbanisation make water shortages increasingly severe</li><br />
<li>Beyond public health implications, water shortages cause conflict and social issues throughout the world</li><br />
<li>Decentralisation of water treatment systems is necessary to increase resilience and adapt to changing demand</li><br />
<li>Wastewater recycling is increasingly essential but has technical and social hurdles to overcome</li><br />
<li>Innovative solutions for cost effective, decentralised water recycling are desperately needed</li><br />
</ul><br />
<br />
<br />
<br />
<br />
</section><br />
<br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>HChughtaihttp://2014.igem.org/Team:Imperial/ResultsTeam:Imperial/Results2014-10-18T03:46:57Z<p>HChughtai: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Results</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#overview">Overview</a><br />
</li><br />
<li><a data-scroll href="#result1"><em>G. xylinus</em></a><br />
</li><br />
<li><a data-scroll href="#result2"><em>E.coli</em></a><br />
</li><br />
<li><a data-scroll href="#result3">Co-Culture</a><br />
</li><br />
<li><a data-scroll href="#result4">Functionalisation</a><br />
</li><br />
<li><a data-scroll href="#result5">Mechanical Testing</a><br />
</li><br />
<li><a data-scroll href="#result6">Water Filtration</a><br />
</li><br />
<li><a data-scroll href="#result7">Water Report</a><br />
</li><br />
<li><a data-scroll href="#result7">i in iGEM</a><br />
</li><br />
<br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<br />
<section id="overview"><br />
<h2>Overview</h2><br />
<ul><br />
<br />
<li>Assembled and demonstrated a functional cellulose-producing system in Escherichia coli based on the high producing Acs operon</li><br />
<br />
<li>Sequenced the previously unknown genomes of <em>G. xylinus</em> ATCC 53582 and <em>G. xylinus</em> igem strains - the first genomes sequenced in the history of iGEM </li><br />
<br />
<li>Developed a set of new and improved protocols for synthetic biology in <em>G. xylinus</em></li><br />
<br />
<li>Developed a novel co-culture system for production of functionalised bacterial cellulose</li><br />
<br />
<li>Characterised three new cellulose binding domains for the registry and used them to functionalise bacterial cellulose with proteins of interest</li><br />
<br />
<li>Thoroughly characterised the properties of our manufactured biomaterial</li><br />
<br />
<li>Manufactured and tested ultrafiltration filters from bacterial cellulose</li><br />
<br />
<li>Demonstrated novel funtionalisation of cellulose filters with fusion proteins to improve binding of particular contaminants</li><br />
<br />
</ul><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
</section><br />
<section id="result1"><br />
<h2><em><a href="https://2014.igem.org/Team:Imperial/Gluconacetobacter">G.xylinus</a></em></h2><br />
<h3>Overview</h3><br />
<p>Bacterial cellulose has great potential in many areas, including water purification, tissue scaffolds, wound dressings, etc., however, until now, all bacterial cellulose-based materials have been created using chemical or physical post-production processing, not genetic engineering. This is due to the lack of well-developed tools and methods for Gluconacetobacter genetic engineering, as well as the lack of genome sequence of the highest cellulose-producing strain ATCC 53582. We have overcome the numerous difficulties associated with G.xylinus genetic engineering, and turned G.xylinus KI and ATCC 53852 strains into new platforms for the production of cellulose-based biomaterials by sequencing the genomes of ATCC 53582 and KI, creating a genetic toolbox of consisting of five new plasmid backbones and around 40 widely used genes, and developing a set of new and improved protocols for G.xylinus genetic engineering.</p><br />
<h3>Key Achievements</h3><br />
<ul><br />
<li>Isolated a new strain of <em>Gluconacetobacter</em> (named <em>G. xylinus</em> igem) from Kombucha tea and characterized its properties fully.</li><br />
<li>Sequenced the previously unknown genomes of <em>G. xylinus</em> ATCC 53582 and <em>G. xylinus</em> igem strains - the first genomes sequenced in the history of iGEM </li><br />
<li>Discovered four new plasmids capable of replication in <em>Gluconacetobacter</em> species - pSEVA321, pSEVA331, pSEVA351 and pBAV1K, which replicate both in <em>G. xylinus</em> ATCC 53582 and igem strains as well as in <em>E. coli</em></li><br />
<li>Were the first in science to create transgenic cells of <em>G.xylinus</em> igem strain </li><br />
<li>Using our discovered plasmids, created a genetic toolbox consisting of 40 genes for <em>G. xylinus</em> engineering and expressed them in the ATCC 53582 and igem</li> <br />
<br />
<li>Developed a set of new and improved protocols for efficient genetic engineering of <em>G. xylinus</em></li><br />
<li>In summary, turned <em>G. xylinus</em> ATCC 53582 and igem strains into new model organisms and developed the necessary tools to create a powerful platform for the synthesis of new cellulose-based biomaterials and water filters</li><br />
<br />
<br />
<br />
<br />
<br />
</ul><br />
<br />
</section><br />
<section id="result2"><br />
<h2><em><a href="https://2014.igem.org/Team:Imperial/EColi">E.coli</a></em></h2><br />
<h3>Overview</h3><br />
<p><em>Escherichia coli</em> is the organism of choice for synthetic biology. It is thoroughly characterised, easy to engineer and has numerous parts, control circuits and complex constructs tested in this host.</p><br />
<p>Some <em>E. coli</em> strains have evolved to produce low amounts of cellulose but the machinery under specific regulatory control (its secretion is generally linked to biofilm formation and stress situations). In order to expand the use of bacterial cellulose as a functional biomaterial that is cost effective to produce, it is desirable for its production machinery to be implemented in an organisms that is easy to engineer and has proven success in large scale bioreactors.</p><br />
<p>Here, we confirm that the high output cellulose production machinery of <em>Gluconacetobacter Xylinus</em> can be transferred into other organisms. We have proven function of the Acs cellulose producing operon in <em>Escherichia coli</em> using Congo Red binding assays.<br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Contributed an optimised Asc cellulose production operon to Registry of Standard Parts.</li><br />
<li>Proved the portability of <em>Gluconacetobacter xylinus</em> operon.</li><br />
<li>Assembled a fully synthetic, functional, cellulose-producing system in <em>Escherichia coli</em></li><br />
<li>Demonstrated the synthesis operon in a two plasmid system for separate induction of genes</li><br />
<br />
<br />
</ul><br />
<br />
</section><br />
<section id="result3"><br />
<h2><a href="https://2014.igem.org/Team:Imperial/coculture">RFP Co-Culture</a></h2><br />
<h3>Overview</h3><br />
<p>Based on the hypothesis of <em>E. coli</em> BL21D3 operating anaerobically and <em>G. xylinus</em> replicating aerobically, a co-culture experiment for bacterial cellulose was attempted. Initially, the best possible carbon source among 5 available was found experimentally. This data was used to inform the choice of glycerol and glucose as the carbon feedstock. With these carbon feedstocks, <em>E. coli</em> with RFP expressed were successfully embedded in the bacterial cellulose, and RFP was clearly visible. </p><br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Experimentally determined the optimum carbon feedstocks for a HS media based co-culture of <em>E. coli</em> and <em>G. xylinus</em>. </li><br />
</ul><br />
<br />
</section><br />
<section id="result4"><br />
<h2><a href="https://2014.igem.org/Team:Imperial/Functionalisation">Functionalisation</a></h2><br />
<h3>Overview</h3><br />
<p>Attaching functional proteins to cellulose can expand the properties of cellulose and allow us to selectivity capture specific contaminants in water. By creating fusion proteins of sfGFP and metal-binding proteins with five different cellulose binding domains, three of which are new to the registry, we were able to characterise the relative affinities of the CBDs and show proof-of-concept removal of contaminants from water.</p><br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Added three new cellulose binding domains to the registry</li><br />
<li>Performed an assay with sfGFP-fusions to determine the strongest potential binders which could be carried forward for further testing</li><br />
<li>Identified potential metal binding proteins to bind heavy metals from wastewater, including the addition of a new promising polypeptide phytochelatin EC20</li><br />
<li>Tested metal ion capture ability of the CBD-phytochelatin fusion constructs when attached to cellulose</li><br />
<br />
</ul><br />
<br />
</section><br />
<section id="result5"><br />
<h2><a href="https://2014.igem.org/Team:Imperial/Mechanical_Testing">Mechanical Testing</a></h2><br />
<h3>Overview</h3><br />
<p>To check the feasibility of using our bacterial cellulose as a customisable ultrafiltration membrane, the mechanical properties were tested. For this to work, we checked the tensile strength of our filter, calculated the shear stress and estimated the processing method that produces membrane with the longest life-time. Our ultimate tensile stress calculated matched with literature values of bacterial cellulose within standard deviation, and the data analysis provided the insight to use non-blended cellulose rather than blended..</p><br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Introduced a new aspect to the manufacturing track in terms of quantitatively characterising the mechanical properties of our product, bacterial cellulose<br />
</li><br />
<li>Quantified the tensile stress-strain properties of our bacterial cellulose.<br />
</li><br />
<li>Discovered that our bacterial cellulose can sustain an order of magnitude higher water pressures than those typically used for ultrafiltration membranes.<br />
</li><br />
<li>Established that non-blended compared to blended bacterial cellulose was significantly more ductile, and would have longer life time as a water filter, which informed the choice of cellulose for the final product.<br />
</li><br />
<li>Tested and analysed 20 samples of bacterial cellulose test pieces.<br />
</li><br />
<li>Created a size and quality optimised gif for visualisation of the experiment and written a protocol for future iGEM teams to do the same.<br />
</li><br />
<br />
<br />
<br />
</ul><br />
</section><br />
<br />
<section id="result6"><br />
<h2>Water filtration</h2><br />
<h3>Overview</h3><br />
<p>By attaching functional proteins to cellulose we can expand it's properties and selectivity capture specific contaminants in water. We used five different cellulose binding domains and fused them to different metal binding proteins, and sfGFP. We performed assays to test the binding of the CBD fusions to our cellulose.</p><br />
</div><br />
<div class="pure-u-1-1"><br />
<h3>Key Achievements </h3><br />
<ul><br />
<li> Synthesized and characterised cellulose binding domains (CBD) and their phytochelatin fusions. </li><br />
<li>Proved that cellulose can be functionalised with CBD-phytochelatins.</li> <br />
<li>Showed that bacterial cellulose in itself can successfully filter metal out of solution.</li><br />
<li>Successfully demonstrated filtration of turbid water. </li><br />
<li>Captured Nickel ions on our customisable cellulose filter. </li><br />
<li>Functionalised our homegrown bacterial cellulose with our fusion proteins. </li><br />
</ul><br />
<br />
<section id="result6"><br />
<h2>Water Report</h2><br />
<h3>At a glance</h3><br />
<ul><br />
<br />
<li>Growing population, development and urbanisation make water shortages increasingly severe</li><br />
<li>Beyond public health implications, water shortages cause conflict and social issues throughout the world</li><br />
<li>Decentralisation of water treatment systems is necessary to increase resilience and adapt to changing demand</li><br />
<li>Wastewater recycling is increasingly essential but has technical and social hurdles to overcome</li><br />
<li>Innovative solutions for cost effective, decentralised water recycling are desperately needed</li><br />
</ul><br />
<br />
<br />
<br />
<br />
</section><br />
<br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>HChughtaihttp://2014.igem.org/Team:Imperial/ResultsTeam:Imperial/Results2014-10-18T03:46:43Z<p>HChughtai: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Results</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#overview">Overview</a><br />
</li><br />
<li><a data-scroll href="#result1"><em>G. xylinus</em></a><br />
</li><br />
<li><a data-scroll href="#result2"><em>E.coli</em></a><br />
</li><br />
<li><a data-scroll href="#result3">Co-Culture</a><br />
</li><br />
<li><a data-scroll href="#result4">Functionalisation</a><br />
</li><br />
<li><a data-scroll href="#result5">Mechanical Testing</a><br />
</li><br />
<li><a data-scroll href="#result6">Water Filtration</a><br />
</li><br />
<li><a data-scroll href="#result7">Water Report</a><br />
</li><br />
<li><a data-scroll href="#result7">i in iGEM</a><br />
</li><br />
<br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<br><br />
<br><br />
<section id="overview"><br />
<h2>Overview</h2><br />
<ul><br />
<br />
<li>Assembled and demonstrated a functional cellulose-producing system in Escherichia coli based on the high producing Acs operon</li><br />
<br />
<li>Sequenced the previously unknown genomes of <em>G. xylinus</em> ATCC 53582 and <em>G. xylinus</em> igem strains - the first genomes sequenced in the history of iGEM </li><br />
<br />
<li>Developed a set of new and improved protocols for synthetic biology in <em>G. xylinus</em></li><br />
<br />
<li>Developed a novel co-culture system for production of functionalised bacterial cellulose</li><br />
<br />
<li>Characterised three new cellulose binding domains for the registry and used them to functionalise bacterial cellulose with proteins of interest</li><br />
<br />
<li>Thoroughly characterised the properties of our manufactured biomaterial</li><br />
<br />
<li>Manufactured and tested ultrafiltration filters from bacterial cellulose</li><br />
<br />
<li>Demonstrated novel funtionalisation of cellulose filters with fusion proteins to improve binding of particular contaminants</li><br />
<br />
</ul><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
</section><br />
<section id="result1"><br />
<h2><em><a href="https://2014.igem.org/Team:Imperial/Gluconacetobacter">G.xylinus</a></em></h2><br />
<h3>Overview</h3><br />
<p>Bacterial cellulose has great potential in many areas, including water purification, tissue scaffolds, wound dressings, etc., however, until now, all bacterial cellulose-based materials have been created using chemical or physical post-production processing, not genetic engineering. This is due to the lack of well-developed tools and methods for Gluconacetobacter genetic engineering, as well as the lack of genome sequence of the highest cellulose-producing strain ATCC 53582. We have overcome the numerous difficulties associated with G.xylinus genetic engineering, and turned G.xylinus KI and ATCC 53852 strains into new platforms for the production of cellulose-based biomaterials by sequencing the genomes of ATCC 53582 and KI, creating a genetic toolbox of consisting of five new plasmid backbones and around 40 widely used genes, and developing a set of new and improved protocols for G.xylinus genetic engineering.</p><br />
<h3>Key Achievements</h3><br />
<ul><br />
<li>Isolated a new strain of <em>Gluconacetobacter</em> (named <em>G. xylinus</em> igem) from Kombucha tea and characterized its properties fully.</li><br />
<li>Sequenced the previously unknown genomes of <em>G. xylinus</em> ATCC 53582 and <em>G. xylinus</em> igem strains - the first genomes sequenced in the history of iGEM </li><br />
<li>Discovered four new plasmids capable of replication in <em>Gluconacetobacter</em> species - pSEVA321, pSEVA331, pSEVA351 and pBAV1K, which replicate both in <em>G. xylinus</em> ATCC 53582 and igem strains as well as in <em>E. coli</em></li><br />
<li>Were the first in science to create transgenic cells of <em>G.xylinus</em> igem strain </li><br />
<li>Using our discovered plasmids, created a genetic toolbox consisting of 40 genes for <em>G. xylinus</em> engineering and expressed them in the ATCC 53582 and igem</li> <br />
<br />
<li>Developed a set of new and improved protocols for efficient genetic engineering of <em>G. xylinus</em></li><br />
<li>In summary, turned <em>G. xylinus</em> ATCC 53582 and igem strains into new model organisms and developed the necessary tools to create a powerful platform for the synthesis of new cellulose-based biomaterials and water filters</li><br />
<br />
<br />
<br />
<br />
<br />
</ul><br />
<br />
</section><br />
<section id="result2"><br />
<h2><em><a href="https://2014.igem.org/Team:Imperial/EColi">E.coli</a></em></h2><br />
<h3>Overview</h3><br />
<p><em>Escherichia coli</em> is the organism of choice for synthetic biology. It is thoroughly characterised, easy to engineer and has numerous parts, control circuits and complex constructs tested in this host.</p><br />
<p>Some <em>E. coli</em> strains have evolved to produce low amounts of cellulose but the machinery under specific regulatory control (its secretion is generally linked to biofilm formation and stress situations). In order to expand the use of bacterial cellulose as a functional biomaterial that is cost effective to produce, it is desirable for its production machinery to be implemented in an organisms that is easy to engineer and has proven success in large scale bioreactors.</p><br />
<p>Here, we confirm that the high output cellulose production machinery of <em>Gluconacetobacter Xylinus</em> can be transferred into other organisms. We have proven function of the Acs cellulose producing operon in <em>Escherichia coli</em> using Congo Red binding assays.<br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Contributed an optimised Asc cellulose production operon to Registry of Standard Parts.</li><br />
<li>Proved the portability of <em>Gluconacetobacter xylinus</em> operon.</li><br />
<li>Assembled a fully synthetic, functional, cellulose-producing system in <em>Escherichia coli</em></li><br />
<li>Demonstrated the synthesis operon in a two plasmid system for separate induction of genes</li><br />
<br />
<br />
</ul><br />
<br />
</section><br />
<section id="result3"><br />
<h2><a href="https://2014.igem.org/Team:Imperial/coculture">RFP Co-Culture</a></h2><br />
<h3>Overview</h3><br />
<p>Based on the hypothesis of <em>E. coli</em> BL21D3 operating anaerobically and <em>G. xylinus</em> replicating aerobically, a co-culture experiment for bacterial cellulose was attempted. Initially, the best possible carbon source among 5 available was found experimentally. This data was used to inform the choice of glycerol and glucose as the carbon feedstock. With these carbon feedstocks, <em>E. coli</em> with RFP expressed were successfully embedded in the bacterial cellulose, and RFP was clearly visible. </p><br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Experimentally determined the optimum carbon feedstocks for a HS media based co-culture of <em>E. coli</em> and <em>G. xylinus</em>. </li><br />
</ul><br />
<br />
</section><br />
<section id="result4"><br />
<h2><a href="https://2014.igem.org/Team:Imperial/Functionalisation">Functionalisation</a></h2><br />
<h3>Overview</h3><br />
<p>Attaching functional proteins to cellulose can expand the properties of cellulose and allow us to selectivity capture specific contaminants in water. By creating fusion proteins of sfGFP and metal-binding proteins with five different cellulose binding domains, three of which are new to the registry, we were able to characterise the relative affinities of the CBDs and show proof-of-concept removal of contaminants from water.</p><br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Added three new cellulose binding domains to the registry</li><br />
<li>Performed an assay with sfGFP-fusions to determine the strongest potential binders which could be carried forward for further testing</li><br />
<li>Identified potential metal binding proteins to bind heavy metals from wastewater, including the addition of a new promising polypeptide phytochelatin EC20</li><br />
<li>Tested metal ion capture ability of the CBD-phytochelatin fusion constructs when attached to cellulose</li><br />
<br />
</ul><br />
<br />
</section><br />
<section id="result5"><br />
<h2><a href="https://2014.igem.org/Team:Imperial/Mechanical_Testing">Mechanical Testing</a></h2><br />
<h3>Overview</h3><br />
<p>To check the feasibility of using our bacterial cellulose as a customisable ultrafiltration membrane, the mechanical properties were tested. For this to work, we checked the tensile strength of our filter, calculated the shear stress and estimated the processing method that produces membrane with the longest life-time. Our ultimate tensile stress calculated matched with literature values of bacterial cellulose within standard deviation, and the data analysis provided the insight to use non-blended cellulose rather than blended..</p><br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Introduced a new aspect to the manufacturing track in terms of quantitatively characterising the mechanical properties of our product, bacterial cellulose<br />
</li><br />
<li>Quantified the tensile stress-strain properties of our bacterial cellulose.<br />
</li><br />
<li>Discovered that our bacterial cellulose can sustain an order of magnitude higher water pressures than those typically used for ultrafiltration membranes.<br />
</li><br />
<li>Established that non-blended compared to blended bacterial cellulose was significantly more ductile, and would have longer life time as a water filter, which informed the choice of cellulose for the final product.<br />
</li><br />
<li>Tested and analysed 20 samples of bacterial cellulose test pieces.<br />
</li><br />
<li>Created a size and quality optimised gif for visualisation of the experiment and written a protocol for future iGEM teams to do the same.<br />
</li><br />
<br />
<br />
<br />
</ul><br />
</section><br />
<br />
<section id="result6"><br />
<h2>Water filtration</h2><br />
<h3>Overview</h3><br />
<p>By attaching functional proteins to cellulose we can expand it's properties and selectivity capture specific contaminants in water. We used five different cellulose binding domains and fused them to different metal binding proteins, and sfGFP. We performed assays to test the binding of the CBD fusions to our cellulose.</p><br />
</div><br />
<div class="pure-u-1-1"><br />
<h3>Key Achievements </h3><br />
<ul><br />
<li> Synthesized and characterised cellulose binding domains (CBD) and their phytochelatin fusions. </li><br />
<li>Proved that cellulose can be functionalised with CBD-phytochelatins.</li> <br />
<li>Showed that bacterial cellulose in itself can successfully filter metal out of solution.</li><br />
<li>Successfully demonstrated filtration of turbid water. </li><br />
<li>Captured Nickel ions on our customisable cellulose filter. </li><br />
<li>Functionalised our homegrown bacterial cellulose with our fusion proteins. </li><br />
</ul><br />
<br />
<section id="result6"><br />
<h2>Water Report</h2><br />
<h3>At a glance</h3><br />
<ul><br />
<br />
<li>Growing population, development and urbanisation make water shortages increasingly severe</li><br />
<li>Beyond public health implications, water shortages cause conflict and social issues throughout the world</li><br />
<li>Decentralisation of water treatment systems is necessary to increase resilience and adapt to changing demand</li><br />
<li>Wastewater recycling is increasingly essential but has technical and social hurdles to overcome</li><br />
<li>Innovative solutions for cost effective, decentralised water recycling are desperately needed</li><br />
</ul><br />
<br />
<br />
<br />
<br />
</section><br />
<br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>HChughtaihttp://2014.igem.org/Team:Imperial/ResultsTeam:Imperial/Results2014-10-18T03:46:16Z<p>HChughtai: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Results</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#overview">Overview</a><br />
</li><br />
<li><a data-scroll href="#result1"><em>G. xylinus</em></a><br />
</li><br />
<li><a data-scroll href="#result2"><em>E.coli</em></a><br />
</li><br />
<li><a data-scroll href="#result3">Co-Culture</a><br />
</li><br />
<li><a data-scroll href="#result4">Functionalisation</a><br />
</li><br />
<li><a data-scroll href="#result5">Mechanical Testing</a><br />
</li><br />
<li><a data-scroll href="#result6">Water filtration</a><br />
</li><br />
<li><a data-scroll href="#result7">Water Report</a><br />
</li><br />
<li><a data-scroll href="#result7">The i in iGEM</a><br />
</li><br />
<br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<br><br />
<br><br />
<section id="overview"><br />
<h2>Overview</h2><br />
<ul><br />
<br />
<li>Assembled and demonstrated a functional cellulose-producing system in Escherichia coli based on the high producing Acs operon</li><br />
<br />
<li>Sequenced the previously unknown genomes of <em>G. xylinus</em> ATCC 53582 and <em>G. xylinus</em> igem strains - the first genomes sequenced in the history of iGEM </li><br />
<br />
<li>Developed a set of new and improved protocols for synthetic biology in <em>G. xylinus</em></li><br />
<br />
<li>Developed a novel co-culture system for production of functionalised bacterial cellulose</li><br />
<br />
<li>Characterised three new cellulose binding domains for the registry and used them to functionalise bacterial cellulose with proteins of interest</li><br />
<br />
<li>Thoroughly characterised the properties of our manufactured biomaterial</li><br />
<br />
<li>Manufactured and tested ultrafiltration filters from bacterial cellulose</li><br />
<br />
<li>Demonstrated novel funtionalisation of cellulose filters with fusion proteins to improve binding of particular contaminants</li><br />
<br />
</ul><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
</section><br />
<section id="result1"><br />
<h2><em><a href="https://2014.igem.org/Team:Imperial/Gluconacetobacter">G.xylinus</a></em></h2><br />
<h3>Overview</h3><br />
<p>Bacterial cellulose has great potential in many areas, including water purification, tissue scaffolds, wound dressings, etc., however, until now, all bacterial cellulose-based materials have been created using chemical or physical post-production processing, not genetic engineering. This is due to the lack of well-developed tools and methods for Gluconacetobacter genetic engineering, as well as the lack of genome sequence of the highest cellulose-producing strain ATCC 53582. We have overcome the numerous difficulties associated with G.xylinus genetic engineering, and turned G.xylinus KI and ATCC 53852 strains into new platforms for the production of cellulose-based biomaterials by sequencing the genomes of ATCC 53582 and KI, creating a genetic toolbox of consisting of five new plasmid backbones and around 40 widely used genes, and developing a set of new and improved protocols for G.xylinus genetic engineering.</p><br />
<h3>Key Achievements</h3><br />
<ul><br />
<li>Isolated a new strain of <em>Gluconacetobacter</em> (named <em>G. xylinus</em> igem) from Kombucha tea and characterized its properties fully.</li><br />
<li>Sequenced the previously unknown genomes of <em>G. xylinus</em> ATCC 53582 and <em>G. xylinus</em> igem strains - the first genomes sequenced in the history of iGEM </li><br />
<li>Discovered four new plasmids capable of replication in <em>Gluconacetobacter</em> species - pSEVA321, pSEVA331, pSEVA351 and pBAV1K, which replicate both in <em>G. xylinus</em> ATCC 53582 and igem strains as well as in <em>E. coli</em></li><br />
<li>Were the first in science to create transgenic cells of <em>G.xylinus</em> igem strain </li><br />
<li>Using our discovered plasmids, created a genetic toolbox consisting of 40 genes for <em>G. xylinus</em> engineering and expressed them in the ATCC 53582 and igem</li> <br />
<br />
<li>Developed a set of new and improved protocols for efficient genetic engineering of <em>G. xylinus</em></li><br />
<li>In summary, turned <em>G. xylinus</em> ATCC 53582 and igem strains into new model organisms and developed the necessary tools to create a powerful platform for the synthesis of new cellulose-based biomaterials and water filters</li><br />
<br />
<br />
<br />
<br />
<br />
</ul><br />
<br />
</section><br />
<section id="result2"><br />
<h2><em><a href="https://2014.igem.org/Team:Imperial/EColi">E.coli</a></em></h2><br />
<h3>Overview</h3><br />
<p><em>Escherichia coli</em> is the organism of choice for synthetic biology. It is thoroughly characterised, easy to engineer and has numerous parts, control circuits and complex constructs tested in this host.</p><br />
<p>Some <em>E. coli</em> strains have evolved to produce low amounts of cellulose but the machinery under specific regulatory control (its secretion is generally linked to biofilm formation and stress situations). In order to expand the use of bacterial cellulose as a functional biomaterial that is cost effective to produce, it is desirable for its production machinery to be implemented in an organisms that is easy to engineer and has proven success in large scale bioreactors.</p><br />
<p>Here, we confirm that the high output cellulose production machinery of <em>Gluconacetobacter Xylinus</em> can be transferred into other organisms. We have proven function of the Acs cellulose producing operon in <em>Escherichia coli</em> using Congo Red binding assays.<br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Contributed an optimised Asc cellulose production operon to Registry of Standard Parts.</li><br />
<li>Proved the portability of <em>Gluconacetobacter xylinus</em> operon.</li><br />
<li>Assembled a fully synthetic, functional, cellulose-producing system in <em>Escherichia coli</em></li><br />
<li>Demonstrated the synthesis operon in a two plasmid system for separate induction of genes</li><br />
<br />
<br />
</ul><br />
<br />
</section><br />
<section id="result3"><br />
<h2><a href="https://2014.igem.org/Team:Imperial/coculture">RFP Co-Culture</a></h2><br />
<h3>Overview</h3><br />
<p>Based on the hypothesis of <em>E. coli</em> BL21D3 operating anaerobically and <em>G. xylinus</em> replicating aerobically, a co-culture experiment for bacterial cellulose was attempted. Initially, the best possible carbon source among 5 available was found experimentally. This data was used to inform the choice of glycerol and glucose as the carbon feedstock. With these carbon feedstocks, <em>E. coli</em> with RFP expressed were successfully embedded in the bacterial cellulose, and RFP was clearly visible. </p><br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Experimentally determined the optimum carbon feedstocks for a HS media based co-culture of <em>E. coli</em> and <em>G. xylinus</em>. </li><br />
</ul><br />
<br />
</section><br />
<section id="result4"><br />
<h2><a href="https://2014.igem.org/Team:Imperial/Functionalisation">Functionalisation</a></h2><br />
<h3>Overview</h3><br />
<p>Attaching functional proteins to cellulose can expand the properties of cellulose and allow us to selectivity capture specific contaminants in water. By creating fusion proteins of sfGFP and metal-binding proteins with five different cellulose binding domains, three of which are new to the registry, we were able to characterise the relative affinities of the CBDs and show proof-of-concept removal of contaminants from water.</p><br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Added three new cellulose binding domains to the registry</li><br />
<li>Performed an assay with sfGFP-fusions to determine the strongest potential binders which could be carried forward for further testing</li><br />
<li>Identified potential metal binding proteins to bind heavy metals from wastewater, including the addition of a new promising polypeptide phytochelatin EC20</li><br />
<li>Tested metal ion capture ability of the CBD-phytochelatin fusion constructs when attached to cellulose</li><br />
<br />
</ul><br />
<br />
</section><br />
<section id="result5"><br />
<h2><a href="https://2014.igem.org/Team:Imperial/Mechanical_Testing">Mechanical Testing</a></h2><br />
<h3>Overview</h3><br />
<p>To check the feasibility of using our bacterial cellulose as a customisable ultrafiltration membrane, the mechanical properties were tested. For this to work, we checked the tensile strength of our filter, calculated the shear stress and estimated the processing method that produces membrane with the longest life-time. Our ultimate tensile stress calculated matched with literature values of bacterial cellulose within standard deviation, and the data analysis provided the insight to use non-blended cellulose rather than blended..</p><br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Introduced a new aspect to the manufacturing track in terms of quantitatively characterising the mechanical properties of our product, bacterial cellulose<br />
</li><br />
<li>Quantified the tensile stress-strain properties of our bacterial cellulose.<br />
</li><br />
<li>Discovered that our bacterial cellulose can sustain an order of magnitude higher water pressures than those typically used for ultrafiltration membranes.<br />
</li><br />
<li>Established that non-blended compared to blended bacterial cellulose was significantly more ductile, and would have longer life time as a water filter, which informed the choice of cellulose for the final product.<br />
</li><br />
<li>Tested and analysed 20 samples of bacterial cellulose test pieces.<br />
</li><br />
<li>Created a size and quality optimised gif for visualisation of the experiment and written a protocol for future iGEM teams to do the same.<br />
</li><br />
<br />
<br />
<br />
</ul><br />
</section><br />
<br />
<section id="result6"><br />
<h2>Water filtration</h2><br />
<h3>Overview</h3><br />
<p>By attaching functional proteins to cellulose we can expand it's properties and selectivity capture specific contaminants in water. We used five different cellulose binding domains and fused them to different metal binding proteins, and sfGFP. We performed assays to test the binding of the CBD fusions to our cellulose.</p><br />
</div><br />
<div class="pure-u-1-1"><br />
<h3>Key Achievements </h3><br />
<ul><br />
<li> Synthesized and characterised cellulose binding domains (CBD) and their phytochelatin fusions. </li><br />
<li>Proved that cellulose can be functionalised with CBD-phytochelatins.</li> <br />
<li>Showed that bacterial cellulose in itself can successfully filter metal out of solution.</li><br />
<li>Successfully demonstrated filtration of turbid water. </li><br />
<li>Captured Nickel ions on our customisable cellulose filter. </li><br />
<li>Functionalised our homegrown bacterial cellulose with our fusion proteins. </li><br />
</ul><br />
<br />
<section id="result6"><br />
<h2>Water Report</h2><br />
<h3>At a glance</h3><br />
<ul><br />
<br />
<li>Growing population, development and urbanisation make water shortages increasingly severe</li><br />
<li>Beyond public health implications, water shortages cause conflict and social issues throughout the world</li><br />
<li>Decentralisation of water treatment systems is necessary to increase resilience and adapt to changing demand</li><br />
<li>Wastewater recycling is increasingly essential but has technical and social hurdles to overcome</li><br />
<li>Innovative solutions for cost effective, decentralised water recycling are desperately needed</li><br />
</ul><br />
<br />
<br />
<br />
<br />
</section><br />
<br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>HChughtaihttp://2014.igem.org/Team:Imperial/ResultsTeam:Imperial/Results2014-10-18T03:45:40Z<p>HChughtai: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Results</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#overview">Overview</a><br />
</li><br />
<li><a data-scroll href="#result1"><em>G. xylinus</em></a><br />
</li><br />
<li><a data-scroll href="#result2"><em>E.coli</em></a><br />
</li><br />
<li><a data-scroll href="#result3">Co-Culture</a><br />
</li><br />
<li><a data-scroll href="#result4">Functionalisation</a><br />
</li><br />
<li><a data-scroll href="#result5">Mechanical Testing</a><br />
</li><br />
<li><a data-scroll href="#result6">Water filtration</a><br />
</li><br />
<li><a data-scroll href="#result7">Water Report</a><br />
</li><br />
<li><a data-scroll href="#result7">The i in iGEM</a><br />
</li><br />
<br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<br><br />
<br><br />
<section id="overview"><br />
<h2>Overview</h2><br />
<ul><br />
<br />
<li>Assembled and demonstrated a functional cellulose-producing system in Escherichia coli based on the high producing Acs operon</li><br />
<br />
<li>Sequenced the previously unknown genomes of <em>G. xylinus</em> ATCC 53582 and <em>G. xylinus</em> igem strains - the first genomes sequenced in the history of iGEM </li><br />
<br />
<li>Developed a set of new and improved protocols for synthetic biology in <em>G. xylinus</em></li><br />
<br />
<li>Developed a novel co-culture system for production of functionalised bacterial cellulose</li><br />
<br />
<li>Characterised three new cellulose binding domains for the registry and used them to functionalise bacterial cellulose with proteins of interest</li><br />
<br />
<li>Thoroughly characterised the properties of our manufactured biomaterial</li><br />
<br />
<li>Manufactured and tested ultrafiltration filters from bacterial cellulose</li><br />
<br />
<li>Demonstrated novel funtionalisation of cellulose filters with fusion proteins to improve binding of particular contaminants</li><br />
<br />
</ul><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
</section><br />
<section id="result1"><br />
<h2><em><a href="https://2014.igem.org/Team:Imperial/Gluconacetobacter">G.xylinus</a></em></h2><br />
<h3>Overview</h3><br />
<p>Bacterial cellulose has great potential in many areas, including water purification, tissue scaffolds, wound dressings, etc., however, until now, all bacterial cellulose-based materials have been created using chemical or physical post-production processing, not genetic engineering. This is due to the lack of well-developed tools and methods for Gluconacetobacter genetic engineering, as well as the lack of genome sequence of the highest cellulose-producing strain ATCC 53582. We have overcome the numerous difficulties associated with G.xylinus genetic engineering, and turned G.xylinus KI and ATCC 53852 strains into new platforms for the production of cellulose-based biomaterials by sequencing the genomes of ATCC 53582 and KI, creating a genetic toolbox of consisting of five new plasmid backbones and around 40 widely used genes, and developing a set of new and improved protocols for G.xylinus genetic engineering.</p><br />
<h3>Key Achievements</h3><br />
<ul><br />
<li>Isolated a new strain of <em>Gluconacetobacter</em> (named <em>G. xylinus</em> igem) from Kombucha tea and characterized its properties fully.</li><br />
<li>Sequenced the previously unknown genomes of <em>G. xylinus</em> ATCC 53582 and <em>G. xylinus</em> igem strains - the first genomes sequenced in the history of iGEM </li><br />
<li>Discovered four new plasmids capable of replication in <em>Gluconacetobacter</em> species - pSEVA321, pSEVA331, pSEVA351 and pBAV1K, which replicate both in <em>G. xylinus</em> ATCC 53582 and igem strains as well as in <em>E. coli</em></li><br />
<li>Were the first in science to create transgenic cells of <em>G.xylinus</em> igem strain </li><br />
<li>Using our discovered plasmids, created a genetic toolbox consisting of 40 genes for <em>G. xylinus</em> engineering and expressed them in the ATCC 53582 and igem</li> <br />
<br />
<li>Developed a set of new and improved protocols for efficient genetic engineering of <em>G. xylinus</em></li><br />
<li>In summary, turned <em>G. xylinus</em> ATCC 53582 and igem strains into new model organisms and developed the necessary tools to create a powerful platform for the synthesis of new cellulose-based biomaterials and water filters</li><br />
<br />
<br />
<br />
<br />
<br />
</ul><br />
<br />
</section><br />
<section id="result2"><br />
<h2><em><a href="https://2014.igem.org/Team:Imperial/EColi">E.coli</a></em></h2><br />
<h3>Overview</h3><br />
<p><em>Escherichia coli</em> is the organism of choice for synthetic biology. It is thoroughly characterised, easy to engineer and has numerous parts, control circuits and complex constructs tested in this host.</p><br />
<p>Some <em>E. coli</em> strains have evolved to produce low amounts of cellulose but the machinery under specific regulatory control (its secretion is generally linked to biofilm formation and stress situations). In order to expand the use of bacterial cellulose as a functional biomaterial that is cost effective to produce, it is desirable for its production machinery to be implemented in an organisms that is easy to engineer and has proven success in large scale bioreactors.</p><br />
<p>Here, we confirm that the high output cellulose production machinery of <em>Gluconacetobacter Xylinus</em> can be transferred into other organisms. We have proven function of the Acs cellulose producing operon in <em>Escherichia coli</em> using Congo Red binding assays.<br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Contributed an optimised Asc cellulose production operon to Registry of Standard Parts.</li><br />
<li>Proved the portability of <em>Gluconacetobacter xylinus</em> operon.</li><br />
<li>Assembled a fully synthetic, functional, cellulose-producing system in <em>Escherichia coli</em></li><br />
<li>Demonstrated the synthesis operon in a two plasmid system for separate induction of genes</li><br />
<br />
<br />
</ul><br />
<br />
</section><br />
<section id="result3"><br />
<h2><a href="https://2014.igem.org/Team:Imperial/coculture">RFP Co-Culture</a></h2><br />
<h3>Overview</h3><br />
<p>Based on the hypothesis of <em>E. coli</em> BL21D3 operating anaerobically and <em>G. xylinus</em> replicating aerobically, a co-culture experiment for bacterial cellulose was attempted. Initially, the best possible carbon source among 5 available was found experimentally. This data was used to inform the choice of glycerol and glucose as the carbon feedstock. With these carbon feedstocks, <em>E. coli</em> with RFP expressed were successfully embedded in the bacterial cellulose, and RFP was clearly visible. </p><br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Experimentally determined the optimum carbon feedstocks for a HS media based co-culture of <em>E. coli</em> and <em>G. xylinus</em>. </li><br />
</ul><br />
<br />
</section><br />
<section id="result4"><br />
<h2><a href="https://2014.igem.org/Team:Imperial/Functionalisation">Functionalisation</a></h2><br />
<h3>Overview</h3><br />
<p>Attaching functional proteins to cellulose can expand the properties of cellulose and allow us to selectivity capture specific contaminants in water. By creating fusion proteins of sfGFP and metal-binding proteins with five different cellulose binding domains, three of which are new to the registry, we were able to characterise the relative affinities of the CBDs and show proof-of-concept removal of contaminants from water.</p><br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Added three new cellulose binding domains to the registry</li><br />
<li>Performed an assay with sfGFP-fusions to determine the strongest potential binders which could be carried forward for further testing</li><br />
<li>Identified potential metal binding proteins to bind heavy metals from wastewater, including the addition of a new promising polypeptide phytochelatin EC20</li><br />
<li>Tested metal ion capture ability of the CBD-phytochelatin fusion constructs when attached to cellulose</li><br />
<br />
</ul><br />
<br />
</section><br />
<section id="result5"><br />
<h2><a href="https://2014.igem.org/Team:Imperial/Mechanical_Testing">Mechanical Testing</a></h2><br />
<h3>Overview</h3><br />
<p>To check the feasibility of using our bacterial cellulose as a customisable ultrafiltration membrane, the mechanical properties were tested. For this to work, we checked the tensile strength of our filter, calculated the shear stress and estimated the processing method that produces membrane with the longest life-time. Our ultimate tensile stress calculated matched with literature values of bacterial cellulose within standard deviation, and the data analysis provided the insight to use non-blended cellulose rather than blended..</p><br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Introduced a new aspect to the manufacturing track in terms of quantitatively characterising the mechanical properties of our product, bacterial cellulose<br />
</li><br />
<li>Quantified the tensile stress-strain properties of our bacterial cellulose.<br />
</li><br />
<li>Discovered that our bacterial cellulose can sustain an order of magnitude higher water pressures than those typically used for ultrafiltration membranes.<br />
</li><br />
<li>Established that non-blended compared to blended bacterial cellulose was significantly more ductile, and would have longer life time as a water filter, which informed the choice of cellulose for the final product.<br />
</li><br />
<li>Tested and analysed 20 samples of bacterial cellulose test pieces.<br />
</li><br />
<li>Created a size and quality optimised gif for visualisation of the experiment and written a protocol for future iGEM teams to do the same.<br />
</li><br />
<br />
<br />
<br />
</ul><br />
</section><br />
<br />
<section id="result6"><br />
<h2>Water filtration</h2><br />
<h3>Overview</h3><br />
<p>By attaching functional proteins to cellulose we can expand it's properties and selectivity capture specific contaminants in water. We used five different cellulose binding domains and fused them to different metal binding proteins, and sfGFP. We performed assays to test the binding of the CBD fusions to our cellulose.</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h3>Key Achievements </h3><br />
<ul><br />
<li> Synthesized and characterised cellulose binding domains (CBD) and their phytochelatin fusions. </li><br />
<li>Proved that cellulose can be functionalised with CBD-phytochelatins.</li> <br />
<li>Showed that bacterial cellulose in itself can successfully filter metal out of solution.</li><br />
<li>Successfully demonstrated filtration of turbid water. </li><br />
<li>Captured Nickel ions on our customisable cellulose filter. </li><br />
<li>Functionalised our homegrown bacterial cellulose with our fusion proteins. </li><br />
</ul><br />
<br />
<section id="result6"><br />
<h2>Water Report</h2><br />
<h3>At a glance</h3><br />
<ul><br />
<br />
<li>Growing population, development and urbanisation make water shortages increasingly severe</li><br />
<li>Beyond public health implications, water shortages cause conflict and social issues throughout the world</li><br />
<li>Decentralisation of water treatment systems is necessary to increase resilience and adapt to changing demand</li><br />
<li>Wastewater recycling is increasingly essential but has technical and social hurdles to overcome</li><br />
<li>Innovative solutions for cost effective, decentralised water recycling are desperately needed</li><br />
</ul><br />
<br />
<br />
<br />
<br />
</section><br />
<br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>HChughtaihttp://2014.igem.org/Team:Imperial/ResultsTeam:Imperial/Results2014-10-18T03:45:13Z<p>HChughtai: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Results</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#overview">Overview</a><br />
</li><br />
<li><a data-scroll href="#result1"><em>G. xylinus</em></a><br />
</li><br />
<li><a data-scroll href="#result2"><em>E.coli</em></a><br />
</li><br />
<li><a data-scroll href="#result3">Co-Culture</a><br />
</li><br />
<li><a data-scroll href="#result4">Functionalisation</a><br />
</li><br />
<li><a data-scroll href="#result5">Mechanical Testing</a><br />
</li><br />
<li><a data-scroll href="#result6">Water filtration</a><br />
</li><br />
<li><a data-scroll href="#result7">Water Report</a><br />
</li><br />
<li><a data-scroll href="#result7">The i in iGEM</a><br />
</li><br />
<br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<br><br />
<br><br />
<section id="overview"><br />
<h2>Overview</h2><br />
<ul><br />
<br />
<li>Assembled and demonstrated a functional cellulose-producing system in Escherichia coli based on the high producing Acs operon</li><br />
<br />
<li>Sequenced the previously unknown genomes of <em>G. xylinus</em> ATCC 53582 and <em>G. xylinus</em> igem strains - the first genomes sequenced in the history of iGEM </li><br />
<br />
<li>Developed a set of new and improved protocols for synthetic biology in <em>G. xylinus</em></li><br />
<br />
<li>Developed a novel co-culture system for production of functionalised bacterial cellulose</li><br />
<br />
<li>Characterised three new cellulose binding domains for the registry and used them to functionalise bacterial cellulose with proteins of interest</li><br />
<br />
<li>Thoroughly characterised the properties of our manufactured biomaterial</li><br />
<br />
<li>Manufactured and tested ultrafiltration filters from bacterial cellulose</li><br />
<br />
<li>Demonstrated novel funtionalisation of cellulose filters with fusion proteins to improve binding of particular contaminants</li><br />
<br />
</ul><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
</section><br />
<section id="result1"><br />
<h2><em><a href="https://2014.igem.org/Team:Imperial/Gluconacetobacter">G.xylinus</a></em></h2><br />
<h3>Overview</h3><br />
<p>Bacterial cellulose has great potential in many areas, including water purification, tissue scaffolds, wound dressings, etc., however, until now, all bacterial cellulose-based materials have been created using chemical or physical post-production processing, not genetic engineering. This is due to the lack of well-developed tools and methods for Gluconacetobacter genetic engineering, as well as the lack of genome sequence of the highest cellulose-producing strain ATCC 53582. We have overcome the numerous difficulties associated with G.xylinus genetic engineering, and turned G.xylinus KI and ATCC 53852 strains into new platforms for the production of cellulose-based biomaterials by sequencing the genomes of ATCC 53582 and KI, creating a genetic toolbox of consisting of five new plasmid backbones and around 40 widely used genes, and developing a set of new and improved protocols for G.xylinus genetic engineering.</p><br />
<h3>Key Achievements</h3><br />
<ul><br />
<li>Isolated a new strain of <em>Gluconacetobacter</em> (named <em>G. xylinus</em> igem) from Kombucha tea and characterized its properties fully.</li><br />
<li>Sequenced the previously unknown genomes of <em>G. xylinus</em> ATCC 53582 and <em>G. xylinus</em> igem strains - the first genomes sequenced in the history of iGEM </li><br />
<li>Discovered four new plasmids capable of replication in <em>Gluconacetobacter</em> species - pSEVA321, pSEVA331, pSEVA351 and pBAV1K, which replicate both in <em>G. xylinus</em> ATCC 53582 and igem strains as well as in <em>E. coli</em></li><br />
<li>Were the first in science to create transgenic cells of <em>G.xylinus</em> igem strain </li><br />
<li>Using our discovered plasmids, created a genetic toolbox consisting of 40 genes for <em>G. xylinus</em> engineering and expressed them in the ATCC 53582 and igem</li> <br />
<br />
<li>Developed a set of new and improved protocols for efficient genetic engineering of <em>G. xylinus</em></li><br />
<li>In summary, turned <em>G. xylinus</em> ATCC 53582 and igem strains into new model organisms and developed the necessary tools to create a powerful platform for the synthesis of new cellulose-based biomaterials and water filters</li><br />
<br />
<br />
<br />
<br />
<br />
</ul><br />
<br />
</section><br />
<section id="result2"><br />
<h2><em><a href="https://2014.igem.org/Team:Imperial/EColi">E.coli</a></em></h2><br />
<h3>Overview</h3><br />
<p><em>Escherichia coli</em> is the organism of choice for synthetic biology. It is thoroughly characterised, easy to engineer and has numerous parts, control circuits and complex constructs tested in this host.</p><br />
<p>Some <em>E. coli</em> strains have evolved to produce low amounts of cellulose but the machinery under specific regulatory control (its secretion is generally linked to biofilm formation and stress situations). In order to expand the use of bacterial cellulose as a functional biomaterial that is cost effective to produce, it is desirable for its production machinery to be implemented in an organisms that is easy to engineer and has proven success in large scale bioreactors.</p><br />
<p>Here, we confirm that the high output cellulose production machinery of <em>Gluconacetobacter Xylinus</em> can be transferred into other organisms. We have proven function of the Acs cellulose producing operon in <em>Escherichia coli</em> using Congo Red binding assays.<br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Contributed an optimised Asc cellulose production operon to Registry of Standard Parts.</li><br />
<li>Proved the portability of <em>Gluconacetobacter xylinus</em> operon.</li><br />
<li>Assembled a fully synthetic, functional, cellulose-producing system in <em>Escherichia coli</em></li><br />
<li>Demonstrated the synthesis operon in a two plasmid system for separate induction of genes</li><br />
<br />
<br />
</ul><br />
<br />
</section><br />
<section id="result3"><br />
<h2>RFP<a href="https://2014.igem.org/Team:Imperial/coculture">Co-Culture</a></h2><br />
<h3>Overview</h3><br />
<p>Based on the hypothesis of <em>E. coli</em> BL21D3 operating anaerobically and <em>G. xylinus</em> replicating aerobically, a co-culture experiment for bacterial cellulose was attempted. Initially, the best possible carbon source among 5 available was found experimentally. This data was used to inform the choice of glycerol and glucose as the carbon feedstock. With these carbon feedstocks, <em>E. coli</em> with RFP expressed were successfully embedded in the bacterial cellulose, and RFP was clearly visible. </p><br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Experimentally determined the optimum carbon feedstocks for a HS media based co-culture of <em>E. coli</em> and <em>G. xylinus</em>. </li><br />
</ul><br />
<br />
</section><br />
<section id="result4"><br />
<h2><a href="https://2014.igem.org/Team:Imperial/Functionalisation">Functionalisation</a></h2><br />
<h3>Overview</h3><br />
<p>Attaching functional proteins to cellulose can expand the properties of cellulose and allow us to selectivity capture specific contaminants in water. By creating fusion proteins of sfGFP and metal-binding proteins with five different cellulose binding domains, three of which are new to the registry, we were able to characterise the relative affinities of the CBDs and show proof-of-concept removal of contaminants from water.</p><br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Added three new cellulose binding domains to the registry</li><br />
<li>Performed an assay with sfGFP-fusions to determine the strongest potential binders which could be carried forward for further testing</li><br />
<li>Identified potential metal binding proteins to bind heavy metals from wastewater, including the addition of a new promising polypeptide phytochelatin EC20</li><br />
<li>Tested metal ion capture ability of the CBD-phytochelatin fusion constructs when attached to cellulose</li><br />
<br />
</ul><br />
<br />
</section><br />
<section id="result5"><br />
<h2><a href="https://2014.igem.org/Team:Imperial/Mechanical_Testing">Mechanical Testing</a></h2><br />
<h3>Overview</h3><br />
<p>To check the feasibility of using our bacterial cellulose as a customisable ultrafiltration membrane, the mechanical properties were tested. For this to work, we checked the tensile strength of our filter, calculated the shear stress and estimated the processing method that produces membrane with the longest life-time. Our ultimate tensile stress calculated matched with literature values of bacterial cellulose within standard deviation, and the data analysis provided the insight to use non-blended cellulose rather than blended..</p><br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Introduced a new aspect to the manufacturing track in terms of quantitatively characterising the mechanical properties of our product, bacterial cellulose<br />
</li><br />
<li>Quantified the tensile stress-strain properties of our bacterial cellulose.<br />
</li><br />
<li>Discovered that our bacterial cellulose can sustain an order of magnitude higher water pressures than those typically used for ultrafiltration membranes.<br />
</li><br />
<li>Established that non-blended compared to blended bacterial cellulose was significantly more ductile, and would have longer life time as a water filter, which informed the choice of cellulose for the final product.<br />
</li><br />
<li>Tested and analysed 20 samples of bacterial cellulose test pieces.<br />
</li><br />
<li>Created a size and quality optimised gif for visualisation of the experiment and written a protocol for future iGEM teams to do the same.<br />
</li><br />
<br />
<br />
<br />
</ul><br />
</section><br />
<br />
<section id="result6"><br />
<h2>Water filtration</h2><br />
<h3>Overview</h3><br />
<p>By attaching functional proteins to cellulose we can expand it's properties and selectivity capture specific contaminants in water. We used five different cellulose binding domains and fused them to different metal binding proteins, and sfGFP. We performed assays to test the binding of the CBD fusions to our cellulose.</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h3>Key Achievements </h3><br />
<ul><br />
<li> Synthesized and characterised cellulose binding domains (CBD) and their phytochelatin fusions. </li><br />
<li>Proved that cellulose can be functionalised with CBD-phytochelatins.</li> <br />
<li>Showed that bacterial cellulose in itself can successfully filter metal out of solution.</li><br />
<li>Successfully demonstrated filtration of turbid water. </li><br />
<li>Captured Nickel ions on our customisable cellulose filter. </li><br />
<li>Functionalised our homegrown bacterial cellulose with our fusion proteins. </li><br />
</ul><br />
<br />
<section id="result6"><br />
<h2>Water Report</h2><br />
<h3>At a glance</h3><br />
<ul><br />
<br />
<li>Growing population, development and urbanisation make water shortages increasingly severe</li><br />
<li>Beyond public health implications, water shortages cause conflict and social issues throughout the world</li><br />
<li>Decentralisation of water treatment systems is necessary to increase resilience and adapt to changing demand</li><br />
<li>Wastewater recycling is increasingly essential but has technical and social hurdles to overcome</li><br />
<li>Innovative solutions for cost effective, decentralised water recycling are desperately needed</li><br />
</ul><br />
<br />
<br />
<br />
<br />
</section><br />
<br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>HChughtaihttp://2014.igem.org/Team:Imperial/EColiTeam:Imperial/EColi2014-10-18T03:42:51Z<p>HChughtai: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1><em>E. coli</em></h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#introduction">Introduction</a><br />
</li><br />
<li><a data-scroll href="#aim">Aims</a><br />
</li><br />
<li><a data-scroll href="#engineering">Engineering</a><br />
</li><br />
<li><a data-scroll href="#methods">Materials and Methods</a><br />
</li><br />
<br />
<li><a data-scroll href="#results">Results</a><br />
</li><br />
<li><a data-scroll href="#future">Future Work</a><br />
</li><br />
<li><a data-scroll href="#references">References</a><br />
</li><br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p><em>Escherichia coli</em> is the organism of choice for synthetic biology. It is thoroughly characterised, easy to engineer and has numerous parts, control circuits and complex constructs tested in this host.</p><br />
<p>Some <em>E. coli</em> strains have evolved to produce low amounts of cellulose but the machinery under specific regulatory control (its secretion is generally linked to biofilm formation and stress situations). In order to expand the use of bacterial cellulose as a functional biomaterial that is cost effective to produce, it is desirable for its production machinery to be implemented in an organisms that is easy to engineer and has proven success in large scale bioreactors.</p><br />
<p>Here, we confirm that the high output cellulose production machinery of <em>Gluconacetobacter Xylinus</em> can be transferred into other organisms. We have proven function of the Acs cellulose producing operon in <em>Escherichia coli</em> using Congo Red binding assays.<br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>Key Achievements </h2><br />
<ul><br />
<li>Contributed an optimised Asc cellulose production operon to Registry of Standard Parts.</li><br />
<li>Proved the portability of <em>Gluconacetobacter xylinus</em> operon.</li><br />
<li>Assembled a fully synthetic, functional, cellulose-producing system in <em>Escherichia coli</em></li><br />
<li>Demonstrated the synthesis operon in a two plasmid system for separate induction of genes</li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<br />
<br/><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<figure class="content-image image-full"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/2/20/IC14-ecoli-fig1.jpg"><br />
<figcaption>Figures 1 & 2: Congo red staining of microbial cellulose in <em>E. coli</em></figcaption><br />
</figure><br />
</div><br />
<br />
<br />
<div class="pure-u-1-2"><br />
<figure class="content-image image-full"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/a/ad/IC14-ecoli-fig3.jpg"><br />
<figcaption></figcaption><br />
</figure><br />
</div><br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<section id="Aims"><br />
<h2>Aims</h2><br />
<br />
<p>By transferring the cellulose production operon from its native organism <em>Gluconacetobacter xylinus</em> into the lab and industrially friendly host <em>Escherichia coli</em>, we aim to improve cellulose production per unit time to achieve more cost effective pellicle growth and to encourage further synthetic biology with microbial cellulose. <em>E. coli</em> grows considerably faster plus tolerates higher temperatures and more vigorous aeration. The ease of genetic engineering and the wealth of other characterized Biobricks increases the potential for exciting future projects</p><br />
<br />
<br />
</section><br />
<section id="engineering"><br />
<h2>Engineering</h2><br />
<p>The cellulose production operon in <em>Gluconacetobacter xylinus</em> is a 10kb genomic region, consisting of four main elements:</p><br />
<ul><br />
<li>acsAB, known as cellulose synthase, is made up of two domains: acsA being the catalytic domain, and acsB being the cyclic-di-GMP-binding domain. This modular enzyme requires the second messenger cyclic-di-GMP in order to carry out efficient catalysis.</li><br />
<li>acsC codes for an oligomeric element that gets embedded in the extracellular membrane and allows transport of the growing polymer across the cell membrane into the extracellular environment.</li><br />
<li>acsD is believed to be a non-essential element, although it is a key player in the control of cellulose crystallinity and required for maximal cellulose productivity.</li><br />
</ul><br />
<p>The native operon is highly regulated at transcriptional, translational and post-translational levels. Cellulose production responds to a wide set of internal signals and environmental cues. The native ribosomal binding sites (RBS) are predicted to be weak by translation rate calculators (The <a href="https://salis.psu.edu/software/"> Salis Lab RBS calculator </a> and <a href="http://sbi.postech.ac.kr/utr_designer"> Postech UTR designer </a>). This is perhaps to reduce noise in gene expression (strong promoter, weak RBS is less noisy that weak promoter strong RBS). The promoter region has not yet been characterized in <em>Gluconacetobacter xylinus</em>, however.</p><br />
<br />
<p>The first step of our computational design engineering was to identify the coding sequences and extract them from NCBI. We removed some native regulation by codon-optimizing the sequences for expression in <em>E.coli</em> and replaced the native RBS’s with the strong B0034 sequence. The 6 base pairs either side of the B0034 RBS were edited with the Salis Lab RBS calculator design function to tune RBS strength output to better preserve the natural stoichiometry.</p><br />
<br />
<p>Finally, in order to allow for even more customizable fine-tuning of the system, the operon was divided and cloned into two separate expression vectors: the AcsAB element was cloned under the control of the inducible pBAD promoter contained within pSB1C3, a high copy plasmid that would contribute to higher expression of Cellulose Synthase. Alternatively, AcsC and AcsD, believed to be expressed at lower levels in <em>G.xylinus</em>, was put under the control of the pLAC promoter and was transferred into a low copy plasmid, pSB3K3 so as to maintain lower levels of expression. This approach provided the following advantages:</p><br />
<ul><br />
<li>Reducing the size of the final expression vector avoids complications during assembly and vector take-up, and it also prevents a large construct from becoming a burden for cell growth and vector propagation.</li><br />
<li>By expressing the cellulose production machinery from two separate expression vectors, the following levels of control become available to us: the first being the changes in vector copy number, which directly affects gene expression levels throughout induction, and the second being the ability to activate the system using two different inducers. These key features of our system allow for a larger scope for fine-tuning and optimization of cellulose production levels.</li><br />
<br />
</ul><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/5/55/IC14-ecoli-pBAD-pLAC-CD.png"><br />
<figcaption>Figure 3: pSB-pBAD-AB and pLAC-CD</figcaption><br />
</figure><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/e/e7/IC14-ecoli-ABCDfragments.jpg.png"><br />
<figcaption>Figure 4: acsABCD fragments</figcaption><br />
</figure><br />
<p>With this approach, we allow for our system to be implemented in new range of hosts because a larger set of growth conditions, inducer concentrations and growth phases can be tested in order to achieve the required stoichiometry for the system to become functional.</p><br />
<br />
<br />
<p>In order to ease synthesis, the operon sequence was split into 4 fragments of similar sizes. We took advantage of the presence of two restriction sites: An NcoI present within the AcsAB sequence, and a PvuII site contained within AcsC. Furthermore, the BioBrick prefix and suffix were included and any additional sites removed elsewhere.</p><br />
<br />
<p>By standard cloning, these fragments could easily be put together to yield the following constructs:</p><br />
<figure class="content-image image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/f/ff/IC14-ecoli-AB-CD-constructs.png"><br />
<figcaption>Figure 5: acsAB and acsCD constructs</figcaption><br />
</figure><br />
<br />
<p>Gene Designer served as a very useful tool for assembling constructs and predicting cloning outcomes before proceeding with the experimental procedure. Find above the plasmid maps of our resulting constructs, and refer to Materials and Methods for a deeper insight into the assembly process.</p><br />
<br />
</section><br />
<section id="methods"><br />
<h2>Materials and Methods</h2><br />
<div class="accordion"><br />
<h3>1.0 Cell Strains and Media Components</h3><br />
<div><br />
<p><em>Escherichia coli</em> strain DH10B were made chemically competent following a standard protocol and were used to clone the pSB-AraC-pBAD and pSB-LacI-pLAC elements. Additionally, High Efficiency chemically competent DH10B <em>Escherichia coli</em> were purchased from New England Biolabs for assembly of the Acs cellulose-producing operon, which was codon-optimized for expression in E.coli and synthesized by GeneArt. Both strains were grown overnight in liquid cultures (supplemented with specific antibiotics), or on semi-solid LB-Agar plates, provided with the specific antibiotic, as listed on the table below.</p><br />
<br />
<p>Luria Broth Miller (LB) and LB Agar were purchased from VWR, prepared using standard protocols and used throughout the experimental procedure. During characterization, Acs-containing strains were supplemented with 1% D-glucose, 0.1% Arabinose and 0.5mM IPTG.<br />
</p><br />
<br />
<figure class="content-image"><br />
<table class="tg image-full"><br />
<tr><br />
<th class="tg-e3zv">Plasmid name</th><br />
<th class="tg-e3zv">Vector backbone</th><br />
<th class="tg-e3zv">Antibiotic concentration (ug/ml)</th><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AraC-pBAD</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-LacI-pLAC</td><br />
<td class="tg-031e">pSB3K3</td><br />
<td class="tg-031e">Kanamycin 25</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AcsAB</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AcsCD</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AraC-pBAD-AcsAB</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-LacI-pLAC-CD</td><br />
<td class="tg-031e">pSB3K3</td><br />
<td class="tg-031e">Kanamycin 25</td><br />
</tr><br />
</table><br />
<figcaption>Figure 6: List of antibiotics used, in relation to their respective constructs</figcaption><br />
</figure><br />
<br />
</div><br />
<h3>2.0 Chemicals </h3><br />
<div><br />
<p>Congo Red was purchased from Sigma Aldrich (Steiheim, Germany) and diluted in 1x PBS to a concentration of 350 uM. The final Congo Red concentration used during system characterization steps was 20 uM. This was also used, also at a concentration of 20 uM, to make LB Agar Congo Red Assay plates.</p><br />
</div><br />
<h3>3.0 Construct Assembly</h3><br />
<div><br />
<h4>3.1 Cloning of pSB-AraC-pBAD</h4><br />
<div><br />
<p>The AraC and pBAD elements were obtained by PCR, using the Biobricks BBa_K325108, BBa_K325218 and BBa_K325219 as DNA templates, all of which follow the standard structure showed on figure 7. The primers used during this procedure were as follows:<br />
</p><br />
<ul><br />
<li>Forward: TACTAGTAGCGGCCGCTGCAG</li><br />
<li>Reverse: GCTAGCCCAAAAAAACGGGTATGGAG</li><br />
</ul><br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/d/d4/IC14-ecoli-AraC-pBAD.png"><br />
<figcaption>Figure 7 - Plasmid maps describing both the original (left) and engineered (right) AraC-pBAD-containing parts, including all relevant elements. These were designed and cloned in silico on GeneDesigner.</figcaption><br />
</figure><br />
</div><br />
<p>The amplified elements were DpnI-treated following a standard procedure (New England Biolabs), and were subsequently submitted to a purification step (Qiaquick PCR clean up, Qiagen) prior to self-ligation. Three different template concentrations were tested during ligation (specifically 3 ng, 7.5 ng and 15 ng), and were incubated at room temperature for 1h+. The ligation mix was then transformed into chemically competent DH10B Escherichia coli using a standard chemical transformation protocol and plated out on Chloramphenicol-specific LB plates.</p><br />
<h4>3.2 Cloning of pSB3K3-LacI-pLAC</h4><br />
<p>A compatible plasmid and induction system was cloned to allow expression of the operon in two parts. The medium/strong promoter J23110 was cloned in front of the quad part inverter Q01121. The inverter has an RBS, the LacI repressor followed by a double terminator then a Lac inducible promoter. The composite part created give constitutive expression of the Lac repressor allowing for induction by IPTG. The parts were then moved into the pSB3k3 backbone to be compatible with pSB1C3.</p><br />
<div><br />
<br />
</div><br />
<h4>3.3 Assembly of AcsAB and AcsCD </h4><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/3/3c/IC14-ecoli-construct-assembly.jpg"><br />
<figcaption>Figure 8:</figcaption><br />
</figure><br />
<p>The AcsABCD operon was designed in silico as described in the previous section. It was ordered for synthesis at GenArt in the form of four separate elements of similar sizes, named AcsA, AcsB, AcsC and AcsD, respectively. After synthesis, the constructs were directly transformed into DH10B <em>E.coli</em> using a standard chemical transformation protocol and plated overnight supplied with 50 ug/ml Kanamycin. 5ml LB were inoculated with a freshly growing colony and grown overnight at 37 C, under shaking conditions. Glycerol stocks were produced prior to proceeding with the assembly process.</p><br />
<p>In order to meet the Registry standards, we aimed to clone these elements into pSB1C3. To do so, we proceeded as described on figure 8. Two separate rounds of digestion were carried out using EcoRI, NcoI, PvuII and PstI to, and the resulting fragments (AcsA, AcsB, AcsC and AcsD and linearized pSB1C3) were submitted to a three-part ligation after dephosphorylation of the vector backbone (rAPid desphosphorylation, Roche). An equimolar ratio amongst all three parts was established during the ligation procedure, which in turn proceeded at 4 degrees overnight. The NEB High Efficiency Transformation protocol was used on NEB 10B cells (New England Biolabs) to propagate the resulting plasmid. Transformed cells were plated and incubated overnight at 37 C. 5 ml LB supplied with 50 ug/ml Chloramphenicol were inoculated with a selection of colonies for further analysis (refer to Results for additional information).</p><br />
<br />
<h4>3.4 Assembly of pSB-AraC-pBAD-AcsAB</h4><br />
<p>AcsAB was cloned into pSB-AraC-pBAD by Biobrick cloning. The destination vector was linearized using SpeI and PstI (New England Biolabs), and AcsAB (previously digested with XbaI and PstI, and gel extracted using the Minelute Gel Extraction Kit, by Qiagen) was ligated at a 1:1 ratio throughout an overnight ligation at room temperature. The resulting part was transformed into chemically competent DH10B Escherichia coli and plated on LB Agar+Chloramphenicol plates, grown overnight at 37 C. 5 ml LB falcons supplied with 50 ug/ml Chloramphenicol were inoculated with a selection of freshly grown colonies for further restriction analysis (refer to Results for additional information)</p><br />
<br />
<h4>3.5 Assembly of pSB-LacI-pLAC-CD</h4><br />
<p>Similarly to 3.4, AcsCD was cloned by BioBrick cloning into the pSB3K3 low copy expression vector containing the LacI-pLAC regulatory elements. Vector and insert were ligated at a 1:1 ratio overnight at room temperature. After transformation and plating on LB Agar+Kanamycin (25 ug/ml), colonies were screened by Greentaq colony PCR, and were further confirmed during the Congo Red Assay.</p><br />
</div><br />
<h3>Electroporation of pSB-pLAC-CD into electrocompetent AcsAB-containing DH10B cells</h3> <br />
<div><br />
<p>DH10B E.coli already containing the AcsAB construct were made electrocompetent using a standard protocol, which can be found in the Protocols section. A second round of transformation was carried out to insert pLAC-AcsCD. 5ul of miniprepped pSB-pLAC-CD (diluted in ddH2O) were added into 50ul electrocompetent DH10B cells already containing the pBAD-inducible AcsAB element. Electroporation was carried out in in 10mm electrocuvettes at 1.8 kV, 200 Ohm resistance and 25 mF capacitance. 500ul SOC medium was added to the electroporated samples and these were recovered at 37 °C for 1h before plating on Kanamycin25 + Chloramphenicol 50 LB Agar plates.</p><br />
</div><br />
<h3>Congo Red Characterization</h3><br />
<div><br />
<p>LB Agar Congo Red assay plates were prepared with a final Congo Red concentration of 20uM, and they were supplied with 0.1% Arabinose, 0.5mM IPTG, 50 ug/mL Chloramphenicol, 25 ug/mL Kanamycin and 1% Glucose. Transformed cells containing both AcsAB and AcsCD were plated on Congo Red assay plates and incubated at 37 °C. They were qualitatively assayed after 24h and 48h for cellulose production. Finally, 5 mL LB supplied with 0.1% Arabinose, 0.5mM IPTG, 50 ug/mL Chloramphenicol, 25 ug/mL Kanamycin and 1% Glucose were inoculated with freshly grown, cellulose-producing colonies and were grown for 16h at 30 °C, 180 rpm. An empty vector control was also grown overnight for comparative analysis. These liquid cultues were supplied with Congo Red, to yield a final concentration of 20uM. They were incubated under static conditions for 2h at room temperature, and were later pelleted down to allow for qualitative analysis of Congo Red binding.</p><br />
<br />
<p>AcsAB functionality was assayed by inducing AcsAB-containing cells with 0.1% Arabinose in 5mL LB supplied with 1% Glucose and Chloramphenicol. Overnight incubations were set up at 30 °C and 37 °C, and both empty vector controls and un-induced controls were also assayed. Cells were pelleted at 4000rpm for 10 minutes and the supernatant was kept for further analysis. Cells were resuspended in 1xPBS and sonicated for 3 minutes as on/off cycles of 15 seconds. Both the membrane and soluble samples produced after centrifugation were kept for further analysis. Congo Red was then added to the LB, soluble and membrane samples up to a final concentration of 20uM, and no Congo Red samples were also kept for further inspection. Samples were incubated for 2h at static conditions and at room temperature to allow for Congo Red binding. 96-well plates were inoculated for further absorbance measurements at 490nm.</p><br />
</div><br />
<br />
<br />
</div><br />
</section><br />
<br />
<br />
<section id="results"><br />
<h2>Results</h2><br />
<div class="accordion"><br />
<h3>Constructs</h3><br />
<div><br />
<p>All constructs were assembled as described in Materials and Methods. As a preliminary verification step, restriction analyses were carried out using the corresponding restriction enzymes (refer to figure legends for more details) and results were visualized on 0.7-1% agarose gels. Final confirmation was obtained by gene sequencing, during which the BioBrick Verification Primers and walking primers were used. These are shown on the table below, please refer to the Registry for further information.</p><br />
<br />
<figure class="content-image"><br />
<table class="tg image-full"><br />
<tr><br />
<th </th><br />
<th </th><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AraC-pBAD</td><br />
<td class="tg-031e">Forward: TACTAGTAGCGGCCGCTGCAG<br />
<br>Reverse: GCTAGCCCAAAAAAACGGGTATGGAG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">BioBrick Verification Primers</td><br />
<td class="tg-031e">Forward: TGCCACCTGACGTCTAAGAA<br />
<br>Reverse: ATTACCGCCTTTGAGTGAGC</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 1</td><br />
<td class="tg-031e">TCT GAA TTA TGC CAT TGG TCA TAC CG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 2</td><br />
<td class="tg-031e">ATA TGT TTC ATG CAG TTG GCA CC</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 3</td><br />
<td class="tg-031e">GAT GCA TGG GTT GAT TGG GG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 4</td><br />
<td class="tg-031e">ATC CAG CAC ATC CGA CCT TTG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 5</td><br />
<td class="tg-031e">GTT ACC GCA AGT AAA CTG CAA G</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 6</td><br />
<td class="tg-031e">GAT GGT CTG ATT CGT CTG GTT A</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 7</td><br />
<td class="tg-031e">ACG CAG CAC AGG TCA GAC CGG TGA A</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 8</td><br />
<td class="tg-031e">ATA TTG ATC TGA CCA CCG AACA</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 9</td><br />
<td class="tg-031e">TGC ACC GCC TGG TGA AAA TGG TT</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 10</td><br />
<td class="tg-031e">GTG GCT ATG CAA TTC AGA CAG GT</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 11</td><br />
<td class="tg-031e">TTC ATT CCC AGC GGT CGG TCG AT</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 12</td><br />
<td class="tg-031e">GTT TGC GTG GTG ATC TTT TT</td><br />
</tr><br />
</table><br />
<figcaption>Figure 9 - List of primers used by Team E.coli during the experimental procedure</figcaption><br />
</figure><br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/f/f8/IC14-ecoli-gel-pSB-AcsAB.jpg"><br />
<figcaption>Figure 10: Restriction Analysis results of AcsAB. Samples were submitted to an XbaI/PstI double digest, which flank the AcsAB construct. Two bands were displayed as expected: a ~5kb band corresponding to the AcsAB insert, and a ~2kb band corresponding to the pSB1C3 vector backbone. </figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/c/c1/IC14-ecoli-gel-pSB-AcsCD.jpg"><br />
<figcaption>Figure 11: Restriction analysis results of AcsCD. Samples were submitted to an XbaI/SpeI double restriction. Positive samples displayed a 4.4kb band corresponding to the AcsCD insert, in addition to a 2kb band that corresponded to the pSB1C3 plasmid backbone. </figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/b/b9/IC14-ecoli-gel-pSB-AraC-pBAD.jpg"><br />
<figcaption>Figure 12: Restriction Analysis results of AraC-pBAD. Samples were submitted to an XbaI/PstI double digest. A 2-band pattern was obtained, indicating the presence of a ~2kb DNA fragment corresponding to the pSB1C3 vector backbone, and a ~1kb fragment corresponding to the AraC and pBAD elements being cloned. </figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/e/e7/IC14-ecoli-gel-pSB-AraC-pBAD-AcsAB-pSB-LacI-AcsAB.jpg"><br />
<figcaption>Figure 13: Restriction Analysis results of AraC-pBAD. Samples were submitted to an XbaI/PstI double digest. A 2-band pattern was obtained, indicating the presence of a ~2kb DNA fragment corresponding to the pSB1C3 vector backbone, and a ~1kb fragment corresponding to the AraC and pBAD elements being cloned. </figcaption><br />
</figure><br />
</div><br />
<br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/4/4a/IC14-ecoli-gel-colony1.jpg"><br />
<figcaption>Figure 14: pLAC-AcsCD colony PCR results. Further details on the procedure can be found on the Methods and Materials section. Those colonies that we testes further have been highlighted with numbers on the pictures. Specifically, colony A1 was used for subcloning into AcsAB containing E.coli DH10B. <br />
Plates A and B were generated <br />
</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/1/10/IC14-ecoli-gel-colony2.jpg"><br />
<figcaption>Figure 15: pLAC-AcsCD colony PCR results. Further details on the procedure can be found on the Methods and Materials section. Those colonies that we testes further have been highlighted with numbers on the pictures. Specifically, colony A1 was used for subcloning into AcsAB containing E.coli DH10B. <br />
Plates A and B were generated <br />
</figcaption><br />
</figure><br />
</div><br />
</div><br />
<br />
<br />
<br />
</div><br />
<h3>Characterising Cellulose Production</h3><br />
<div><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/f/fe/IC14-ecoli-fig2.png"><br />
<figcaption>Figure 16:</figcaption><br />
</figure><br />
<p>Cellulose Production can be easily assayed using the diazo dye Congo Red. Congo Red specifically binds cellulostic fibrils, and this binding can be measured by spectral analysis, because it causes a shift on the spectral properties of the dye, which can be monitored with a spectrophotometer (Klunk et al., 1999). In addition to this, Congo Red also allows for visual, qualitative analysis: it causes a color change of any cellulose-producing colonies by binding to the growing fibres. Therefore, cellulose production can be easily detected by eye on LB Agar plates and liquid cultures (Jolanta Sereikaite and Vladas-Algirdas Bumelis, 2006).</p><br />
<br />
<p>We assayed cellulose production on LB Agar Congo Red assay plates. Colonies containing the refactored cellulose production machinery turned red within 24h, and presented a rougher composition and brighter red color after 48h. In contrast to this, colonies presenting empty vector (negative controls), presented no color changes and maintained the characteristics of standard <em>Escherichia coli</em> colonies (smoother composition and standard yellow colour).</p><br />
<br />
<p>To confirm this qualitative assay, a second qualitative assay was carried out, also based on Congo Red binding. This second analysis consisted of incubating overnight cultures (both cellulose producers and empty vector controls) with Congo Red as described in Materials and Methods. Cellulose producers will present growing cellulose fibres on their extracellular surface, hence will dye red in the presence of Congo Red, unlike non-cellulose-producing cells. After spinning down the cells, a red pellet was observed that corresponded to the cellulose producing colonies. In contrast to this, negative controls did not bind Congo Red and hence maintained the standard E.coli characteristics. We consider that this qualitative data supports our design and confirms that the cellulose production operon has been successfully refactored and transferred into <em>Escherichia coli</em>.</p><br />
<br />
<p>In order to gain a better understanding of the activity of the Acs elements in Escherichia coli, it was of interest to explore whether the AcsAB element alone would be enough to achieve cellulose production. AcsAB is embedded in the cytoplasmic membrane and transports the growing polymer through the membrane as it attaches the glucose monomers in the cytoplasm. In the absence of AcsC and AcsD, no cellulose can be secreted into the environment and as a result, it was assumed that it would instead become accumulated in the cell’s periplasm. For this reason, during characterization we required sonication in order to get the cellulose (if any at all) out of the cells.</p><br />
<br />
<p>To widen our screening, we set up induced samples and uninduced controls and assayed samples at different temperatures (30°C versus 37°C) and different conditions (shaking versus static) in the presence or absence of 1% D-Glucose. Furthermore, 2 Biological replicates were assayed, and technical triplicates were also set up during plate reading to support any statistically relevant findings. Although we expected no cellulose to be accumulating in the medium, we still analysed all fractions originating throughout the procedure: LB fractions, soluble fractions and non-soluble fractions (called membrane fractions throughout this study).</p><br />
<br />
<p>All fractions were incubated in the presence of Congo Red (as described in Materials and Methods) and were later inoculated into a 96-well plate for absorbance measurements at 490nm. Free Congo Red has a maximal absorption at such wavelength. By setting up a control sample, containing solvent (PBS)+ Congo Red, it is possible to measure the total absorbance of the molecule whilst free in solution. When cellulolytic samples are incubated in the presence of Congo Red, less azodye molecules becomes available in the medium due to binding, hence absorbance levels will decrease. The total Congo Red bound will equal the absorbance of Congo Red Control minus the absorbance of our samples of interest. This approach gives you an idea of the amount of Congo Red that may have bound to the cellulositic fibres, but it does not provide exact values of cellulose present.</p><br />
<br />
<figure class="content-image image-half"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/7/76/IC14-congo.png"><br />
<figcaption>Figure 17: LB fraction - Congo Red Binding</figcaption><br />
</figure><br />
<p>As expected, LB fractions all presented similar, non-cellulolytic composition and hence displayed no changes in absorbance, indicating no CR binding. </p><br />
<figure class="content-image image-half"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/b/bb/IC14-Membrane_fraction.png"><br />
<figcaption>Figure 18: Membrane Fraction - Induction of the pBAD-AcsAB</figcaption><br />
</figure><br />
<p>It was observed that interestingly, membrane fractions that had been previously incubated at 30 C presented a dramatic change in Congo Red binding. This proves not only that the AcsAB is active (at least to some extent) in the absence of AcsC and AcsD, but also that it may be optimal for the cellulose synthase to be folded and functional at lower temperatures, as it occurs in the native host G.xylinus. </p><br />
<br />
</div><br />
<br />
<br />
</section><br />
<br />
<br />
<br />
<section id="references"><br />
<h2>References</h2><br />
<ol><br />
<li></li><br />
<li>P. Ross, R. Mayer, and M. Benziman (1991) "Cellulose biosynthesis and function in bacteria," Microbiol Mol Biol Rev, vol. 55, no. 1, pp. 35-58, Mar</li><br />
<li>Sereikaite, J.; Bumelis, V.A. (2006) Congo Red Interactions with alpha-proteins</li><br />
<li>W. E. Klunk, R. F. Jacob, and R. P. Mason, “Quantifying amyloid by congo red spectral shift assay,” Methods in Enzymology, vol. 309, pp. 285–305, 1999.</li><br />
<li></li><br />
<br />
<br />
<br />
<br />
<br />
</ol><br />
</section><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
<br />
{{:Team:Imperial/Templates:footer}}</div>HChughtaihttp://2014.igem.org/File:IC14-ecoli-future.pngFile:IC14-ecoli-future.png2014-10-18T03:41:01Z<p>HChughtai: </p>
<hr />
<div></div>HChughtaihttp://2014.igem.org/Team:Imperial/EColiTeam:Imperial/EColi2014-10-18T03:38:12Z<p>HChughtai: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1><em>E. coli</em></h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#introduction">Introduction</a><br />
</li><br />
<li><a data-scroll href="#aim">Aims</a><br />
</li><br />
<li><a data-scroll href="#engineering">Engineering</a><br />
</li><br />
<li><a data-scroll href="#methods">Materials and Methods</a><br />
</li><br />
<br />
<li><a data-scroll href="#results">Results</a><br />
</li><br />
<li><a data-scroll href="#future">Future Work</a><br />
</li><br />
<li><a data-scroll href="#references">References</a><br />
</li><br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p><em>Escherichia coli</em> is the organism of choice for synthetic biology. It is thoroughly characterised, easy to engineer and has numerous parts, control circuits and complex constructs tested in this host.</p><br />
<p>Some <em>E. coli</em> strains have evolved to produce low amounts of cellulose but the machinery under specific regulatory control (its secretion is generally linked to biofilm formation and stress situations). In order to expand the use of bacterial cellulose as a functional biomaterial that is cost effective to produce, it is desirable for its production machinery to be implemented in an organisms that is easy to engineer and has proven success in large scale bioreactors.</p><br />
<p>Here, we confirm that the high output cellulose production machinery of <em>Gluconacetobacter Xylinus</em> can be transferred into other organisms. We have proven function of the Acs cellulose producing operon in <em>Escherichia coli</em> using Congo Red binding assays.<br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>Key Achievements </h2><br />
<ul><br />
<li>Contributed an optimised Asc cellulose production operon to Registry of Standard Parts.</li><br />
<li>Proved the portability of <em>Gluconacetobacter xylinus</em> operon.</li><br />
<li>Assembled a fully synthetic, functional, cellulose-producing system in <em>Escherichia coli</em></li><br />
<li>Demonstrated the synthesis operon in a two plasmid system for separate induction of genes</li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<br />
<br/><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<figure class="content-image image-full"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/2/20/IC14-ecoli-fig1.jpg"><br />
<figcaption>Figures 1 & 2: Congo red staining of microbial cellulose in <em>E. coli</em></figcaption><br />
</figure><br />
</div><br />
<br />
<br />
<div class="pure-u-1-2"><br />
<figure class="content-image image-full"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/a/ad/IC14-ecoli-fig3.jpg"><br />
<figcaption></figcaption><br />
</figure><br />
</div><br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<section id="Aims"><br />
<h2>Aims</h2><br />
<br />
<p>By transferring the cellulose production operon from its native organism <em>Gluconacetobacter xylinus</em> into the lab and industrially friendly host <em>Escherichia coli</em>, we aim to improve cellulose production per unit time to achieve more cost effective pellicle growth and to encourage further synthetic biology with microbial cellulose. <em>E. coli</em> grows considerably faster plus tolerates higher temperatures and more vigorous aeration. The ease of genetic engineering and the wealth of other characterized Biobricks increases the potential for exciting future projects</p><br />
<br />
<br />
</section><br />
<section id="engineering"><br />
<h2>Engineering</h2><br />
<p>The cellulose production operon in <em>Gluconacetobacter xylinus</em> is a 10kb genomic region, consisting of four main elements:</p><br />
<ul><br />
<li>acsAB, known as cellulose synthase, is made up of two domains: acsA being the catalytic domain, and acsB being the cyclic-di-GMP-binding domain. This modular enzyme requires the second messenger cyclic-di-GMP in order to carry out efficient catalysis.</li><br />
<li>acsC codes for an oligomeric element that gets embedded in the extracellular membrane and allows transport of the growing polymer across the cell membrane into the extracellular environment.</li><br />
<li>acsD is believed to be a non-essential element, although it is a key player in the control of cellulose crystallinity and required for maximal cellulose productivity.</li><br />
</ul><br />
<p>The native operon is highly regulated at transcriptional, translational and post-translational levels. Cellulose production responds to a wide set of internal signals and environmental cues. The native ribosomal binding sites (RBS) are predicted to be weak by translation rate calculators (The <a href="https://salis.psu.edu/software/"> Salis Lab RBS calculator </a> and <a href="http://sbi.postech.ac.kr/utr_designer"> Postech UTR designer </a>). This is perhaps to reduce noise in gene expression (strong promoter, weak RBS is less noisy that weak promoter strong RBS). The promoter region has not yet been characterized in <em>Gluconacetobacter xylinus</em>, however.</p><br />
<br />
<p>The first step of our computational design engineering was to identify the coding sequences and extract them from NCBI. We removed some native regulation by codon-optimizing the sequences for expression in <em>E.coli</em> and replaced the native RBS’s with the strong B0034 sequence. The 6 base pairs either side of the B0034 RBS were edited with the Salis Lab RBS calculator design function to tune RBS strength output to better preserve the natural stoichiometry.</p><br />
<br />
<p>Finally, in order to allow for even more customizable fine-tuning of the system, the operon was divided and cloned into two separate expression vectors: the AcsAB element was cloned under the control of the inducible pBAD promoter contained within pSB1C3, a high copy plasmid that would contribute to higher expression of Cellulose Synthase. Alternatively, AcsC and AcsD, believed to be expressed at lower levels in <em>G.xylinus</em>, was put under the control of the pLAC promoter and was transferred into a low copy plasmid, pSB3K3 so as to maintain lower levels of expression. This approach provided the following advantages:</p><br />
<ul><br />
<li>Reducing the size of the final expression vector avoids complications during assembly and vector take-up, and it also prevents a large construct from becoming a burden for cell growth and vector propagation.</li><br />
<li>By expressing the cellulose production machinery from two separate expression vectors, the following levels of control become available to us: the first being the changes in vector copy number, which directly affects gene expression levels throughout induction, and the second being the ability to activate the system using two different inducers. These key features of our system allow for a larger scope for fine-tuning and optimization of cellulose production levels.</li><br />
<br />
</ul><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/5/55/IC14-ecoli-pBAD-pLAC-CD.png"><br />
<figcaption>Figure 3: pSB-pBAD-AB and pLAC-CD</figcaption><br />
</figure><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/e/e7/IC14-ecoli-ABCDfragments.jpg.png"><br />
<figcaption>Figure 4: acsABCD fragments</figcaption><br />
</figure><br />
<p>With this approach, we allow for our system to be implemented in new range of hosts because a larger set of growth conditions, inducer concentrations and growth phases can be tested in order to achieve the required stoichiometry for the system to become functional.</p><br />
<br />
<br />
<p>In order to ease synthesis, the operon sequence was split into 4 fragments of similar sizes. We took advantage of the presence of two restriction sites: An NcoI present within the AcsAB sequence, and a PvuII site contained within AcsC. Furthermore, the BioBrick prefix and suffix were included and any additional sites removed elsewhere.</p><br />
<br />
<p>By standard cloning, these fragments could easily be put together to yield the following constructs:</p><br />
<figure class="content-image image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/f/ff/IC14-ecoli-AB-CD-constructs.png"><br />
<figcaption>Figure 5: acsAB and acsCD constructs</figcaption><br />
</figure><br />
<br />
<p>Gene Designer served as a very useful tool for assembling constructs and predicting cloning outcomes before proceeding with the experimental procedure. Find above the plasmid maps of our resulting constructs, and refer to Materials and Methods for a deeper insight into the assembly process.</p><br />
<br />
</section><br />
<section id="methods"><br />
<h2>Materials and Methods</h2><br />
<div class="accordion"><br />
<h3>1.0 Cell Strains and Media Components</h3><br />
<div><br />
<p><em>Escherichia coli</em> strain DH10B were made chemically competent following a standard protocol and were used to clone the pSB-AraC-pBAD and pSB-LacI-pLAC elements. Additionally, High Efficiency chemically competent DH10B <em>Escherichia coli</em> were purchased from New England Biolabs for assembly of the Acs cellulose-producing operon, which was codon-optimized for expression in E.coli and synthesized by GeneArt. Both strains were grown overnight in liquid cultures (supplemented with specific antibiotics), or on semi-solid LB-Agar plates, provided with the specific antibiotic, as listed on the table below.</p><br />
<br />
<p>Luria Broth Miller (LB) and LB Agar were purchased from VWR, prepared using standard protocols and used throughout the experimental procedure. During characterization, Acs-containing strains were supplemented with 1% D-glucose, 0.1% Arabinose and 0.5mM IPTG.<br />
</p><br />
<br />
<figure class="content-image"><br />
<table class="tg image-full"><br />
<tr><br />
<th class="tg-e3zv">Plasmid name</th><br />
<th class="tg-e3zv">Vector backbone</th><br />
<th class="tg-e3zv">Antibiotic concentration (ug/ml)</th><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AraC-pBAD</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-LacI-pLAC</td><br />
<td class="tg-031e">pSB3K3</td><br />
<td class="tg-031e">Kanamycin 25</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AcsAB</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AcsCD</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AraC-pBAD-AcsAB</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-LacI-pLAC-CD</td><br />
<td class="tg-031e">pSB3K3</td><br />
<td class="tg-031e">Kanamycin 25</td><br />
</tr><br />
</table><br />
<figcaption>Figure 6: List of antibiotics used, in relation to their respective constructs</figcaption><br />
</figure><br />
<br />
</div><br />
<h3>2.0 Chemicals </h3><br />
<div><br />
<p>Congo Red was purchased from Sigma Aldrich (Steiheim, Germany) and diluted in 1x PBS to a concentration of 350 uM. The final Congo Red concentration used during system characterization steps was 20 uM. This was also used, also at a concentration of 20 uM, to make LB Agar Congo Red Assay plates.</p><br />
</div><br />
<h3>3.0 Construct Assembly</h3><br />
<div><br />
<h4>3.1 Cloning of pSB-AraC-pBAD</h4><br />
<div><br />
<p>The AraC and pBAD elements were obtained by PCR, using the Biobricks BBa_K325108, BBa_K325218 and BBa_K325219 as DNA templates, all of which follow the standard structure showed on figure 7. The primers used during this procedure were as follows:<br />
</p><br />
<ul><br />
<li>Forward: TACTAGTAGCGGCCGCTGCAG</li><br />
<li>Reverse: GCTAGCCCAAAAAAACGGGTATGGAG</li><br />
</ul><br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/d/d4/IC14-ecoli-AraC-pBAD.png"><br />
<figcaption>Figure 7 - Plasmid maps describing both the original (left) and engineered (right) AraC-pBAD-containing parts, including all relevant elements. These were designed and cloned in silico on GeneDesigner.</figcaption><br />
</figure><br />
</div><br />
<p>The amplified elements were DpnI-treated following a standard procedure (New England Biolabs), and were subsequently submitted to a purification step (Qiaquick PCR clean up, Qiagen) prior to self-ligation. Three different template concentrations were tested during ligation (specifically 3 ng, 7.5 ng and 15 ng), and were incubated at room temperature for 1h+. The ligation mix was then transformed into chemically competent DH10B Escherichia coli using a standard chemical transformation protocol and plated out on Chloramphenicol-specific LB plates.</p><br />
<h4>3.2 Cloning of pSB3K3-LacI-pLAC</h4><br />
<p>A compatible plasmid and induction system was cloned to allow expression of the operon in two parts. The medium/strong promoter J23110 was cloned in front of the quad part inverter Q01121. The inverter has an RBS, the LacI repressor followed by a double terminator then a Lac inducible promoter. The composite part created give constitutive expression of the Lac repressor allowing for induction by IPTG. The parts were then moved into the pSB3k3 backbone to be compatible with pSB1C3.</p><br />
<div><br />
<br />
</div><br />
<h4>3.3 Assembly of AcsAB and AcsCD </h4><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/3/3c/IC14-ecoli-construct-assembly.jpg"><br />
<figcaption>Figure 8:</figcaption><br />
</figure><br />
<p>The AcsABCD operon was designed in silico as described in the previous section. It was ordered for synthesis at GenArt in the form of four separate elements of similar sizes, named AcsA, AcsB, AcsC and AcsD, respectively. After synthesis, the constructs were directly transformed into DH10B <em>E.coli</em> using a standard chemical transformation protocol and plated overnight supplied with 50 ug/ml Kanamycin. 5ml LB were inoculated with a freshly growing colony and grown overnight at 37 C, under shaking conditions. Glycerol stocks were produced prior to proceeding with the assembly process.</p><br />
<p>In order to meet the Registry standards, we aimed to clone these elements into pSB1C3. To do so, we proceeded as described on figure 8. Two separate rounds of digestion were carried out using EcoRI, NcoI, PvuII and PstI to, and the resulting fragments (AcsA, AcsB, AcsC and AcsD and linearized pSB1C3) were submitted to a three-part ligation after dephosphorylation of the vector backbone (rAPid desphosphorylation, Roche). An equimolar ratio amongst all three parts was established during the ligation procedure, which in turn proceeded at 4 degrees overnight. The NEB High Efficiency Transformation protocol was used on NEB 10B cells (New England Biolabs) to propagate the resulting plasmid. Transformed cells were plated and incubated overnight at 37 C. 5 ml LB supplied with 50 ug/ml Chloramphenicol were inoculated with a selection of colonies for further analysis (refer to Results for additional information).</p><br />
<br />
<h4>3.4 Assembly of pSB-AraC-pBAD-AcsAB</h4><br />
<p>AcsAB was cloned into pSB-AraC-pBAD by Biobrick cloning. The destination vector was linearized using SpeI and PstI (New England Biolabs), and AcsAB (previously digested with XbaI and PstI, and gel extracted using the Minelute Gel Extraction Kit, by Qiagen) was ligated at a 1:1 ratio throughout an overnight ligation at room temperature. The resulting part was transformed into chemically competent DH10B Escherichia coli and plated on LB Agar+Chloramphenicol plates, grown overnight at 37 C. 5 ml LB falcons supplied with 50 ug/ml Chloramphenicol were inoculated with a selection of freshly grown colonies for further restriction analysis (refer to Results for additional information)</p><br />
<br />
<h4>3.5 Assembly of pSB-LacI-pLAC-CD</h4><br />
<p>Similarly to 3.4, AcsCD was cloned by BioBrick cloning into the pSB3K3 low copy expression vector containing the LacI-pLAC regulatory elements. Vector and insert were ligated at a 1:1 ratio overnight at room temperature. After transformation and plating on LB Agar+Kanamycin (25 ug/ml), colonies were screened by Greentaq colony PCR, and were further confirmed during the Congo Red Assay.</p><br />
</div><br />
<h3>Electroporation of pSB-pLAC-CD into electrocompetent AcsAB-containing DH10B cells</h3> <br />
<div><br />
<p>DH10B E.coli already containing the AcsAB construct were made electrocompetent using a standard protocol, which can be found in the Protocols section. A second round of transformation was carried out to insert pLAC-AcsCD. 5ul of miniprepped pSB-pLAC-CD (diluted in ddH2O) were added into 50ul electrocompetent DH10B cells already containing the pBAD-inducible AcsAB element. Electroporation was carried out in in 10mm electrocuvettes at 1.8 kV, 200 Ohm resistance and 25 mF capacitance. 500ul SOC medium was added to the electroporated samples and these were recovered at 37 °C for 1h before plating on Kanamycin25 + Chloramphenicol 50 LB Agar plates.</p><br />
</div><br />
<h3>Congo Red Characterization</h3><br />
<div><br />
<p>LB Agar Congo Red assay plates were prepared with a final Congo Red concentration of 20uM, and they were supplied with 0.1% Arabinose, 0.5mM IPTG, 50 ug/mL Chloramphenicol, 25 ug/mL Kanamycin and 1% Glucose. Transformed cells containing both AcsAB and AcsCD were plated on Congo Red assay plates and incubated at 37 °C. They were qualitatively assayed after 24h and 48h for cellulose production. Finally, 5 mL LB supplied with 0.1% Arabinose, 0.5mM IPTG, 50 ug/mL Chloramphenicol, 25 ug/mL Kanamycin and 1% Glucose were inoculated with freshly grown, cellulose-producing colonies and were grown for 16h at 30 °C, 180 rpm. An empty vector control was also grown overnight for comparative analysis. These liquid cultues were supplied with Congo Red, to yield a final concentration of 20uM. They were incubated under static conditions for 2h at room temperature, and were later pelleted down to allow for qualitative analysis of Congo Red binding.</p><br />
<br />
<p>AcsAB functionality was assayed by inducing AcsAB-containing cells with 0.1% Arabinose in 5mL LB supplied with 1% Glucose and Chloramphenicol. Overnight incubations were set up at 30 °C and 37 °C, and both empty vector controls and un-induced controls were also assayed. Cells were pelleted at 4000rpm for 10 minutes and the supernatant was kept for further analysis. Cells were resuspended in 1xPBS and sonicated for 3 minutes as on/off cycles of 15 seconds. Both the membrane and soluble samples produced after centrifugation were kept for further analysis. Congo Red was then added to the LB, soluble and membrane samples up to a final concentration of 20uM, and no Congo Red samples were also kept for further inspection. Samples were incubated for 2h at static conditions and at room temperature to allow for Congo Red binding. 96-well plates were inoculated for further absorbance measurements at 490nm.</p><br />
</div><br />
<br />
<br />
</div><br />
</section><br />
<br />
<br />
<section id="results"><br />
<h2>Results</h2><br />
<div class="accordion"><br />
<h3>Constructs</h3><br />
<div><br />
<p>All constructs were assembled as described in Materials and Methods. As a preliminary verification step, restriction analyses were carried out using the corresponding restriction enzymes (refer to figure legends for more details) and results were visualized on 0.7-1% agarose gels. Final confirmation was obtained by gene sequencing, during which the BioBrick Verification Primers and walking primers were used. These are shown on the table below, please refer to the Registry for further information.</p><br />
<br />
<figure class="content-image"><br />
<table class="tg image-full"><br />
<tr><br />
<th </th><br />
<th </th><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AraC-pBAD</td><br />
<td class="tg-031e">Forward: TACTAGTAGCGGCCGCTGCAG<br />
<br>Reverse: GCTAGCCCAAAAAAACGGGTATGGAG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">BioBrick Verification Primers</td><br />
<td class="tg-031e">Forward: TGCCACCTGACGTCTAAGAA<br />
<br>Reverse: ATTACCGCCTTTGAGTGAGC</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 1</td><br />
<td class="tg-031e">TCT GAA TTA TGC CAT TGG TCA TAC CG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 2</td><br />
<td class="tg-031e">ATA TGT TTC ATG CAG TTG GCA CC</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 3</td><br />
<td class="tg-031e">GAT GCA TGG GTT GAT TGG GG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 4</td><br />
<td class="tg-031e">ATC CAG CAC ATC CGA CCT TTG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 5</td><br />
<td class="tg-031e">GTT ACC GCA AGT AAA CTG CAA G</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 6</td><br />
<td class="tg-031e">GAT GGT CTG ATT CGT CTG GTT A</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 7</td><br />
<td class="tg-031e">ACG CAG CAC AGG TCA GAC CGG TGA A</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 8</td><br />
<td class="tg-031e">ATA TTG ATC TGA CCA CCG AACA</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 9</td><br />
<td class="tg-031e">TGC ACC GCC TGG TGA AAA TGG TT</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 10</td><br />
<td class="tg-031e">GTG GCT ATG CAA TTC AGA CAG GT</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 11</td><br />
<td class="tg-031e">TTC ATT CCC AGC GGT CGG TCG AT</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 12</td><br />
<td class="tg-031e">GTT TGC GTG GTG ATC TTT TT</td><br />
</tr><br />
</table><br />
<figcaption>Figure 9 - List of primers used by Team E.coli during the experimental procedure</figcaption><br />
</figure><br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/f/f8/IC14-ecoli-gel-pSB-AcsAB.jpg"><br />
<figcaption>Figure 10: Restriction Analysis results of AcsAB. Samples were submitted to an XbaI/PstI double digest, which flank the AcsAB construct. Two bands were displayed as expected: a ~5kb band corresponding to the AcsAB insert, and a ~2kb band corresponding to the pSB1C3 vector backbone. </figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/c/c1/IC14-ecoli-gel-pSB-AcsCD.jpg"><br />
<figcaption>Figure 11: Restriction analysis results of AcsCD. Samples were submitted to an XbaI/SpeI double restriction. Positive samples displayed a 4.4kb band corresponding to the AcsCD insert, in addition to a 2kb band that corresponded to the pSB1C3 plasmid backbone. </figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/b/b9/IC14-ecoli-gel-pSB-AraC-pBAD.jpg"><br />
<figcaption>Figure 12: Restriction Analysis results of AraC-pBAD. Samples were submitted to an XbaI/PstI double digest. A 2-band pattern was obtained, indicating the presence of a ~2kb DNA fragment corresponding to the pSB1C3 vector backbone, and a ~1kb fragment corresponding to the AraC and pBAD elements being cloned. </figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/e/e7/IC14-ecoli-gel-pSB-AraC-pBAD-AcsAB-pSB-LacI-AcsAB.jpg"><br />
<figcaption>Figure 13: Restriction Analysis results of AraC-pBAD. Samples were submitted to an XbaI/PstI double digest. A 2-band pattern was obtained, indicating the presence of a ~2kb DNA fragment corresponding to the pSB1C3 vector backbone, and a ~1kb fragment corresponding to the AraC and pBAD elements being cloned. </figcaption><br />
</figure><br />
</div><br />
<br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/4/4a/IC14-ecoli-gel-colony1.jpg"><br />
<figcaption>Figure 14: pLAC-AcsCD colony PCR results. Further details on the procedure can be found on the Methods and Materials section. Those colonies that we testes further have been highlighted with numbers on the pictures. Specifically, colony A1 was used for subcloning into AcsAB containing E.coli DH10B. <br />
Plates A and B were generated <br />
</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/1/10/IC14-ecoli-gel-colony2.jpg"><br />
<figcaption>Figure 15: pLAC-AcsCD colony PCR results. Further details on the procedure can be found on the Methods and Materials section. Those colonies that we testes further have been highlighted with numbers on the pictures. Specifically, colony A1 was used for subcloning into AcsAB containing E.coli DH10B. <br />
Plates A and B were generated <br />
</figcaption><br />
</figure><br />
</div><br />
</div><br />
<br />
<br />
<br />
</div><br />
<h3>Characterising Cellulose Production</h3><br />
<div><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/f/fe/IC14-ecoli-fig2.png"><br />
<figcaption>Figure 16:</figcaption><br />
</figure><br />
<p>Cellulose Production can be easily assayed using the diazo dye Congo Red. Congo Red specifically binds cellulostic fibrils, and this binding can be measured by spectral analysis, because it causes a shift on the spectral properties of the dye, which can be monitored with a spectrophotometer (Klunk et al., 1999). In addition to this, Congo Red also allows for visual, qualitative analysis: it causes a color change of any cellulose-producing colonies by binding to the growing fibres. Therefore, cellulose production can be easily detected by eye on LB Agar plates and liquid cultures.</p><br />
<br />
<p>We assayed cellulose production on LB Agar Congo Red assay plates. Colonies containing the refactored cellulose production machinery turned red within 24h, and presented a rougher composition and brighter red color after 48h. In contrast to this, colonies presenting empty vector (negative controls), presented no color changes and maintained the characteristics of standard <em>Escherichia coli</em> colonies (smoother composition and standard yellow colour).</p><br />
<br />
<p>To confirm this qualitative assay, a second qualitative assay was carried out, also based on Congo Red binding. This second analysis consisted of incubating overnight cultures (both cellulose producers and empty vector controls) with Congo Red as described in Materials and Methods. Cellulose producers will present growing cellulose fibres on their extracellular surface, hence will dye red in the presence of Congo Red, unlike non-cellulose-producing cells. After spinning down the cells, a red pellet was observed that corresponded to the cellulose producing colonies. In contrast to this, negative controls did not bind Congo Red and hence maintained the standard E.coli characteristics. We consider that this qualitative data supports our design and confirms that the cellulose production operon has been successfully refactored and transferred into <em>Escherichia coli</em>.</p><br />
<br />
<p>In order to gain a better understanding of the activity of the Acs elements in Escherichia coli, it was of interest to explore whether the AcsAB element alone would be enough to achieve cellulose production. AcsAB is embedded in the cytoplasmic membrane and transports the growing polymer through the membrane as it attaches the glucose monomers in the cytoplasm. In the absence of AcsC and AcsD, no cellulose can be secreted into the environment and as a result, it was assumed that it would instead become accumulated in the cell’s periplasm. For this reason, during characterization we required sonication in order to get the cellulose (if any at all) out of the cells.</p><br />
<br />
<p>To widen our screening, we set up induced samples and uninduced controls and assayed samples at different temperatures (30°C versus 37°C) and different conditions (shaking versus static) in the presence or absence of 1% D-Glucose. Furthermore, 2 Biological replicates were assayed, and technical triplicates were also set up during plate reading to support any statistically relevant findings. Although we expected no cellulose to be accumulating in the medium, we still analysed all fractions originating throughout the procedure: LB fractions, soluble fractions and non-soluble fractions (called membrane fractions throughout this study).</p><br />
<br />
<p>All fractions were incubated in the presence of Congo Red (as described in Materials and Methods) and were later inoculated into a 96-well plate for absorbance measurements at 490nm. Free Congo Red has a maximal absorption at such wavelength. By setting up a control sample, containing solvent (PBS)+ Congo Red, it is possible to measure the total absorbance of the molecule whilst free in solution. When cellulolytic samples are incubated in the presence of Congo Red, less azodye molecules becomes available in the medium due to binding, hence absorbance levels will decrease. The total Congo Red bound will equal the absorbance of Congo Red Control minus the absorbance of our samples of interest. This approach gives you an idea of the amount of Congo Red that may have bound to the cellulositic fibres, but it does not provide exact values of cellulose present.</p><br />
<br />
<figure class="content-image image-half"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/7/76/IC14-congo.png"><br />
<figcaption>Figure 17: LB fraction - Congo Red Binding</figcaption><br />
</figure><br />
<p>As expected, LB fractions all presented similar, non-cellulolytic composition and hence displayed no changes in absorbance, indicating no CR binding. </p><br />
<figure class="content-image image-half"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/b/bb/IC14-Membrane_fraction.png"><br />
<figcaption>Figure 18: Membrane Fraction - Induction of the pBAD-AcsAB</figcaption><br />
</figure><br />
<p>It was observed that interestingly, membrane fractions that had been previously incubated at 30 C presented a dramatic change in Congo Red binding. This proves not only that the AcsAB is active (at least to some extent) in the absence of AcsC and AcsD, but also that it may be optimal for the cellulose synthase to be folded and functional at lower temperatures, as it occurs in the native host G.xylinus. </p><br />
<br />
</div><br />
<br />
<br />
</section><br />
<section id="future"><br />
<h2>Future Work</h2><br />
<br />
</section><br />
<br />
<section id="references"><br />
<h2>References</h2><br />
<ol><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<br />
<br />
<br />
<br />
<br />
</ol><br />
</section><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
<br />
{{:Team:Imperial/Templates:footer}}</div>HChughtaihttp://2014.igem.org/File:IC14-Membrane_fraction.pngFile:IC14-Membrane fraction.png2014-10-18T03:37:57Z<p>HChughtai: </p>
<hr />
<div></div>HChughtaihttp://2014.igem.org/File:IC14-congo.pngFile:IC14-congo.png2014-10-18T03:37:19Z<p>HChughtai: </p>
<hr />
<div></div>HChughtaihttp://2014.igem.org/Team:Imperial/ResultsTeam:Imperial/Results2014-10-18T03:30:50Z<p>HChughtai: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Results</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#overview">Overview</a><br />
</li><br />
<li><a data-scroll href="#result1">G. xylinus</a><br />
</li><br />
<li><a data-scroll href="#result2">RESULT 2</a><br />
</li><br />
<li><a data-scroll href="#result3">RESULT 3</a><br />
</li><br />
<li><a data-scroll href="#result4">RESULT 4</a><br />
</li><br />
<li><a data-scroll href="#result5">RESULT 5</a><br />
</li><br />
<br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<section id="overview"><br />
<h2>Overview</h2><br />
<ul><br />
<li>Sequenced the previously unknown genomes of <em>G. xylinus</em> ATCC 53582 and <em>G. xylinus</em> igem strains - the first genomes sequenced in the history of iGEM </li><br />
<li>Developed a set of new and improved protocols for synthetic biology in <em>G. xylinus</em></li><br />
</ul><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
</section><br />
<section id="result1"><br />
<h2>G.xylinus</h2><br />
<h3>Overview</h3><br />
<p>Bacterial cellulose has great potential in many areas, including water purification, tissue scaffolds, wound dressings, etc., however, until now, all bacterial cellulose-based materials have been created using chemical or physical post-production processing, not genetic engineering. This is due to the lack of well-developed tools and methods for Gluconacetobacter genetic engineering, as well as the lack of genome sequence of the highest cellulose-producing strain ATCC 53582. We have overcome the numerous difficulties associated with G.xylinus genetic engineering, and turned G.xylinus KI and ATCC 53852 strains into new platforms for the production of cellulose-based biomaterials by sequencing the genomes of ATCC 53582 and KI, creating a genetic toolbox of consisting of five new plasmid backbones and around 40 widely used genes, and developing a set of new and improved protocols for G.xylinus genetic engineering.</p><br />
<h3>Key Achievements</h3><br />
<ul><br />
<li>Isolated a new strain of <em>Gluconacetobacter</em> (named <em>G. xylinus</em> igem) from Kombucha tea and characterized its properties fully.</li><br />
<li>Sequenced the previously unknown genomes of <em>G. xylinus</em> ATCC 53582 and <em>G. xylinus</em> igem strains - the first genomes sequenced in the history of iGEM </li><br />
<li>Discovered four new plasmids capable of replication in <em>Gluconacetobacter</em> species - pSEVA321, pSEVA331, pSEVA351 and pBAV1K, which replicate both in <em>G. xylinus</em> ATCC 53582 and igem strains as well as in <em>E. coli</em></li><br />
<li>Were the first in science to create transgenic cells of <em>G.xylinus</em> igem strain </li><br />
<li>Using our discovered plasmids, created a genetic toolbox consisting of 40 genes for <em>G. xylinus</em> engineering and expressed them in the ATCC 53582 and igem</li> <br />
<br />
<li>Developed a set of new and improved protocols for efficient genetic engineering of <em>G. xylinus</em></li><br />
<li>In summary, turned <em>G. xylinus</em> ATCC 53582 and igem strains into new model organisms and developed the necessary tools to create a powerful platform for the synthesis of new cellulose-based biomaterials and water filters</li><br />
<br />
<br />
<br />
<br />
<br />
</ul><br />
<br />
</section><br />
<section id="result2"><br />
<h2>E.col</h2><br />
<h3>Overview</h3><br />
<p><em>Escherichia coli</em> is the organism of choice for synthetic biology. It is thoroughly characterised, easy to engineer and has numerous parts, control circuits and complex constructs tested in this host.</p><br />
<p>Some <em>E. coli</em> strains have evolved to produce low amounts of cellulose but the machinery under specific regulatory control (its secretion is generally linked to biofilm formation and stress situations). In order to expand the use of bacterial cellulose as a functional biomaterial that is cost effective to produce, it is desirable for its production machinery to be implemented in an organisms that is easy to engineer and has proven success in large scale bioreactors.</p><br />
<p>Here, we confirm that the high output cellulose production machinery of <em>Gluconacetobacter Xylinus</em> can be transferred into other organisms. We have proven function of the Acs cellulose producing operon in <em>Escherichia coli</em> using Congo Red binding assays.<br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Contributed an optimised Asc cellulose production operon to Registry of Standard Parts.</li><br />
<li>Proved the portability of <em>Gluconacetobacter xylinus</em> operon.</li><br />
<li>Assembled a fully synthetic, functional, cellulose-producing system in <em>Escherichia coli</em></li><br />
<li>Demonstrated the synthesis operon in a two plasmid system for separate induction of genes</li><br />
<br />
<br />
</ul><br />
<br />
</section><br />
<section id="result3"><br />
<h2>RFP <em>E. coli</em> and <em>G. xylinus iGEM</em> Co-Culture</h2><br />
<h3>Overview</h3><br />
<p>Based on the hypothesis of <em>E. coli</em> BL21D3 operating anaerobically and <em>G. xylinus</em> replicating aerobically, a co-culture experiment for bacterial cellulose was attempted. Initially, the best possible carbon source among 5 available was found experimentally. This data was used to inform the choice of glycerol and glucose as the carbon feedstock. With these carbon feedstocks, <em>E. coli</em> with RFP expressed were successfully embedded in the bacterial cellulose, and RFP was clearly visible. </p><br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Experimentally determined the optimum carbon feedstocks for a HS media based co-culture of <em>E. coli</em> and <em>G. xylinus</em>. </li><br />
</ul><br />
<br />
</section><br />
<section id="result4"><br />
<h2>Functionalisation</h2><br />
<h3>Overview</h3><br />
<p>Attaching functional proteins to cellulose can expand the properties of cellulose and allow us to selectivity capture specific contaminants in water. By creating fusion proteins of sfGFP and metal-binding proteins with five different cellulose binding domains, three of which are new to the registry, we were able to characterise the relative affinities of the CBDs and show proof-of-concept removal of contaminants from water.</p><br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Added three new cellulose binding domains to the registry</li><br />
<li>Performed an assay with sfGFP-fusions to determine the strongest potential binders which could be carried forward for further testing</li><br />
<li>Identified potential metal binding proteins to bind heavy metals from wastewater, including the addition of a new promising polypeptide phytochelatin EC20</li><br />
<li>Tested metal ion capture ability of the CBD-phytochelatin fusion constructs when attached to cellulose</li><br />
<br />
</ul><br />
<br />
</section><br />
<section id="result5"><br />
<h2>Mechanical Testing</h2><br />
<h3>Overview</h3><br />
<p>To check the feasibility of using our bacterial cellulose as a customisable ultrafiltration membrane, the mechanical properties were tested. For this to work, we checked the tensile strength of our filter, calculated the shear stress and estimated the processing method that produces membrane with the longest life-time. Our ultimate tensile stress calculated matched with literature values of bacterial cellulose within standard deviation, and the data analysis provided the insight to use non-blended cellulose rather than blended..</p><br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Introduced a new aspect to the manufacturing track in terms of quantitatively characterising the mechanical properties of our product, bacterial cellulose<br />
</li><br />
<li>Quantified the tensile stress-strain properties of our bacterial cellulose.<br />
</li><br />
<li>Discovered that our bacterial cellulose can sustain an order of magnitude higher water pressures than those typically used for ultrafiltration membranes.<br />
</li><br />
<li>Established that non-blended compared to blended bacterial cellulose was significantly more ductile, and would have longer life time as a water filter, which informed the choice of cellulose for the final product.<br />
</li><br />
<li>Tested and analysed 20 samples of bacterial cellulose test pieces.<br />
</li><br />
<li>Created a size and quality optimised gif for visualisation of the experiment and written a protocol for future iGEM teams to do the same.<br />
</li><br />
<br />
<br />
<br />
</ul><br />
</section><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>HChughtaihttp://2014.igem.org/Team:Imperial/Resources/JS:teamTeam:Imperial/Resources/JS:team2014-10-18T03:29:37Z<p>HChughtai: </p>
<hr />
<div>$(document).ready(function () {<br />
<br />
$(".overlay").hide();<br />
$(".info-overlay").hide();<br />
//toggle the componenet with class msg_body<br />
$('.member').hover(function () {<br />
$(this).find('.overlay').fadeIn(300);<br />
}, function () {<br />
$(this).find('.overlay').fadeOut(100);<br />
});<br />
<br />
$('.expand').click(function () {<br />
$('.info-overlay').fadeIn(300);<br />
$("#name").html(name);<br />
$("#subject").html(subject);<br />
$("#Q1").html(A1);<br />
$("#Q2").html(A2);<br />
$("#Q3").html(A3);<br />
$("#Q4").html(A4);<br />
$("#Q5").html(A5);<br />
$("#Q6").html(A6);<br />
$("#Q7").html(A7);<br />
$("#Q8").html(A8);<br />
$("#Q9").html(A9);<br />
$("#Q10").html(A10);<br />
<br />
});<br />
<br />
$('.min').click(function () {<br />
$('.info-overlay').fadeOut(300);<br />
});<br />
<br />
$('#xenia').hover(function () {<br />
name = "Xenia Spencer-Milnes"<br />
subject = "Biology with a Year in Industry"<br />
A1 = "Xen";<br />
A2 = "22";<br />
A3 = "Round the corner from a zoo.";<br />
A4 = "Being outside, walking, camping, windsurfing, piano-ing, choir-ing, partying, laughing. Though science can be pretty amusing too.";<br />
A5 = " It inspired me, now I want to do the same for other people, and contribute something to synthetic biology, and the world!";<br />
A6 = "Yes";<br />
A7 = "Depends on how I'm feeling.";<br />
A8 = "Hopefully not too tired. Really want a campervan. And animal friends.";<br />
A9 = "English, a little bit of French";<br />
A10 = "Hocus Pocus - Focus";<br />
<br />
<br />
});<br />
<br />
$('#laura').hover(function () {<br />
name = "Laura De Arroyo Garcia";<br />
subject = "Biotechnology with Management";<br />
A1 = "Laura";<br />
A2 = "21";<br />
A3 = "Canary Islands; a warm, Spanish hotspot near the Moroccan coast.";<br />
A4 = "I enjoy keeping fit and cooking yummy meals! I am also into photography, fashion, travelling, hanging out…. I am just interested in anything interesting really!";<br />
A5 = "You get to learn loads by working with others! On top of that, it also allows you to be creative. Can’t get any better than pioneering Synthetic Biology and also developing a project that can make a difference.";<br />
A6 = "Being pessimistic is great! I prefer preparing for the worst, so if things don’t go as planned I won’t get disappointed. Is this weird?";<br />
A7 = "Hot during the summer, cold during the winter, just right :)";<br />
A8 = "Working on SB for NASA and helping terraform a new galaxy!";<br />
A9 = "Spanish, English, and I also like to say I can speak German";<br />
A10 = "Wasted - Tiësto (Very science-y)";<br />
<br />
});<br />
<br />
$('#haroon').hover(function () {<br />
name = "Haroon Chughtai";<br />
subject = "Biomedical Engineering";<br />
A1 = "Harpoon/Lord Sir Haroon The Mighty";<br />
A2 = "20";<br />
A3 = "London";<br />
A4 = "Dressing up all in white and poking people with swords. Otherwise reading pop-sci and sci-fi.";<br />
A5 = "Definitely didn’t promise someone I’d make them a dragon...";<br />
A6 = "Depends on what you’re measuring.";<br />
A7 = "'Some say the world will end in fire,Some say in ice.'";<br />
A8 = "Science";<br />
A9 = "English";<br />
A10 = "DNA - Miracle of Sound";<br />
<br />
});<br />
<br />
$('#gabi').hover(function () {<br />
name = "Gabriella Santosa"<br />
subject = "Biochemistry with a Year in Industry";<br />
A1 = "Gabi";<br />
A2 = "21.85";<br />
A3 = "Singa-nesia";<br />
A4 = "I can usually be found near an oven, doing a more practical form of science that results in many noms, consistently contributing to the growing waistlines of myself and anyone in a 5 metre radius. I also like my dog and cat a lot. And shopping. And sushi.";<br />
A5 = "Because I wanted to meet great people, work in an exceptional team and because I like to be pushed.";<br />
A6 = "It's always empty. I drink a lot of water.";<br />
A7 = "Incubate at room temperature, please.";<br />
A8 = "In my early 30s and wishing I was 21 again. Maybe being a phone operator :P.";<br />
A9 = "English, Indonesian, French, bits of Mandarin";<br />
A10 = "Habits - Tove Lo";<br />
<br />
});<br />
<br />
$('#chrisl').hover(function () {<br />
name = "Christopher Lazenbatt";<br />
subject = "Biochemistry";<br />
A1 = "The other Chris.";<br />
A2 = "23";<br />
A3 = "A town whose main claims to fame are a magic roundabout and an industrial explosion.";<br />
A4 = "Baking, writing, teaching caterpillars to use Twitter.";<br />
A5 = "For the cold, hard cash.";<br />
A6 = "Doesn’t matter either way.";<br />
A7 = "There’s no such thing as ‘hot’ or ‘cold’, just ‘too hot’ and ‘too cold’.";<br />
A8 = "Wondering when the postdocs will end.";<br />
A9 = "English.";<br />
A10 = "Any and all of Susumu Hirasawa’s work.";<br />
<br />
});<br />
<br />
$('#deze').hover(function () {<br />
name = "Deze Kong";<br />
subject = "Biomedical Engineering";<br />
<br />
A1 = "Dory";<br />
A2 = "Almost 20";<br />
A3 = "Beijing, China";<br />
A4 = "Ice-skating, badminton, perhaps also stupify myself with some cooking inventions...?";<br />
A5 = "It’s great to work with an accomplished team where you never stop refreshing yourself. The cool thing about iGEM is that it is not solely about science, but also about people, society and the whole network upon which science flourishes.";<br />
A6 = "It depends.";<br />
A7 = "About room temperature.";<br />
A8 = "Hard question. But I always wanted to be a traveller and build a jungle tree house of my own. Plus live a self-contained ecolife, i.e. be a farmer.";<br />
A9 = "Mandarin, English, survival Japanese, and very little French.";<br />
A10 = "Beethoven <em>Pathetique</em> 2nd movement, a constant companion to coding.";<br />
<br />
});<br />
<br />
$('#des').hover(function () {<br />
name = "Despoina Paschou";<br />
subject = "Biomedical Engineering";<br />
<br />
A1 = "I'm not that cool yet...";<br />
A2 = "22 and counting";<br />
A3 = "Preveza, Greece. Small, relatively unknown peninsula town resting between a gulf and the open sea. Home to the best giant prawns and mullet fish you’ll ever have and the friendliest dolphins you’ll ever meet.";<br />
A4 = "Quoting Mean Girls. Trying to discover the best burger in Europe. Trying to match my mum’s cooking abilities. Watching movies and learning about cinema in general. Reading books in random cafes around London. Urban exploring.";<br />
A5 = "Because I really wanted to work on a big scale SynBio project with a potential life outside of the lab. I also wanted to work in a team with likeminded people in order to create something awesome.";<br />
A6 = "It’s broken; I’m too clumsy.";<br />
A7 = "As long as I’m wearing the right clothes, either works.";<br />
A8 = "Either inheriting my family’s takeaway or becoming a magician’s assistant. My Hogwarts acceptance letter should have arrived by then too. I also hope to have met Kanye.";<br />
A9 = "In order of fluency: Greek, English, German. I can also understand a bit of Italian and Slovak.";<br />
A10 = "Cornerstone - Arctic Monkeys";<br />
<br />
});<br />
<br />
$('#chrism').hover(function () {<br />
name = "Chris Micklem";<br />
subject = "Biology";<br />
<br />
A1 = "The other Chris";<br />
A2 = "Just turned 20";<br />
A3 = "Cambridge, Cambridgeshire";<br />
A4 = "Sleeping, eating, climbing, listening to music, tapping rhythmically on surfaces and going to festivals.";<br />
A5 = "It's an incredible opportunity to have fun learning so much with such an amazing group of people! Also it's the 10th anniversary, what better time to do it?";<br />
A6 = "N/A; my glass never drops below three quarters.";<br />
A7 = "To tackle this age-old question I have been dedicating my knowledge to develop a radical new temperature, using both hot and cold elements, which I have dubbed “hold”.";<br />
A8 = "Living in a house lit solely by the bioluminescent plants I engineered.";<br />
A9 = "English, Japanese, a bit of French.";<br />
A10 = "Days to Come - Bonobo";<br />
<br />
});<br />
<br />
$('#michael').hover(function () {<br />
name = "Michael Florea";<br />
subject = "Biology";<br />
<br />
A1 = "Michael";<br />
A2 = "Lost count after the 18th.";<br />
A3 = "Estonia";<br />
A4 = "Aside from science?";<br />
A5 = "To do something great.";<br />
A6 = "I am not satisfied with semantics: if need be, I’ll get more water and have a glass that is totally full.";<br />
A7 = "Cold, of course. -80 °C.";<br />
A8 = "Good question, ask me in 10 years.";<br />
A9 = "Estonian and English. Could also survive in Germany, Russia and Japan.";<br />
A10 = "4'33'' - John Cage";<br />
<br />
});<br />
<br />
<br />
});</div>HChughtaihttp://2014.igem.org/Team:Imperial/EColiTeam:Imperial/EColi2014-10-18T03:26:18Z<p>HChughtai: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1><em>E. coli</em></h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#introduction">Introduction</a><br />
</li><br />
<li><a data-scroll href="#aim">Aims</a><br />
</li><br />
<li><a data-scroll href="#engineering">Engineering</a><br />
</li><br />
<li><a data-scroll href="#methods">Materials and Methods</a><br />
</li><br />
<br />
<li><a data-scroll href="#results">Results</a><br />
</li><br />
<li><a data-scroll href="#future">Future Work</a><br />
</li><br />
<li><a data-scroll href="#references">References</a><br />
</li><br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p><em>Escherichia coli</em> is the organism of choice for synthetic biology. It is thoroughly characterised, easy to engineer and has numerous parts, control circuits and complex constructs tested in this host.</p><br />
<p>Some <em>E. coli</em> strains have evolved to produce low amounts of cellulose but the machinery under specific regulatory control (its secretion is generally linked to biofilm formation and stress situations). In order to expand the use of bacterial cellulose as a functional biomaterial that is cost effective to produce, it is desirable for its production machinery to be implemented in an organisms that is easy to engineer and has proven success in large scale bioreactors.</p><br />
<p>Here, we confirm that the high output cellulose production machinery of <em>Gluconacetobacter Xylinus</em> can be transferred into other organisms. We have proven function of the Acs cellulose producing operon in <em>Escherichia coli</em> using Congo Red binding assays.<br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>Key Achievements </h2><br />
<ul><br />
<li>Contributed an optimised Asc cellulose production operon to Registry of Standard Parts.</li><br />
<li>Proved the portability of <em>Gluconacetobacter xylinus</em> operon.</li><br />
<li>Assembled a fully synthetic, functional, cellulose-producing system in <em>Escherichia coli</em></li><br />
<li>Demonstrated the synthesis operon in a two plasmid system for separate induction of genes</li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<br />
<br/><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<figure class="content-image image-full"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/2/20/IC14-ecoli-fig1.jpg"><br />
<figcaption>Figures 1 & 2: Congo red staining of microbial cellulose in <em>E. coli</em></figcaption><br />
</figure><br />
</div><br />
<br />
<br />
<div class="pure-u-1-2"><br />
<figure class="content-image image-full"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/a/ad/IC14-ecoli-fig3.jpg"><br />
<figcaption></figcaption><br />
</figure><br />
</div><br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<section id="Aims"><br />
<h2>Aims</h2><br />
<br />
<p>By transferring the cellulose production operon from its native organism <em>Gluconacetobacter xylinus</em> into the lab and industrially friendly host <em>Escherichia coli</em>, we aim to improve cellulose production per unit time to achieve more cost effective pellicle growth and to encourage further synthetic biology with microbial cellulose. <em>E. coli</em> grows considerably faster plus tolerates higher temperatures and more vigorous aeration. The ease of genetic engineering and the wealth of other characterized Biobricks increases the potential for exciting future projects</p><br />
<br />
<br />
</section><br />
<section id="engineering"><br />
<h2>Engineering</h2><br />
<p>The cellulose production operon in <em>Gluconacetobacter xylinus</em> is a 10kb genomic region, consisting of four main elements:</p><br />
<ul><br />
<li>acsAB, known as cellulose synthase, is made up of two domains: acsA being the catalytic domain, and acsB being the cyclic-di-GMP-binding domain. This modular enzyme requires the second messenger cyclic-di-GMP in order to carry out efficient catalysis.</li><br />
<li>acsC codes for an oligomeric element that gets embedded in the extracellular membrane and allows transport of the growing polymer across the cell membrane into the extracellular environment.</li><br />
<li>acsD is believed to be a non-essential element, although it is a key player in the control of cellulose crystallinity and required for maximal cellulose productivity.</li><br />
</ul><br />
<p>The native operon is highly regulated at transcriptional, translational and post-translational levels. Cellulose production responds to a wide set of internal signals and environmental cues. The native ribosomal binding sites (RBS) are predicted to be weak by translation rate calculators (The <a href="https://salis.psu.edu/software/"> Salis Lab RBS calculator </a> and <a href="http://sbi.postech.ac.kr/utr_designer"> Postech UTR designer </a>). This is perhaps to reduce noise in gene expression (strong promoter, weak RBS is less noisy that weak promoter strong RBS). The promoter region has not yet been characterized in <em>Gluconacetobacter xylinus</em>, however.</p><br />
<br />
<p>The first step of our computational design engineering was to identify the coding sequences and extract them from NCBI. We removed some native regulation by codon-optimizing the sequences for expression in <em>E.coli</em> and replaced the native RBS’s with the strong B0034 sequence. The 6 base pairs either side of the B0034 RBS were edited with the Salis Lab RBS calculator design function to tune RBS strength output to better preserve the natural stoichiometry.</p><br />
<br />
<p>Finally, in order to allow for even more customizable fine-tuning of the system, the operon was divided and cloned into two separate expression vectors: the AcsAB element was cloned under the control of the inducible pBAD promoter contained within pSB1C3, a high copy plasmid that would contribute to higher expression of Cellulose Synthase. Alternatively, AcsC and AcsD, believed to be expressed at lower levels in <em>G.xylinus</em>, was put under the control of the pLAC promoter and was transferred into a low copy plasmid, pSB3K3 so as to maintain lower levels of expression. This approach provided the following advantages:</p><br />
<ul><br />
<li>Reducing the size of the final expression vector avoids complications during assembly and vector take-up, and it also prevents a large construct from becoming a burden for cell growth and vector propagation.</li><br />
<li>By expressing the cellulose production machinery from two separate expression vectors, the following levels of control become available to us: the first being the changes in vector copy number, which directly affects gene expression levels throughout induction, and the second being the ability to activate the system using two different inducers. These key features of our system allow for a larger scope for fine-tuning and optimization of cellulose production levels.</li><br />
<br />
</ul><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/5/55/IC14-ecoli-pBAD-pLAC-CD.png"><br />
<figcaption>Figure 3: pSB-pBAD-AB and pLAC-CD</figcaption><br />
</figure><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/e/e7/IC14-ecoli-ABCDfragments.jpg.png"><br />
<figcaption>Figure 4: acsABCD fragments</figcaption><br />
</figure><br />
<p>With this approach, we allow for our system to be implemented in new range of hosts because a larger set of growth conditions, inducer concentrations and growth phases can be tested in order to achieve the required stoichiometry for the system to become functional.</p><br />
<br />
<br />
<p>In order to ease synthesis, the operon sequence was split into 4 fragments of similar sizes. We took advantage of the presence of two restriction sites: An NcoI present within the AcsAB sequence, and a PvuII site contained within AcsC. Furthermore, the BioBrick prefix and suffix were included and any additional sites removed elsewhere.</p><br />
<br />
<p>By standard cloning, these fragments could easily be put together to yield the following constructs:</p><br />
<figure class="content-image image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/f/ff/IC14-ecoli-AB-CD-constructs.png"><br />
<figcaption>Figure 5: acsAB and acsCD constructs</figcaption><br />
</figure><br />
<br />
<p>Gene Designer served as a very useful tool for assembling constructs and predicting cloning outcomes before proceeding with the experimental procedure. Find above the plasmid maps of our resulting constructs, and refer to Materials and Methods for a deeper insight into the assembly process.</p><br />
<br />
</section><br />
<section id="methods"><br />
<h2>Materials and Methods</h2><br />
<div class="accordion"><br />
<h3>1.0 Cell Strains and Media Components</h3><br />
<div><br />
<p><em>Escherichia coli</em> strain DH10B were made chemically competent following a standard protocol and were used to clone the pSB-AraC-pBAD and pSB-LacI-pLAC elements. Additionally, High Efficiency chemically competent DH10B <em>Escherichia coli</em> were purchased from New England Biolabs for assembly of the Acs cellulose-producing operon, which was codon-optimized for expression in E.coli and synthesized by GeneArt. Both strains were grown overnight in liquid cultures (supplemented with specific antibiotics), or on semi-solid LB-Agar plates, provided with the specific antibiotic, as listed on the table below.</p><br />
<br />
<p>Luria Broth Miller (LB) and LB Agar were purchased from VWR, prepared using standard protocols and used throughout the experimental procedure. During characterization, Acs-containing strains were supplemented with 1% D-glucose, 0.1% Arabinose and 0.5mM IPTG.<br />
</p><br />
<br />
<figure class="content-image"><br />
<table class="tg image-full"><br />
<tr><br />
<th class="tg-e3zv">Plasmid name</th><br />
<th class="tg-e3zv">Vector backbone</th><br />
<th class="tg-e3zv">Antibiotic concentration (ug/ml)</th><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AraC-pBAD</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-LacI-pLAC</td><br />
<td class="tg-031e">pSB3K3</td><br />
<td class="tg-031e">Kanamycin 25</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AcsAB</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AcsCD</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AraC-pBAD-AcsAB</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-LacI-pLAC-CD</td><br />
<td class="tg-031e">pSB3K3</td><br />
<td class="tg-031e">Kanamycin 25</td><br />
</tr><br />
</table><br />
<figcaption>Figure 6: List of antibiotics used, in relation to their respective constructs</figcaption><br />
</figure><br />
<br />
</div><br />
<h3>2.0 Chemicals </h3><br />
<div><br />
<p>Congo Red was purchased from Sigma Aldrich (Steiheim, Germany) and diluted in 1x PBS to a concentration of 350 uM. The final Congo Red concentration used during system characterization steps was 20 uM. This was also used, also at a concentration of 20 uM, to make LB Agar Congo Red Assay plates.</p><br />
</div><br />
<h3>3.0 Construct Assembly</h3><br />
<div><br />
<h4>3.1 Cloning of pSB-AraC-pBAD</h4><br />
<div><br />
<p>The AraC and pBAD elements were obtained by PCR, using the Biobricks BBa_K325108, BBa_K325218 and BBa_K325219 as DNA templates, all of which follow the standard structure showed on figure 7. The primers used during this procedure were as follows:<br />
</p><br />
<ul><br />
<li>Forward: TACTAGTAGCGGCCGCTGCAG</li><br />
<li>Reverse: GCTAGCCCAAAAAAACGGGTATGGAG</li><br />
</ul><br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/d/d4/IC14-ecoli-AraC-pBAD.png"><br />
<figcaption>Figure 7 - Plasmid maps describing both the original (left) and engineered (right) AraC-pBAD-containing parts, including all relevant elements. These were designed and cloned in silico on GeneDesigner.</figcaption><br />
</figure><br />
</div><br />
<p>The amplified elements were DpnI-treated following a standard procedure (New England Biolabs), and were subsequently submitted to a purification step (Qiaquick PCR clean up, Qiagen) prior to self-ligation. Three different template concentrations were tested during ligation (specifically 3 ng, 7.5 ng and 15 ng), and were incubated at room temperature for 1h+. The ligation mix was then transformed into chemically competent DH10B Escherichia coli using a standard chemical transformation protocol and plated out on Chloramphenicol-specific LB plates.</p><br />
<h4>3.2 Cloning of pSB3K3-LacI-pLAC</h4><br />
<p>A compatible plasmid and induction system was cloned to allow expression of the operon in two parts. The medium/strong promoter J23110 was cloned in front of the quad part inverter Q01121. The inverter has an RBS, the LacI repressor followed by a double terminator then a Lac inducible promoter. The composite part created give constitutive expression of the Lac repressor allowing for induction by IPTG. The parts were then moved into the pSB3k3 backbone to be compatible with pSB1C3.</p><br />
<div><br />
<br />
</div><br />
<h4>3.3 Assembly of AcsAB and AcsCD </h4><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/3/3c/IC14-ecoli-construct-assembly.jpg"><br />
<figcaption>Figure 8:</figcaption><br />
</figure><br />
<p>The AcsABCD operon was designed in silico as described in the previous section. It was ordered for synthesis at GenArt in the form of four separate elements of similar sizes, named AcsA, AcsB, AcsC and AcsD, respectively. After synthesis, the constructs were directly transformed into DH10B <em>E.coli</em> using a standard chemical transformation protocol and plated overnight supplied with 50 ug/ml Kanamycin. 5ml LB were inoculated with a freshly growing colony and grown overnight at 37 C, under shaking conditions. Glycerol stocks were produced prior to proceeding with the assembly process.</p><br />
<p>In order to meet the Registry standards, we aimed to clone these elements into pSB1C3. To do so, we proceeded as described on figure 8. Two separate rounds of digestion were carried out using EcoRI, NcoI, PvuII and PstI to, and the resulting fragments (AcsA, AcsB, AcsC and AcsD and linearized pSB1C3) were submitted to a three-part ligation after dephosphorylation of the vector backbone (rAPid desphosphorylation, Roche). An equimolar ratio amongst all three parts was established during the ligation procedure, which in turn proceeded at 4 degrees overnight. The NEB High Efficiency Transformation protocol was used on NEB 10B cells (New England Biolabs) to propagate the resulting plasmid. Transformed cells were plated and incubated overnight at 37 C. 5 ml LB supplied with 50 ug/ml Chloramphenicol were inoculated with a selection of colonies for further analysis (refer to Results for additional information).</p><br />
<br />
<h4>3.4 Assembly of pSB-AraC-pBAD-AcsAB</h4><br />
<p>AcsAB was cloned into pSB-AraC-pBAD by Biobrick cloning. The destination vector was linearized using SpeI and PstI (New England Biolabs), and AcsAB (previously digested with XbaI and PstI, and gel extracted using the Minelute Gel Extraction Kit, by Qiagen) was ligated at a 1:1 ratio throughout an overnight ligation at room temperature. The resulting part was transformed into chemically competent DH10B Escherichia coli and plated on LB Agar+Chloramphenicol plates, grown overnight at 37 C. 5 ml LB falcons supplied with 50 ug/ml Chloramphenicol were inoculated with a selection of freshly grown colonies for further restriction analysis (refer to Results for additional information)</p><br />
<br />
<h4>3.5 Assembly of pSB-LacI-pLAC-CD</h4><br />
<p>Similarly to 3.4, AcsCD was cloned by BioBrick cloning into the pSB3K3 low copy expression vector containing the LacI-pLAC regulatory elements. Vector and insert were ligated at a 1:1 ratio overnight at room temperature. After transformation and plating on LB Agar+Kanamycin (25 ug/ml), colonies were screened by Greentaq colony PCR, and were further confirmed during the Congo Red Assay.</p><br />
</div><br />
<h3>Electroporation of pSB-pLAC-CD into electrocompetent AcsAB-containing DH10B cells</h3> <br />
<div><br />
<p>DH10B E.coli already containing the AcsAB construct were made electrocompetent using a standard protocol, which can be found in the Protocols section. A second round of transformation was carried to insert pLAC-AcsCD. 5ul of miniprepped pSB-pLAC-CD (diluted in ddH2O) were added into 50ul electrocompetent DH10B cells already containing the pBAD-inducible AcsAB element. Electroporation was carried out in in 10mm electrocuvettes at 1.8 kV, 200 Ohm resistance and 25 mF capacitance. 500ul SOC medium was added to the electroporated samples and these were recovered at 37 °C for 1h before plating on Kanamycin25 + Chloramphenicol 50 LB Agar plates.</p><br />
</div><br />
<h3>Congo Red Characterization</h3><br />
<div><br />
<p>LB Agar Congo Red assay plates were prepared with a final Congo Red concentration of 20uM, and they were supplied with 0.1% Arabinose, 0.5mM IPTG, 50 ug/mL Chloramphenicol, 25 ug/mL Kanamycin and 1% Glucose. Transformed cells containing both AcsAB and AcsCD were plated on Congo Red assay plates and incubated at 37 °C. They were qualitatively assayed after 24h and 48h for cellulose production. Finally, 5 mL LB supplied with 0.1% Arabinose, 0.5mM IPTG, 50 ug/mL Chloramphenicol, 25 ug/mL Kanamycin and 1% Glucose were inoculated with freshly grown, cellulose-producing colonies and were grown for 16h at 30 °C, 180 rpm. An empty vector control was also grown overnight for comparative analysis. These liquid cultues were supplied with Congo Red, to yield a final concentration of 20uM. They were incubated under static conditions for 2h at room temperature, and were later pelleted down to allow for qualitative analysis of Congo Red binding.</p><br />
<br />
<p>AcsAB functionality was assayed by inducing AcsAB-containing cells with 0.1% Arabinose in 5mL LB supplied with 1% Glucose and Chloramphenicol. Overnight incubations were set up at 30 °C and 37 °C, and both empty vector controls and un-induced controls were also assayed. Cells were pelleted at 4000rpm for 10 minutes and the supernatant was kept for further analysis. Cells were resuspended in 1xPBS and sonicated for 3 minutes as on/off cycles of 15 seconds. Both the membrane and soluble samples produced after centrifugation were kept for further analysis. Congo Red was then added to the LB, soluble and membrane samples up to a final concentration of 20uM, and no Congo Red samples were also kept for further inspection. Samples were incubated for 2h at static conditions and at room temperature to allow for Congo Red binding. 96-well plates were inoculated for further absorbance measurements at 490nm.</p><br />
</div><br />
<br />
<br />
</div><br />
</section><br />
<br />
<br />
<section id="results"><br />
<h2>Results</h2><br />
<div class="accordion"><br />
<h3>Constructs</h3><br />
<div><br />
<p>All constructs were assembled as described in Materials and Methods. As a preliminary verification step, restriction analyses were carried out using the corresponding restriction enzymes (refer to figure legends for more details) and results were visualized on 0.7-1% agarose gels. Final confirmation was obtained by gene sequencing, during which the BioBrick Verification Primers and walking primers were used. These are shown on the table below, please refer to the Registry for further information.</p><br />
<br />
<figure class="content-image"><br />
<table class="tg image-full"><br />
<tr><br />
<th </th><br />
<th </th><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AraC-pBAD</td><br />
<td class="tg-031e">Forward: TACTAGTAGCGGCCGCTGCAG<br />
<br>Reverse: GCTAGCCCAAAAAAACGGGTATGGAG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">BioBrick Verification Primers</td><br />
<td class="tg-031e">Forward: TGCCACCTGACGTCTAAGAA<br />
<br>Reverse: ATTACCGCCTTTGAGTGAGC</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 1</td><br />
<td class="tg-031e">TCT GAA TTA TGC CAT TGG TCA TAC CG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 2</td><br />
<td class="tg-031e">ATA TGT TTC ATG CAG TTG GCA CC</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 3</td><br />
<td class="tg-031e">GAT GCA TGG GTT GAT TGG GG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 4</td><br />
<td class="tg-031e">ATC CAG CAC ATC CGA CCT TTG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 5</td><br />
<td class="tg-031e">GTT ACC GCA AGT AAA CTG CAA G</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 6</td><br />
<td class="tg-031e">GAT GGT CTG ATT CGT CTG GTT A</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 7</td><br />
<td class="tg-031e">ACG CAG CAC AGG TCA GAC CGG TGA A</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 8</td><br />
<td class="tg-031e">ATA TTG ATC TGA CCA CCG AACA</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 9</td><br />
<td class="tg-031e">TGC ACC GCC TGG TGA AAA TGG TT</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 10</td><br />
<td class="tg-031e">GTG GCT ATG CAA TTC AGA CAG GT</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 11</td><br />
<td class="tg-031e">TTC ATT CCC AGC GGT CGG TCG AT</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 12</td><br />
<td class="tg-031e">GTT TGC GTG GTG ATC TTT TT</td><br />
</tr><br />
</table><br />
<figcaption>Figure 9 - List of primers used by Team E.coli during the experimental procedure</figcaption><br />
</figure><br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/f/f8/IC14-ecoli-gel-pSB-AcsAB.jpg"><br />
<figcaption>Figure 10: Restriction Analysis results of AcsAB. Samples were submitted to an XbaI/PstI double digest, which flank the AcsAB construct. Two bands were displayed as expected: a ~5kb band corresponding to the AcsAB insert, and a ~2kb band corresponding to the pSB1C3 vector backbone. </figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/c/c1/IC14-ecoli-gel-pSB-AcsCD.jpg"><br />
<figcaption>Figure 11: pSB-AcsCD</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/b/b9/IC14-ecoli-gel-pSB-AraC-pBAD.jpg"><br />
<figcaption>Figure 12: pSB-AraC-pBAD</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/e/e7/IC14-ecoli-gel-pSB-AraC-pBAD-AcsAB-pSB-LacI-AcsAB.jpg"><br />
<figcaption>Figure 13: pSB-AraC-pBAD-AcsAB and pSB-LacI-AcsAB</figcaption><br />
</figure><br />
</div><br />
<br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/4/4a/IC14-ecoli-gel-colony1.jpg"><br />
<figcaption>Figure 14: pLAC-AcsCD colony PCR results. Further details on the procedure can be found on the Methods and Materials section. Those colonies that we testes further have been highlighted with numbers on the pictures. Specifically, colony A1 was used for subcloning into AcsAB containing E.coli DH10B. <br />
Plates A and B were generated <br />
</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/1/10/IC14-ecoli-gel-colony2.jpg"><br />
<figcaption>Figure 15: pLAC-AcsCD colony PCR results. Further details on the procedure can be found on the Methods and Materials section. Those colonies that we testes further have been highlighted with numbers on the pictures. Specifically, colony A1 was used for subcloning into AcsAB containing E.coli DH10B. <br />
Plates A and B were generated <br />
</figcaption><br />
</figure><br />
</div><br />
</div><br />
<br />
<br />
<br />
</div><br />
<h3>Characterising Cellulose Production</h3><br />
<div><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/f/fe/IC14-ecoli-fig2.png"><br />
<figcaption>Figure 16:</figcaption><br />
</figure><br />
<p>Cellulose Production can be easily assayed using the diazo dye Congo Red. Congo Red specifically binds cellulostic fibrils, and this binding can be measured by spectral analysis, because it causes a shift on the spectral properties of the dye, which can be monitored with a spectrophotometer (Klunk et al., 1999). In addition to this, Congo Red also allows for visual, qualitative analysis: it causes a color change of any cellulose-producing colonies by binding to the growing fibres. Therefore, cellulose production can be easily detected by eye on LB Agar plates and liquid cultures.</p><br />
<br />
<p>We assayed cellulose production on LB Agar Congo Red assay plates. Colonies containing the refactored cellulose production machinery turned red within 24h, and presented a rougher composition and brighter red color after 48h. In contrast to this, colonies presenting empty vector (negative controls), presented no color changes and maintained the characteristics of standard <em>Escherichia coli</em> colonies (smoother composition and standard yellow colour).</p><br />
<br />
<p>To confirm this qualitative assay, a second qualitative assay was carried out, also based on Congo Red binding. This second analysis consisted of incubating overnight cultures (both cellulose producers and empty vector controls) with Congo Red as described in Materials and Methods. Cellulose producers will present growing cellulose fibres on their extracellular surface, hence will dye red in the presence of Congo Red, unlike non-cellulose-producing cells. After spinning down the cells, a red pellet was observed that corresponded to the cellulose producing colonies. In contrast to this, negative controls did not bind Congo Red and hence maintained the standard E.coli characteristics. We consider that this qualitative data supports our design and confirms that the cellulose production operon has been successfully refactored and transferred into <em>Escherichia coli</em>.</p><br />
<br />
<p>In order to gain a better understanding of the activity of the Acs elements in Escherichia coli, it was of interest to explore whether the AcsAB element alone would be enough to achieve cellulose production. AcsAB is embedded in the cytoplasmic membrane and transports the growing polymer through the membrane as it attaches the glucose monomers in the cytoplasm. In the absence of AcsC and AcsD, no cellulose can be secreted into the environment and as a result, it was assumed that it would instead become accumulated in the cell’s periplasm. For this reason, during characterization we required sonication in order to get the cellulose (if any at all) out of the cells.</p><br />
<br />
<p>To widen our screening, we set up induced samples and uninduced controls and assayed samples at different temperatures (30°C versus 37°C) and different conditions (shaking versus static) in the presence or absence of 1% D-Glucose. Furthermore, 2 Biological replicates were assayed, and technical triplicates were also set up during plate reading to support any statistically relevant findings. Although we expected no cellulose to be accumulating in the medium, we still analysed all fractions originating throughout the procedure: LB fractions, soluble fractions and non-soluble fractions (called membrane fractions throughout this study).</p><br />
<br />
<p>All fractions were incubated in the presence of Congo Red (as described in Materials and Methods) and were later inoculated into a 96-well plate for absorbance measurements at 490nm. Free Congo Red has a maximal absorption at such wavelength. By setting up a control sample, containing solvent (PBS)+ Congo Red, it is possible to measure the total absorbance of the molecule whilst free in solution. When cellulolytic samples are incubated in the presence of Congo Red, less azodye molecules becomes available in the medium due to binding, hence absorbance levels will decrease. The total Congo Red bound will equal the absorbance of Congo Red Control minus the absorbance of our samples of interest. This approach gives you an idea of the amount of Congo Red that may have bound to the cellulositic fibres, but it does not provide exact values of cellulose present.</p><br />
</div><br />
<br />
<br />
</section><br />
<section id="future"><br />
<h2>Future Work</h2><br />
<br />
</section><br />
<br />
<section id="references"><br />
<h2>References</h2><br />
<ol><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<br />
<br />
<br />
<br />
<br />
</ol><br />
</section><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
<br />
{{:Team:Imperial/Templates:footer}}</div>HChughtaihttp://2014.igem.org/Team:Imperial/EColiTeam:Imperial/EColi2014-10-18T03:25:50Z<p>HChughtai: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1><em>E. coli</em></h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#introduction">Introduction</a><br />
</li><br />
<li><a data-scroll href="#aim">Aims</a><br />
</li><br />
<li><a data-scroll href="#engineering">Engineering</a><br />
</li><br />
<li><a data-scroll href="#methods">Materials and Methods</a><br />
</li><br />
<br />
<li><a data-scroll href="#results">Results</a><br />
</li><br />
<li><a data-scroll href="#future">Future Work</a><br />
</li><br />
<li><a data-scroll href="#references">References</a><br />
</li><br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p><em>Escherichia coli</em> is the organism of choice for synthetic biology. It is thoroughly characterised, easy to engineer and has numerous parts, control circuits and complex constructs tested in this host.</p><br />
<p>Some <em>E. coli</em> strains have evolved to produce low amounts of cellulose but the machinery under specific regulatory control (its secretion is generally linked to biofilm formation and stress situations). In order to expand the use of bacterial cellulose as a functional biomaterial that is cost effective to produce, it is desirable for its production machinery to be implemented in an organisms that is easy to engineer and has proven success in large scale bioreactors.</p><br />
<p>Here, we confirm that the high output cellulose production machinery of <em>Gluconacetobacter Xylinus</em> can be transferred into other organisms. We have proven function of the Acs cellulose producing operon in <em>Escherichia coli</em> using Congo Red binding assays.<br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>Key Achievements </h2><br />
<ul><br />
<li>Contributed an optimised Asc cellulose production operon to Registry of Standard Parts.</li><br />
<li>Proved the portability of <em>Gluconacetobacter xylinus</em> operon.</li><br />
<li>Assembled a fully synthetic, functional, cellulose-producing system in <em>Escherichia coli</em></li><br />
<li>Demonstrated the synthesis operon in a two plasmid system for separate induction of genes</li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<br />
<br/><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<figure class="content-image image-half"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/2/20/IC14-ecoli-fig1.jpg"><br />
<figcaption>Figures 1 & 2: Congo red staining of microbial cellulose in <em>E. coli</em></figcaption><br />
</figure><br />
</div><br />
<br />
<br />
<div class="pure-u-1-2"><br />
<figure class="content-image image-half"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/a/ad/IC14-ecoli-fig3.jpg"><br />
<figcaption></figcaption><br />
</figure><br />
</div><br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<section id="Aims"><br />
<h2>Aims</h2><br />
<br />
<p>By transferring the cellulose production operon from its native organism <em>Gluconacetobacter xylinus</em> into the lab and industrially friendly host <em>Escherichia coli</em>, we aim to improve cellulose production per unit time to achieve more cost effective pellicle growth and to encourage further synthetic biology with microbial cellulose. <em>E. coli</em> grows considerably faster plus tolerates higher temperatures and more vigorous aeration. The ease of genetic engineering and the wealth of other characterized Biobricks increases the potential for exciting future projects</p><br />
<br />
<br />
</section><br />
<section id="engineering"><br />
<h2>Engineering</h2><br />
<p>The cellulose production operon in <em>Gluconacetobacter xylinus</em> is a 10kb genomic region, consisting of four main elements:</p><br />
<ul><br />
<li>acsAB, known as cellulose synthase, is made up of two domains: acsA being the catalytic domain, and acsB being the cyclic-di-GMP-binding domain. This modular enzyme requires the second messenger cyclic-di-GMP in order to carry out efficient catalysis.</li><br />
<li>acsC codes for an oligomeric element that gets embedded in the extracellular membrane and allows transport of the growing polymer across the cell membrane into the extracellular environment.</li><br />
<li>acsD is believed to be a non-essential element, although it is a key player in the control of cellulose crystallinity and required for maximal cellulose productivity.</li><br />
</ul><br />
<p>The native operon is highly regulated at transcriptional, translational and post-translational levels. Cellulose production responds to a wide set of internal signals and environmental cues. The native ribosomal binding sites (RBS) are predicted to be weak by translation rate calculators (The <a href="https://salis.psu.edu/software/"> Salis Lab RBS calculator </a> and <a href="http://sbi.postech.ac.kr/utr_designer"> Postech UTR designer </a>). This is perhaps to reduce noise in gene expression (strong promoter, weak RBS is less noisy that weak promoter strong RBS). The promoter region has not yet been characterized in <em>Gluconacetobacter xylinus</em>, however.</p><br />
<br />
<p>The first step of our computational design engineering was to identify the coding sequences and extract them from NCBI. We removed some native regulation by codon-optimizing the sequences for expression in <em>E.coli</em> and replaced the native RBS’s with the strong B0034 sequence. The 6 base pairs either side of the B0034 RBS were edited with the Salis Lab RBS calculator design function to tune RBS strength output to better preserve the natural stoichiometry.</p><br />
<br />
<p>Finally, in order to allow for even more customizable fine-tuning of the system, the operon was divided and cloned into two separate expression vectors: the AcsAB element was cloned under the control of the inducible pBAD promoter contained within pSB1C3, a high copy plasmid that would contribute to higher expression of Cellulose Synthase. Alternatively, AcsC and AcsD, believed to be expressed at lower levels in <em>G.xylinus</em>, was put under the control of the pLAC promoter and was transferred into a low copy plasmid, pSB3K3 so as to maintain lower levels of expression. This approach provided the following advantages:</p><br />
<ul><br />
<li>Reducing the size of the final expression vector avoids complications during assembly and vector take-up, and it also prevents a large construct from becoming a burden for cell growth and vector propagation.</li><br />
<li>By expressing the cellulose production machinery from two separate expression vectors, the following levels of control become available to us: the first being the changes in vector copy number, which directly affects gene expression levels throughout induction, and the second being the ability to activate the system using two different inducers. These key features of our system allow for a larger scope for fine-tuning and optimization of cellulose production levels.</li><br />
<br />
</ul><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/5/55/IC14-ecoli-pBAD-pLAC-CD.png"><br />
<figcaption>Figure 3: pSB-pBAD-AB and pLAC-CD</figcaption><br />
</figure><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/e/e7/IC14-ecoli-ABCDfragments.jpg.png"><br />
<figcaption>Figure 4: acsABCD fragments</figcaption><br />
</figure><br />
<p>With this approach, we allow for our system to be implemented in new range of hosts because a larger set of growth conditions, inducer concentrations and growth phases can be tested in order to achieve the required stoichiometry for the system to become functional.</p><br />
<br />
<br />
<p>In order to ease synthesis, the operon sequence was split into 4 fragments of similar sizes. We took advantage of the presence of two restriction sites: An NcoI present within the AcsAB sequence, and a PvuII site contained within AcsC. Furthermore, the BioBrick prefix and suffix were included and any additional sites removed elsewhere.</p><br />
<br />
<p>By standard cloning, these fragments could easily be put together to yield the following constructs:</p><br />
<figure class="content-image image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/f/ff/IC14-ecoli-AB-CD-constructs.png"><br />
<figcaption>Figure 5: acsAB and acsCD constructs</figcaption><br />
</figure><br />
<br />
<p>Gene Designer served as a very useful tool for assembling constructs and predicting cloning outcomes before proceeding with the experimental procedure. Find above the plasmid maps of our resulting constructs, and refer to Materials and Methods for a deeper insight into the assembly process.</p><br />
<br />
</section><br />
<section id="methods"><br />
<h2>Materials and Methods</h2><br />
<div class="accordion"><br />
<h3>1.0 Cell Strains and Media Components</h3><br />
<div><br />
<p><em>Escherichia coli</em> strain DH10B were made chemically competent following a standard protocol and were used to clone the pSB-AraC-pBAD and pSB-LacI-pLAC elements. Additionally, High Efficiency chemically competent DH10B <em>Escherichia coli</em> were purchased from New England Biolabs for assembly of the Acs cellulose-producing operon, which was codon-optimized for expression in E.coli and synthesized by GeneArt. Both strains were grown overnight in liquid cultures (supplemented with specific antibiotics), or on semi-solid LB-Agar plates, provided with the specific antibiotic, as listed on the table below.</p><br />
<br />
<p>Luria Broth Miller (LB) and LB Agar were purchased from VWR, prepared using standard protocols and used throughout the experimental procedure. During characterization, Acs-containing strains were supplemented with 1% D-glucose, 0.1% Arabinose and 0.5mM IPTG.<br />
</p><br />
<br />
<figure class="content-image"><br />
<table class="tg image-full"><br />
<tr><br />
<th class="tg-e3zv">Plasmid name</th><br />
<th class="tg-e3zv">Vector backbone</th><br />
<th class="tg-e3zv">Antibiotic concentration (ug/ml)</th><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AraC-pBAD</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-LacI-pLAC</td><br />
<td class="tg-031e">pSB3K3</td><br />
<td class="tg-031e">Kanamycin 25</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AcsAB</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AcsCD</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AraC-pBAD-AcsAB</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-LacI-pLAC-CD</td><br />
<td class="tg-031e">pSB3K3</td><br />
<td class="tg-031e">Kanamycin 25</td><br />
</tr><br />
</table><br />
<figcaption>Figure 6: List of antibiotics used, in relation to their respective constructs</figcaption><br />
</figure><br />
<br />
</div><br />
<h3>2.0 Chemicals </h3><br />
<div><br />
<p>Congo Red was purchased from Sigma Aldrich (Steiheim, Germany) and diluted in 1x PBS to a concentration of 350 uM. The final Congo Red concentration used during system characterization steps was 20 uM. This was also used, also at a concentration of 20 uM, to make LB Agar Congo Red Assay plates.</p><br />
</div><br />
<h3>3.0 Construct Assembly</h3><br />
<div><br />
<h4>3.1 Cloning of pSB-AraC-pBAD</h4><br />
<div><br />
<p>The AraC and pBAD elements were obtained by PCR, using the Biobricks BBa_K325108, BBa_K325218 and BBa_K325219 as DNA templates, all of which follow the standard structure showed on figure 7. The primers used during this procedure were as follows:<br />
</p><br />
<ul><br />
<li>Forward: TACTAGTAGCGGCCGCTGCAG</li><br />
<li>Reverse: GCTAGCCCAAAAAAACGGGTATGGAG</li><br />
</ul><br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/d/d4/IC14-ecoli-AraC-pBAD.png"><br />
<figcaption>Figure 7 - Plasmid maps describing both the original (left) and engineered (right) AraC-pBAD-containing parts, including all relevant elements. These were designed and cloned in silico on GeneDesigner.</figcaption><br />
</figure><br />
</div><br />
<p>The amplified elements were DpnI-treated following a standard procedure (New England Biolabs), and were subsequently submitted to a purification step (Qiaquick PCR clean up, Qiagen) prior to self-ligation. Three different template concentrations were tested during ligation (specifically 3 ng, 7.5 ng and 15 ng), and were incubated at room temperature for 1h+. The ligation mix was then transformed into chemically competent DH10B Escherichia coli using a standard chemical transformation protocol and plated out on Chloramphenicol-specific LB plates.</p><br />
<h4>3.2 Cloning of pSB3K3-LacI-pLAC</h4><br />
<p>A compatible plasmid and induction system was cloned to allow expression of the operon in two parts. The medium/strong promoter J23110 was cloned in front of the quad part inverter Q01121. The inverter has an RBS, the LacI repressor followed by a double terminator then a Lac inducible promoter. The composite part created give constitutive expression of the Lac repressor allowing for induction by IPTG. The parts were then moved into the pSB3k3 backbone to be compatible with pSB1C3.</p><br />
<div><br />
<br />
</div><br />
<h4>3.3 Assembly of AcsAB and AcsCD </h4><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/3/3c/IC14-ecoli-construct-assembly.jpg"><br />
<figcaption>Figure 8:</figcaption><br />
</figure><br />
<p>The AcsABCD operon was designed in silico as described in the previous section. It was ordered for synthesis at GenArt in the form of four separate elements of similar sizes, named AcsA, AcsB, AcsC and AcsD, respectively. After synthesis, the constructs were directly transformed into DH10B <em>E.coli</em> using a standard chemical transformation protocol and plated overnight supplied with 50 ug/ml Kanamycin. 5ml LB were inoculated with a freshly growing colony and grown overnight at 37 C, under shaking conditions. Glycerol stocks were produced prior to proceeding with the assembly process.</p><br />
<p>In order to meet the Registry standards, we aimed to clone these elements into pSB1C3. To do so, we proceeded as described on figure 8. Two separate rounds of digestion were carried out using EcoRI, NcoI, PvuII and PstI to, and the resulting fragments (AcsA, AcsB, AcsC and AcsD and linearized pSB1C3) were submitted to a three-part ligation after dephosphorylation of the vector backbone (rAPid desphosphorylation, Roche). An equimolar ratio amongst all three parts was established during the ligation procedure, which in turn proceeded at 4 degrees overnight. The NEB High Efficiency Transformation protocol was used on NEB 10B cells (New England Biolabs) to propagate the resulting plasmid. Transformed cells were plated and incubated overnight at 37 C. 5 ml LB supplied with 50 ug/ml Chloramphenicol were inoculated with a selection of colonies for further analysis (refer to Results for additional information).</p><br />
<br />
<h4>3.4 Assembly of pSB-AraC-pBAD-AcsAB</h4><br />
<p>AcsAB was cloned into pSB-AraC-pBAD by Biobrick cloning. The destination vector was linearized using SpeI and PstI (New England Biolabs), and AcsAB (previously digested with XbaI and PstI, and gel extracted using the Minelute Gel Extraction Kit, by Qiagen) was ligated at a 1:1 ratio throughout an overnight ligation at room temperature. The resulting part was transformed into chemically competent DH10B Escherichia coli and plated on LB Agar+Chloramphenicol plates, grown overnight at 37 C. 5 ml LB falcons supplied with 50 ug/ml Chloramphenicol were inoculated with a selection of freshly grown colonies for further restriction analysis (refer to Results for additional information)</p><br />
<br />
<h4>3.5 Assembly of pSB-LacI-pLAC-CD</h4><br />
<p>Similarly to 3.4, AcsCD was cloned by BioBrick cloning into the pSB3K3 low copy expression vector containing the LacI-pLAC regulatory elements. Vector and insert were ligated at a 1:1 ratio overnight at room temperature. After transformation and plating on LB Agar+Kanamycin (25 ug/ml), colonies were screened by Greentaq colony PCR, and were further confirmed during the Congo Red Assay.</p><br />
</div><br />
<h3>Electroporation of pSB-pLAC-CD into electrocompetent AcsAB-containing DH10B cells</h3> <br />
<div><br />
<p>DH10B E.coli already containing the AcsAB construct were made electrocompetent using a standard protocol, which can be found in the Protocols section. A second round of transformation was carried to insert pLAC-AcsCD. 5ul of miniprepped pSB-pLAC-CD (diluted in ddH2O) were added into 50ul electrocompetent DH10B cells already containing the pBAD-inducible AcsAB element. Electroporation was carried out in in 10mm electrocuvettes at 1.8 kV, 200 Ohm resistance and 25 mF capacitance. 500ul SOC medium was added to the electroporated samples and these were recovered at 37 °C for 1h before plating on Kanamycin25 + Chloramphenicol 50 LB Agar plates.</p><br />
</div><br />
<h3>Congo Red Characterization</h3><br />
<div><br />
<p>LB Agar Congo Red assay plates were prepared with a final Congo Red concentration of 20uM, and they were supplied with 0.1% Arabinose, 0.5mM IPTG, 50 ug/mL Chloramphenicol, 25 ug/mL Kanamycin and 1% Glucose. Transformed cells containing both AcsAB and AcsCD were plated on Congo Red assay plates and incubated at 37 °C. They were qualitatively assayed after 24h and 48h for cellulose production. Finally, 5 mL LB supplied with 0.1% Arabinose, 0.5mM IPTG, 50 ug/mL Chloramphenicol, 25 ug/mL Kanamycin and 1% Glucose were inoculated with freshly grown, cellulose-producing colonies and were grown for 16h at 30 °C, 180 rpm. An empty vector control was also grown overnight for comparative analysis. These liquid cultues were supplied with Congo Red, to yield a final concentration of 20uM. They were incubated under static conditions for 2h at room temperature, and were later pelleted down to allow for qualitative analysis of Congo Red binding.</p><br />
<br />
<p>AcsAB functionality was assayed by inducing AcsAB-containing cells with 0.1% Arabinose in 5mL LB supplied with 1% Glucose and Chloramphenicol. Overnight incubations were set up at 30 °C and 37 °C, and both empty vector controls and un-induced controls were also assayed. Cells were pelleted at 4000rpm for 10 minutes and the supernatant was kept for further analysis. Cells were resuspended in 1xPBS and sonicated for 3 minutes as on/off cycles of 15 seconds. Both the membrane and soluble samples produced after centrifugation were kept for further analysis. Congo Red was then added to the LB, soluble and membrane samples up to a final concentration of 20uM, and no Congo Red samples were also kept for further inspection. Samples were incubated for 2h at static conditions and at room temperature to allow for Congo Red binding. 96-well plates were inoculated for further absorbance measurements at 490nm.</p><br />
</div><br />
<br />
<br />
</div><br />
</section><br />
<br />
<br />
<section id="results"><br />
<h2>Results</h2><br />
<div class="accordion"><br />
<h3>Constructs</h3><br />
<div><br />
<p>All constructs were assembled as described in Materials and Methods. As a preliminary verification step, restriction analyses were carried out using the corresponding restriction enzymes (refer to figure legends for more details) and results were visualized on 0.7-1% agarose gels. Final confirmation was obtained by gene sequencing, during which the BioBrick Verification Primers and walking primers were used. These are shown on the table below, please refer to the Registry for further information.</p><br />
<br />
<figure class="content-image"><br />
<table class="tg image-full"><br />
<tr><br />
<th </th><br />
<th </th><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AraC-pBAD</td><br />
<td class="tg-031e">Forward: TACTAGTAGCGGCCGCTGCAG<br />
<br>Reverse: GCTAGCCCAAAAAAACGGGTATGGAG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">BioBrick Verification Primers</td><br />
<td class="tg-031e">Forward: TGCCACCTGACGTCTAAGAA<br />
<br>Reverse: ATTACCGCCTTTGAGTGAGC</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 1</td><br />
<td class="tg-031e">TCT GAA TTA TGC CAT TGG TCA TAC CG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 2</td><br />
<td class="tg-031e">ATA TGT TTC ATG CAG TTG GCA CC</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 3</td><br />
<td class="tg-031e">GAT GCA TGG GTT GAT TGG GG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 4</td><br />
<td class="tg-031e">ATC CAG CAC ATC CGA CCT TTG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 5</td><br />
<td class="tg-031e">GTT ACC GCA AGT AAA CTG CAA G</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 6</td><br />
<td class="tg-031e">GAT GGT CTG ATT CGT CTG GTT A</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 7</td><br />
<td class="tg-031e">ACG CAG CAC AGG TCA GAC CGG TGA A</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 8</td><br />
<td class="tg-031e">ATA TTG ATC TGA CCA CCG AACA</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 9</td><br />
<td class="tg-031e">TGC ACC GCC TGG TGA AAA TGG TT</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 10</td><br />
<td class="tg-031e">GTG GCT ATG CAA TTC AGA CAG GT</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 11</td><br />
<td class="tg-031e">TTC ATT CCC AGC GGT CGG TCG AT</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 12</td><br />
<td class="tg-031e">GTT TGC GTG GTG ATC TTT TT</td><br />
</tr><br />
</table><br />
<figcaption>Figure 9 - List of primers used by Team E.coli during the experimental procedure</figcaption><br />
</figure><br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/f/f8/IC14-ecoli-gel-pSB-AcsAB.jpg"><br />
<figcaption>Figure 10: pSB-AcsAB</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/c/c1/IC14-ecoli-gel-pSB-AcsCD.jpg"><br />
<figcaption>Figure 11: pSB-AcsCD</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/b/b9/IC14-ecoli-gel-pSB-AraC-pBAD.jpg"><br />
<figcaption>Figure 12: pSB-AraC-pBAD</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/e/e7/IC14-ecoli-gel-pSB-AraC-pBAD-AcsAB-pSB-LacI-AcsAB.jpg"><br />
<figcaption>Figure 13: pSB-AraC-pBAD-AcsAB and pSB-LacI-AcsAB</figcaption><br />
</figure><br />
</div><br />
<br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/4/4a/IC14-ecoli-gel-colony1.jpg"><br />
<figcaption>Figure 14: pLAC-AcsCD colony PCR results. Further details on the procedure can be found on the Methods and Materials section. Those colonies that we testes further have been highlighted with numbers on the pictures. Specifically, colony A1 was used for subcloning into AcsAB containing E.coli DH10B. <br />
Plates A and B were generated <br />
</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/1/10/IC14-ecoli-gel-colony2.jpg"><br />
<figcaption>Figure 15: pLAC-AcsCD colony PCR results. Further details on the procedure can be found on the Methods and Materials section. Those colonies that we testes further have been highlighted with numbers on the pictures. Specifically, colony A1 was used for subcloning into AcsAB containing E.coli DH10B. <br />
Plates A and B were generated <br />
</figcaption><br />
</figure><br />
</div><br />
</div><br />
<br />
<br />
<br />
</div><br />
<h3>Characterising Cellulose Production</h3><br />
<div><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/f/fe/IC14-ecoli-fig2.png"><br />
<figcaption>Figure 16:</figcaption><br />
</figure><br />
<p>Cellulose Production can be easily assayed using the diazo dye Congo Red. Congo Red specifically binds cellulostic fibrils, and this binding can be measured by spectral analysis, because it causes a shift on the spectral properties of the dye, which can be monitored with a spectrophotometer (Klunk et al., 1999). In addition to this, Congo Red also allows for visual, qualitative analysis: it causes a color change of any cellulose-producing colonies by binding to the growing fibres. Therefore, cellulose production can be easily detected by eye on LB Agar plates and liquid cultures.</p><br />
<br />
<p>We assayed cellulose production on LB Agar Congo Red assay plates. Colonies containing the refactored cellulose production machinery turned red within 24h, and presented a rougher composition and brighter red color after 48h. In contrast to this, colonies presenting empty vector (negative controls), presented no color changes and maintained the characteristics of standard <em>Escherichia coli</em> colonies (smoother composition and standard yellow colour).</p><br />
<br />
<p>To confirm this qualitative assay, a second qualitative assay was carried out, also based on Congo Red binding. This second analysis consisted of incubating overnight cultures (both cellulose producers and empty vector controls) with Congo Red as described in Materials and Methods. Cellulose producers will present growing cellulose fibres on their extracellular surface, hence will dye red in the presence of Congo Red, unlike non-cellulose-producing cells. After spinning down the cells, a red pellet was observed that corresponded to the cellulose producing colonies. In contrast to this, negative controls did not bind Congo Red and hence maintained the standard E.coli characteristics. We consider that this qualitative data supports our design and confirms that the cellulose production operon has been successfully refactored and transferred into <em>Escherichia coli</em>.</p><br />
<br />
<p>In order to gain a better understanding of the activity of the Acs elements in Escherichia coli, it was of interest to explore whether the AcsAB element alone would be enough to achieve cellulose production. AcsAB is embedded in the cytoplasmic membrane and transports the growing polymer through the membrane as it attaches the glucose monomers in the cytoplasm. In the absence of AcsC and AcsD, no cellulose can be secreted into the environment and as a result, it was assumed that it would instead become accumulated in the cell’s periplasm. For this reason, during characterization we required sonication in order to get the cellulose (if any at all) out of the cells.</p><br />
<br />
<p>To widen our screening, we set up induced samples and uninduced controls and assayed samples at different temperatures (30°C versus 37°C) and different conditions (shaking versus static) in the presence or absence of 1% D-Glucose. Furthermore, 2 Biological replicates were assayed, and technical triplicates were also set up during plate reading to support any statistically relevant findings. Although we expected no cellulose to be accumulating in the medium, we still analysed all fractions originating throughout the procedure: LB fractions, soluble fractions and non-soluble fractions (called membrane fractions throughout this study).</p><br />
<br />
<p>All fractions were incubated in the presence of Congo Red (as described in Materials and Methods) and were later inoculated into a 96-well plate for absorbance measurements at 490nm. Free Congo Red has a maximal absorption at such wavelength. By setting up a control sample, containing solvent (PBS)+ Congo Red, it is possible to measure the total absorbance of the molecule whilst free in solution. When cellulolytic samples are incubated in the presence of Congo Red, less azodye molecules becomes available in the medium due to binding, hence absorbance levels will decrease. The total Congo Red bound will equal the absorbance of Congo Red Control minus the absorbance of our samples of interest. This approach gives you an idea of the amount of Congo Red that may have bound to the cellulositic fibres, but it does not provide exact values of cellulose present.</p><br />
</div><br />
<br />
<br />
</section><br />
<section id="future"><br />
<h2>Future Work</h2><br />
<br />
</section><br />
<br />
<section id="references"><br />
<h2>References</h2><br />
<ol><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<br />
<br />
<br />
<br />
<br />
</ol><br />
</section><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
<br />
{{:Team:Imperial/Templates:footer}}</div>HChughtaihttp://2014.igem.org/Team:Imperial/EColiTeam:Imperial/EColi2014-10-18T03:25:01Z<p>HChughtai: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1><em>E. coli</em></h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#introduction">Introduction</a><br />
</li><br />
<li><a data-scroll href="#aim">Aims</a><br />
</li><br />
<li><a data-scroll href="#engineering">Engineering</a><br />
</li><br />
<li><a data-scroll href="#methods">Materials and Methods</a><br />
</li><br />
<br />
<li><a data-scroll href="#results">Results</a><br />
</li><br />
<li><a data-scroll href="#future">Future Work</a><br />
</li><br />
<li><a data-scroll href="#references">References</a><br />
</li><br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p><em>Escherichia coli</em> is the organism of choice for synthetic biology. It is thoroughly characterised, easy to engineer and has numerous parts, control circuits and complex constructs tested in this host.</p><br />
<p>Some <em>E. coli</em> strains have evolved to produce low amounts of cellulose but the machinery under specific regulatory control (its secretion is generally linked to biofilm formation and stress situations). In order to expand the use of bacterial cellulose as a functional biomaterial that is cost effective to produce, it is desirable for its production machinery to be implemented in an organisms that is easy to engineer and has proven success in large scale bioreactors.</p><br />
<p>Here, we confirm that the high output cellulose production machinery of <em>Gluconacetobacter Xylinus</em> can be transferred into other organisms. We have proven function of the Acs cellulose producing operon in <em>Escherichia coli</em> using Congo Red binding assays.<br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>Key Achievements </h2><br />
<ul><br />
<li>Contributed an optimised Asc cellulose production operon to Registry of Standard Parts.</li><br />
<li>Proved the portability of <em>Gluconacetobacter xylinus</em> operon.</li><br />
<li>Assembled a fully synthetic, functional, cellulose-producing system in <em>Escherichia coli</em></li><br />
<li>Demonstrated the synthesis operon in a two plasmid system for separate induction of genes</li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<br />
<br/><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<figure class="content-image image-full"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/2/20/IC14-ecoli-fig1.jpg"><br />
<figcaption>Figures 1 & 2: Congo red staining of microbial cellulose in <em>E. coli</em></figcaption><br />
</figure><br />
</div><br />
<br />
<br />
<div class="pure-u-1-2"><br />
<figure class="content-image image-full"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/a/ad/IC14-ecoli-fig3.jpg"><br />
<figcaption></figcaption><br />
</figure><br />
</div><br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<section id="Aims"><br />
<h2>Aims</h2><br />
<br />
<p>By transferring the cellulose production operon from its native organism <em>Gluconacetobacter xylinus</em> into the lab and industrially friendly host <em>Escherichia coli</em>, we aim to improve cellulose production per unit time to achieve more cost effective pellicle growth and to encourage further synthetic biology with microbial cellulose. <em>E. coli</em> grows considerably faster plus tolerates higher temperatures and more vigorous aeration. The ease of genetic engineering and the wealth of other characterized Biobricks increases the potential for exciting future projects</p><br />
<br />
<br />
</section><br />
<section id="engineering"><br />
<h2>Engineering</h2><br />
<p>The cellulose production operon in <em>Gluconacetobacter xylinus</em> is a 10kb genomic region, consisting of four main elements:</p><br />
<ul><br />
<li>acsAB, known as cellulose synthase, is made up of two domains: acsA being the catalytic domain, and acsB being the cyclic-di-GMP-binding domain. This modular enzyme requires the second messenger cyclic-di-GMP in order to carry out efficient catalysis.</li><br />
<li>acsC codes for an oligomeric element that gets embedded in the extracellular membrane and allows transport of the growing polymer across the cell membrane into the extracellular environment.</li><br />
<li>acsD is believed to be a non-essential element, although it is a key player in the control of cellulose crystallinity and required for maximal cellulose productivity.</li><br />
</ul><br />
<p>The native operon is highly regulated at transcriptional, translational and post-translational levels. Cellulose production responds to a wide set of internal signals and environmental cues. The native ribosomal binding sites (RBS) are predicted to be weak by translation rate calculators (The <a href="https://salis.psu.edu/software/"> Salis Lab RBS calculator </a> and <a href="http://sbi.postech.ac.kr/utr_designer"> Postech UTR designer </a>). This is perhaps to reduce noise in gene expression (strong promoter, weak RBS is less noisy that weak promoter strong RBS). The promoter region has not yet been characterized in <em>Gluconacetobacter xylinus</em>, however.</p><br />
<br />
<p>The first step of our computational design engineering was to identify the coding sequences and extract them from NCBI. We removed some native regulation by codon-optimizing the sequences for expression in <em>E.coli</em> and replaced the native RBS’s with the strong B0034 sequence. The 6 base pairs either side of the B0034 RBS were edited with the Salis Lab RBS calculator design function to tune RBS strength output to better preserve the natural stoichiometry.</p><br />
<br />
<p>Finally, in order to allow for even more customizable fine-tuning of the system, the operon was divided and cloned into two separate expression vectors: the AcsAB element was cloned under the control of the inducible pBAD promoter contained within pSB1C3, a high copy plasmid that would contribute to higher expression of Cellulose Synthase. Alternatively, AcsC and AcsD, believed to be expressed at lower levels in <em>G.xylinus</em>, was put under the control of the pLAC promoter and was transferred into a low copy plasmid, pSB3K3 so as to maintain lower levels of expression. This approach provided the following advantages:</p><br />
<ul><br />
<li>Reducing the size of the final expression vector avoids complications during assembly and vector take-up, and it also prevents a large construct from becoming a burden for cell growth and vector propagation.</li><br />
<li>By expressing the cellulose production machinery from two separate expression vectors, the following levels of control become available to us: the first being the changes in vector copy number, which directly affects gene expression levels throughout induction, and the second being the ability to activate the system using two different inducers. These key features of our system allow for a larger scope for fine-tuning and optimization of cellulose production levels.</li><br />
<br />
</ul><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/5/55/IC14-ecoli-pBAD-pLAC-CD.png"><br />
<figcaption>Figure 3: pSB-pBAD-AB and pLAC-CD</figcaption><br />
</figure><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/e/e7/IC14-ecoli-ABCDfragments.jpg.png"><br />
<figcaption>Figure 4: acsABCD fragments</figcaption><br />
</figure><br />
<p>With this approach, we allow for our system to be implemented in new range of hosts because a larger set of growth conditions, inducer concentrations and growth phases can be tested in order to achieve the required stoichiometry for the system to become functional.</p><br />
<br />
<br />
<p>In order to ease synthesis, the operon sequence was split into 4 fragments of similar sizes. We took advantage of the presence of two restriction sites: An NcoI present within the AcsAB sequence, and a PvuII site contained within AcsC. Furthermore, the BioBrick prefix and suffix were included and any additional sites removed elsewhere.</p><br />
<br />
<p>By standard cloning, these fragments could easily be put together to yield the following constructs:</p><br />
<figure class="content-image image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/f/ff/IC14-ecoli-AB-CD-constructs.png"><br />
<figcaption>Figure 5: acsAB and acsCD constructs</figcaption><br />
</figure><br />
<br />
<p>Gene Designer served as a very useful tool for assembling constructs and predicting cloning outcomes before proceeding with the experimental procedure. Find above the plasmid maps of our resulting constructs, and refer to Materials and Methods for a deeper insight into the assembly process.</p><br />
<br />
</section><br />
<section id="methods"><br />
<h2>Materials and Methods</h2><br />
<div class="accordion"><br />
<h3>1.0 Cell Strains and Media Components</h3><br />
<div><br />
<p><em>Escherichia coli</em> strain DH10B were made chemically competent following a standard protocol and were used to clone the pSB-AraC-pBAD and pSB-LacI-pLAC elements. Additionally, High Efficiency chemically competent DH10B <em>Escherichia coli</em> were purchased from New England Biolabs for assembly of the Acs cellulose-producing operon, which was codon-optimized for expression in E.coli and synthesized by GeneArt. Both strains were grown overnight in liquid cultures (supplemented with specific antibiotics), or on semi-solid LB-Agar plates, provided with the specific antibiotic, as listed on the table below.</p><br />
<br />
<p>Luria Broth Miller (LB) and LB Agar were purchased from VWR, prepared using standard protocols and used throughout the experimental procedure. During characterization, Acs-containing strains were supplemented with 1% D-glucose, 0.1% Arabinose and 0.5mM IPTG.<br />
</p><br />
<br />
<figure class="content-image"><br />
<table class="tg image-full"><br />
<tr><br />
<th class="tg-e3zv">Plasmid name</th><br />
<th class="tg-e3zv">Vector backbone</th><br />
<th class="tg-e3zv">Antibiotic concentration (ug/ml)</th><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AraC-pBAD</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-LacI-pLAC</td><br />
<td class="tg-031e">pSB3K3</td><br />
<td class="tg-031e">Kanamycin 25</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AcsAB</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AcsCD</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AraC-pBAD-AcsAB</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-LacI-pLAC-CD</td><br />
<td class="tg-031e">pSB3K3</td><br />
<td class="tg-031e">Kanamycin 25</td><br />
</tr><br />
</table><br />
<figcaption>Figure 6: List of antibiotics used, in relation to their respective constructs</figcaption><br />
</figure><br />
<br />
</div><br />
<h3>2.0 Chemicals </h3><br />
<div><br />
<p>Congo Red was purchased from Sigma Aldrich (Steiheim, Germany) and diluted in 1x PBS to a concentration of 350 uM. The final Congo Red concentration used during system characterization steps was 20 uM. This was also used, also at a concentration of 20 uM, to make LB Agar Congo Red Assay plates.</p><br />
</div><br />
<h3>3.0 Construct Assembly</h3><br />
<div><br />
<h4>3.1 Cloning of pSB-AraC-pBAD</h4><br />
<div><br />
<p>The AraC and pBAD elements were obtained by PCR, using the Biobricks BBa_K325108, BBa_K325218 and BBa_K325219 as DNA templates, all of which follow the standard structure showed on figure 7. The primers used during this procedure were as follows:<br />
</p><br />
<ul><br />
<li>Forward: TACTAGTAGCGGCCGCTGCAG</li><br />
<li>Reverse: GCTAGCCCAAAAAAACGGGTATGGAG</li><br />
</ul><br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/d/d4/IC14-ecoli-AraC-pBAD.png"><br />
<figcaption>Figure 7 - Plasmid maps describing both the original (left) and engineered (right) AraC-pBAD-containing parts, including all relevant elements. These were designed and cloned in silico on GeneDesigner.</figcaption><br />
</figure><br />
</div><br />
<p>The amplified elements were DpnI-treated following a standard procedure (New England Biolabs), and were subsequently submitted to a purification step (Qiaquick PCR clean up, Qiagen) prior to self-ligation. Three different template concentrations were tested during ligation (specifically 3 ng, 7.5 ng and 15 ng), and were incubated at room temperature for 1h+. The ligation mix was then transformed into chemically competent DH10B Escherichia coli using a standard chemical transformation protocol and plated out on Chloramphenicol-specific LB plates.</p><br />
<h4>3.2 Cloning of pSB3K3-LacI-pLAC</h4><br />
<p>A compatible plasmid and induction system was cloned to allow expression of the operon in two parts. The medium/strong promoter J23110 was cloned in front of the quad part inverter Q01121. The inverter has an RBS, the LacI repressor followed by a double terminator then a Lac inducible promoter. The composite part created give constitutive expression of the Lac repressor allowing for induction by IPTG. The parts were then moved into the pSB3k3 backbone to be compatible with pSB1C3.</p><br />
<div><br />
<br />
</div><br />
<h4>3.3 Assembly of AcsAB and AcsCD </h4><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/3/3c/IC14-ecoli-construct-assembly.jpg"><br />
<figcaption>Figure 8:</figcaption><br />
</figure><br />
<p>The AcsABCD operon was designed in silico as described in the previous section. It was ordered for synthesis at GenArt in the form of four separate elements of similar sizes, named AcsA, AcsB, AcsC and AcsD, respectively. After synthesis, the constructs were directly transformed into DH10B <em>E.coli</em> using a standard chemical transformation protocol and plated overnight supplied with 50 ug/ml Kanamycin. 5ml LB were inoculated with a freshly growing colony and grown overnight at 37 C, under shaking conditions. Glycerol stocks were produced prior to proceeding with the assembly process.</p><br />
<p>In order to meet the Registry standards, we aimed to clone these elements into pSB1C3. To do so, we proceeded as described on figure 8. Two separate rounds of digestion were carried out using EcoRI, NcoI, PvuII and PstI to, and the resulting fragments (AcsA, AcsB, AcsC and AcsD and linearized pSB1C3) were submitted to a three-part ligation after dephosphorylation of the vector backbone (rAPid desphosphorylation, Roche). An equimolar ratio amongst all three parts was established during the ligation procedure, which in turn proceeded at 4 degrees overnight. The NEB High Efficiency Transformation protocol was used on NEB 10B cells (New England Biolabs) to propagate the resulting plasmid. Transformed cells were plated and incubated overnight at 37 C. 5 ml LB supplied with 50 ug/ml Chloramphenicol were inoculated with a selection of colonies for further analysis (refer to Results for additional information).</p><br />
<br />
<h4>3.4 Assembly of pSB-AraC-pBAD-AcsAB</h4><br />
<p>AcsAB was cloned into pSB-AraC-pBAD by Biobrick cloning. The destination vector was linearized using SpeI and PstI (New England Biolabs), and AcsAB (previously digested with XbaI and PstI, and gel extracted using the Minelute Gel Extraction Kit, by Qiagen) was ligated at a 1:1 ratio throughout an overnight ligation at room temperature. The resulting part was transformed into chemically competent DH10B Escherichia coli and plated on LB Agar+Chloramphenicol plates, grown overnight at 37 C. 5 ml LB falcons supplied with 50 ug/ml Chloramphenicol were inoculated with a selection of freshly grown colonies for further restriction analysis (refer to Results for additional information)</p><br />
<br />
<h4>3.5 Assembly of pSB-LacI-pLAC-CD</h4><br />
<p>Similarly to 3.4, AcsCD was cloned by BioBrick cloning into the pSB3K3 low copy expression vector containing the LacI-pLAC regulatory elements. Vector and insert were ligated at a 1:1 ratio overnight at room temperature. After transformation and plating on LB Agar+Kanamycin (25 ug/ml), colonies were screened by Greentaq colony PCR, and were further confirmed during the Congo Red Assay.</p><br />
</div><br />
<h3>Electroporation of pSB-pLAC-CD into electrocompetent AcsAB-containing DH10B cells</h3> <br />
<div><br />
<p>DH10B E.coli already containing the AcsAB construct were made electrocompetent using a standard protocol, which can be found in the Protocols section. A second round of transformation was carried to insert pLAC-AcsCD. 5ul of miniprepped pSB-pLAC-CD (diluted in ddH2O) were added into 50ul electrocompetent DH10B cells already containing the pBAD-inducible AcsAB element. Electroporation was carried out in in 10mm electrocuvettes at 1.8 kV, 200 Ohm resistance and 25 mF capacitance. 500ul SOC medium was added to the electroporated samples and these were recovered at 37 °C for 1h before plating on Kanamycin25 + Chloramphenicol 50 LB Agar plates.</p><br />
</div><br />
<h3>Congo Red Characterization</h3><br />
<div><br />
<p>LB Agar Congo Red assay plates were prepared with a final Congo Red concentration of 20uM, and they were supplied with 0.1% Arabinose, 0.5mM IPTG, 50 ug/mL Chloramphenicol, 25 ug/mL Kanamycin and 1% Glucose. Transformed cells containing both AcsAB and AcsCD were plated on Congo Red assay plates and incubated at 37 °C. They were qualitatively assayed after 24h and 48h for cellulose production. Finally, 5 mL LB supplied with 0.1% Arabinose, 0.5mM IPTG, 50 ug/mL Chloramphenicol, 25 ug/mL Kanamycin and 1% Glucose were inoculated with freshly grown, cellulose-producing colonies and were grown for 16h at 30 °C, 180 rpm. An empty vector control was also grown overnight for comparative analysis. These liquid cultues were supplied with Congo Red, to yield a final concentration of 20uM. They were incubated under static conditions for 2h at room temperature, and were later pelleted down to allow for qualitative analysis of Congo Red binding.</p><br />
<br />
<p>AcsAB functionality was assayed by inducing AcsAB-containing cells with 0.1% Arabinose in 5mL LB supplied with 1% Glucose and Chloramphenicol. Overnight incubations were set up at 30 °C and 37 °C, and both empty vector controls and un-induced controls were also assayed. Cells were pelleted at 4000rpm for 10 minutes and the supernatant was kept for further analysis. Cells were resuspended in 1xPBS and sonicated for 3 minutes as on/off cycles of 15 seconds. Both the membrane and soluble samples produced after centrifugation were kept for further analysis. Congo Red was then added to the LB, soluble and membrane samples up to a final concentration of 20uM, and no Congo Red samples were also kept for further inspection. Samples were incubated for 2h at static conditions and at room temperature to allow for Congo Red binding. 96-well plates were inoculated for further absorbance measurements at 490nm.</p><br />
</div><br />
<br />
<br />
</div><br />
</section><br />
<br />
<br />
<section id="results"><br />
<h2>Results</h2><br />
<div class="accordion"><br />
<h3>Constructs</h3><br />
<div><br />
<p>All constructs were assembled as described in Materials and Methods. As a preliminary verification step, restriction analyses were carried out using the corresponding restriction enzymes (refer to figure legends for more details) and results were visualized on 0.7-1% agarose gels. Final confirmation was obtained by gene sequencing, during which the BioBrick Verification Primers and walking primers were used. These are shown on the table below, please refer to the Registry for further information.</p><br />
<br />
<figure class="content-image"><br />
<table class="tg image-full"><br />
<tr><br />
<th </th><br />
<th </th><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AraC-pBAD</td><br />
<td class="tg-031e">Forward: TACTAGTAGCGGCCGCTGCAG<br />
<br>Reverse: GCTAGCCCAAAAAAACGGGTATGGAG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">BioBrick Verification Primers</td><br />
<td class="tg-031e">Forward: TGCCACCTGACGTCTAAGAA<br />
<br>Reverse: ATTACCGCCTTTGAGTGAGC</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 1</td><br />
<td class="tg-031e">TCT GAA TTA TGC CAT TGG TCA TAC CG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 2</td><br />
<td class="tg-031e">ATA TGT TTC ATG CAG TTG GCA CC</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 3</td><br />
<td class="tg-031e">GAT GCA TGG GTT GAT TGG GG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 4</td><br />
<td class="tg-031e">ATC CAG CAC ATC CGA CCT TTG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 5</td><br />
<td class="tg-031e">GTT ACC GCA AGT AAA CTG CAA G</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 6</td><br />
<td class="tg-031e">GAT GGT CTG ATT CGT CTG GTT A</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 7</td><br />
<td class="tg-031e">ACG CAG CAC AGG TCA GAC CGG TGA A</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 8</td><br />
<td class="tg-031e">ATA TTG ATC TGA CCA CCG AACA</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 9</td><br />
<td class="tg-031e">TGC ACC GCC TGG TGA AAA TGG TT</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 10</td><br />
<td class="tg-031e">GTG GCT ATG CAA TTC AGA CAG GT</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 11</td><br />
<td class="tg-031e">TTC ATT CCC AGC GGT CGG TCG AT</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 12</td><br />
<td class="tg-031e">GTT TGC GTG GTG ATC TTT TT</td><br />
</tr><br />
</table><br />
<figcaption>Figure 9 - List of primers used by Team E.coli during the experimental procedure</figcaption><br />
</figure><br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/f/f8/IC14-ecoli-gel-pSB-AcsAB.jpg"><br />
<figcaption>Figure 10: pSB-AcsAB</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/c/c1/IC14-ecoli-gel-pSB-AcsCD.jpg"><br />
<figcaption>Figure 11: pSB-AcsCD</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/b/b9/IC14-ecoli-gel-pSB-AraC-pBAD.jpg"><br />
<figcaption>Figure 12: pSB-AraC-pBAD</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/e/e7/IC14-ecoli-gel-pSB-AraC-pBAD-AcsAB-pSB-LacI-AcsAB.jpg"><br />
<figcaption>Figure 13: pSB-AraC-pBAD-AcsAB and pSB-LacI-AcsAB</figcaption><br />
</figure><br />
</div><br />
<br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/4/4a/IC14-ecoli-gel-colony1.jpg"><br />
<figcaption>Figure 14: pLAC-AcsCD colony PCR results. Further details on the procedure can be found on the Methods and Materials section. Those colonies that we testes further have been highlighted with numbers on the pictures. Specifically, colony A1 was used for subcloning into AcsAB containing E.coli DH10B. <br />
Plates A and B were generated <br />
</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/1/10/IC14-ecoli-gel-colony2.jpg"><br />
<figcaption>Figure 15: pLAC-AcsCD colony PCR results. Further details on the procedure can be found on the Methods and Materials section. Those colonies that we testes further have been highlighted with numbers on the pictures. Specifically, colony A1 was used for subcloning into AcsAB containing E.coli DH10B. <br />
Plates A and B were generated <br />
</figcaption><br />
</figure><br />
</div><br />
</div><br />
<br />
<br />
<br />
</div><br />
<h3>Characterising Cellulose Production</h3><br />
<div><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/f/fe/IC14-ecoli-fig2.png"><br />
<figcaption>Figure 16:</figcaption><br />
</figure><br />
<p>Cellulose Production can be easily assayed using the diazo dye Congo Red. Congo Red specifically binds cellulostic fibrils, and this binding can be measured by spectral analysis, because it causes a shift on the spectral properties of the dye, which can be monitored with a spectrophotometer (Klunk et al., 1999). In addition to this, Congo Red also allows for visual, qualitative analysis: it causes a color change of any cellulose-producing colonies by binding to the growing fibres. Therefore, cellulose production can be easily detected by eye on LB Agar plates and liquid cultures.</p><br />
<br />
<p>We assayed cellulose production on LB Agar Congo Red assay plates. Colonies containing the refactored cellulose production machinery turned red within 24h, and presented a rougher composition and brighter red color after 48h. In contrast to this, colonies presenting empty vector (negative controls), presented no color changes and maintained the characteristics of standard <em>Escherichia coli</em> colonies (smoother composition and standard yellow colour).</p><br />
<br />
<p>To confirm this qualitative assay, a second qualitative assay was carried out, also based on Congo Red binding. This second analysis consisted of incubating overnight cultures (both cellulose producers and empty vector controls) with Congo Red as described in Materials and Methods. Cellulose producers will present growing cellulose fibres on their extracellular surface, hence will dye red in the presence of Congo Red, unlike non-cellulose-producing cells. After spinning down the cells, a red pellet was observed that corresponded to the cellulose producing colonies. In contrast to this, negative controls did not bind Congo Red and hence maintained the standard E.coli characteristics. We consider that this qualitative data supports our design and confirms that the cellulose production operon has been successfully refactored and transferred into <em>Escherichia coli</em>.</p><br />
<br />
<p>In order to gain a better understanding of the activity of the Acs elements in Escherichia coli, it was of interest to explore whether the AcsAB element alone would be enough to achieve cellulose production. AcsAB is embedded in the cytoplasmic membrane and transports the growing polymer through the membrane as it attaches the glucose monomers in the cytoplasm. In the absence of AcsC and AcsD, no cellulose can be secreted into the environment and as a result, it was assumed that it would instead become accumulated in the cell’s periplasm. For this reason, during characterization we required sonication in order to get the cellulose (if any at all) out of the cells.</p><br />
<br />
<p>To widen our screening, we set up induced samples and uninduced controls and assayed samples at different temperatures (30°C versus 37°C) and different conditions (shaking versus static) in the presence or absence of 1% D-Glucose. Furthermore, 2 Biological replicates were assayed, and technical triplicates were also set up during plate reading to support any statistically relevant findings. Although we expected no cellulose to be accumulating in the medium, we still analysed all fractions originating throughout the procedure: LB fractions, soluble fractions and non-soluble fractions (called membrane fractions throughout this study).</p><br />
<br />
<p>All fractions were incubated in the presence of Congo Red (as described in Materials and Methods) and were later inoculated into a 96-well plate for absorbance measurements at 490nm. Free Congo Red has a maximal absorption at such wavelength. By setting up a control sample, containing solvent (PBS)+ Congo Red, it is possible to measure the total absorbance of the molecule whilst free in solution. When cellulolytic samples are incubated in the presence of Congo Red, less azodye molecules becomes available in the medium due to binding, hence absorbance levels will decrease. The total Congo Red bound will equal the absorbance of Congo Red Control minus the absorbance of our samples of interest. This approach gives you an idea of the amount of Congo Red that may have bound to the cellulositic fibres, but it does not provide exact values of cellulose present.</p><br />
</div><br />
<br />
<br />
</section><br />
<section id="future"><br />
<h2>Future Work</h2><br />
<br />
</section><br />
<br />
<section id="references"><br />
<h2>References</h2><br />
<ol><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<br />
<br />
<br />
<br />
<br />
</ol><br />
</section><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
<br />
{{:Team:Imperial/Templates:footer}}</div>HChughtaihttp://2014.igem.org/Team:Imperial/Judging_CriteriaTeam:Imperial/Judging Criteria2014-10-18T03:21:32Z<p>HChughtai: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Judging Criteria</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#gold">Gold</a><br />
</li><br />
<li><a data-scroll href="#silver">Silver</a><br />
</li><br />
<li><a data-scroll href="#bronze">Bronze</a><br />
</li><br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
</div><br />
</div><br />
<div class="pure-g"><br />
<div class="pure-u-1-1"><br />
<section class="medal" id="gold"><br />
<br />
<ol><br />
<li>We improved the characterisation of parts</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/The_i_in_iGEM">Language</a> is an important part of science. We investigated the impact it had on iGEM and the competition</li><br />
<li>We explored the concept of <a href="https://2014.igem.org/Team:Imperial/Water_Report">sustainable water management and wastewater recycling</a> as solutions to water stress. We uncovered key barriers to their implementation and addressed them in our project.</li><br />
<li>We <a href="https://2014.igem.org/Team:Imperial/BioHackspace_Model">simulated</a> the bacterial cellulose 3D printing system for <a href="https://2014.igem.org/Team:London_BioHackspace">London Biohackspace</a></li><br />
</ol><br />
<br />
</section><br />
<section class="medal" id="silver"><br />
<br />
<ol><br />
<li>We experimentally validated our <a href="https://2014.igem.org/Team:Imperial/Parts">parts</a></li><br />
<li>We documented characterisation of our parts on the registry </li><br />
<li>We submitted new parts to the iGEM Parts Registry</li><br />
<li>We considered how our biomaterial could be used to address the problem of water purification and investigated the feasibility of doing so by talking with <a href="https://2014.igem.org/Team:Imperial/Informing_Design">experts</a></li><br />
</ol><br />
<br />
</section><br />
<section class="medal" id="bronze"><br />
<br />
<ol><br />
<li>We completed the <a href="https://igem.org/Team.cgi?id=1321">Team registration</a></li><br />
<li>We completed the <a href="https://igem.org/2014_Judging_Form?id=1321">Judging form</a></li><br />
<li>A Team Wiki was designed and constructed</li><br />
<li>We have prepared a poster and a talk for the iGEM Jamboree.</li><br />
<li>We have <a href="https://2014.igem.org/Team:Imperial/Attributions">attributed</a> all work to the proper persons</li><br />
<li>We have submitted <a href="https://2014.igem.org/Team:Imperial/Parts">parts</a> to the registry </li><br />
</ol><br />
<br />
</section><br />
</div><br />
<br />
<br />
<br />
<br />
</div><br />
<br />
</div><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>HChughtaihttp://2014.igem.org/Team:Imperial/Judging_CriteriaTeam:Imperial/Judging Criteria2014-10-18T03:20:05Z<p>HChughtai: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Judging Criteria</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#gold">Gold</a><br />
</li><br />
<li><a data-scroll href="#silver">Silver</a><br />
</li><br />
<li><a data-scroll href="#bronze">Bronze</a><br />
</li><br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
</div><br />
</div><br />
<div class="pure-g"><br />
<div class="pure-u-1-1"><br />
<section class="medal" id="gold"><br />
<br />
<ol><br />
<li>We improved the characterisation of parts</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Language_Study">Language</a> is an important part of science. We investigated the impact it had on iGEM and the competition</li><br />
<li>We explored the concept of <a href="https://2014.igem.org/Team:Imperial/Water_Report">sustainable water management and wastewater recycling</a> as solutions to water stress. We uncovered key barriers to their implementation and addressed them in our project.</li><br />
<li>We <a href="https://2014.igem.org/Team:Imperial/BioHackspace_Model">simulated</a> the bacterial cellulose 3D printing system for <a href="https://2014.igem.org/Team:London_BioHackspace">London Biohackspace</a></li><br />
</ol><br />
<br />
</section><br />
<section class="medal" id="silver"><br />
<br />
<ol><br />
<li>We experimentally validated our <a href="https://2014.igem.org/Team:Imperial/Parts">parts</a></li><br />
<li>We documented characterisation of our parts on the registry </li><br />
<li>We submitted new parts to the iGEM Parts Registry</li><br />
<li>We considered how our biomaterial could be used to address the problem of water purification and investigated the feasibility of doing so by talking with <a href="https://2014.igem.org/Team:Imperial/Informing_Design">experts</a></li><br />
</ol><br />
<br />
</section><br />
<section class="medal" id="bronze"><br />
<br />
<ol><br />
<li>We completed the <a href="https://igem.org/Team.cgi?id=1321">Team registration</a></li><br />
<li>We completed the <a href="https://igem.org/2014_Judging_Form?id=1321">Judging form</a></li><br />
<li>A Team Wiki was designed and constructed</li><br />
<li>We have prepared a poster and a talk for the iGEM Jamboree.</li><br />
<li>We have <a href="https://2014.igem.org/Team:Imperial/Attributions">attributed</a> all work to the proper persons</li><br />
<li>We have submitted <a href="https://2014.igem.org/Team:Imperial/Parts">parts</a> to the registry </li><br />
</ol><br />
<br />
</section><br />
</div><br />
<br />
<br />
<br />
<br />
</div><br />
<br />
</div><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>HChughtaihttp://2014.igem.org/Team:Imperial/AchievementsTeam:Imperial/Achievements2014-10-18T03:16:07Z<p>HChughtai: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<br />
<body><br />
<div class="content-wrapper"><br />
<h1>Achievements</h1><br />
<div class="pure-g"><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2>Introduction</h2><br />
<p>Our months of intense work in the lab have resulted in a variety of achievements. We’ve submitted parts to the registry, characterised existing parts, tested the binding of our CBDs, the water filtration properties of our biomaterial and fulfilled the criteria for a gold medal.<br />
</p><br />
<br />
</div><br />
<br />
</div><br />
<br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<img class="bg" src="https://static.igem.org/mediawiki/2014/1/17/IC14-awesome-1.jpg"><br />
<br />
<br />
</div><br />
<br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2>Parts</h2><br />
<p>Throughout the course of our project we both created novel parts as well as pulled existing parts from the registry. Find a full list of submitted parts here as well as some detail on our favourites.<br />
</p><br />
<div class="more-box more-box-bottom"><a href="https://2014.igem.org/Team:Imperial/Parts">read more...</a></div><br />
<br />
</div><br />
<br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2>Results</h2><br />
<p>Our many sub-projects and experiments yielded many results that have been detailed in their respective project sections. Our main results are highlighted here.<br />
</p><br />
<div class="more-box more-box-bottom"><a href="hhttps://2014.igem.org/Team:Imperial/Results">read more...</a></div><br />
<br />
</div><br />
<br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2>Judging Criteria</h2><br />
<p>We fulfilled all the requirements needed to achieve a gold medal. A summary of these can be found here.<br />
</p><br />
<div class="more-box more-box-bottom"><a href="https://2014.igem.org/Team:Imperial/Judging_Criteria">read more...</a></div><br />
<br />
</div><br />
<br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2>Interlab Study</h2><br />
<p>We participated in the interlab study to measure fluorescence from the same three genetic devices for GFP expression. This exciting experiment will allow the robustness of parts against a variety of different protocols and lab techniques to be assessed. </p><br />
<div class="more-box more-box-bottom"><a href="https://2014.igem.org/Team:Imperial/InterLab_Study">read more...</a></div><br />
<br />
<br />
</div><br />
<br />
</div><br />
<br />
</div><br />
</div><br />
<br />
<br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>HChughtaihttp://2014.igem.org/Team:Imperial/AchievementsTeam:Imperial/Achievements2014-10-18T03:13:11Z<p>HChughtai: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<br />
<body><br />
<div class="content-wrapper"><br />
<h1>Achievements</h1><br />
<div class="pure-g"><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2>Introduction</h2><br />
<p>Our months of intense work in the lab have resulted in a variety of achievements. We’ve submitted parts to the registry, characterised existing parts, tested the binding of our CBDs, the water filtration properties of our biomaterial and fulfilled the criteria for a gold medal.<br />
</p><br />
<br />
</div><br />
<br />
</div><br />
<br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<img class="bg" src="https://static.igem.org/mediawiki/2014/1/17/IC14-awesome-1.jpg"><br />
<br />
<br />
</div><br />
<br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2>Parts</h2><br />
<p>Throughout the course of our project we both created novel parts as well as pulled existing parts from the registry. Find a full list of submitted parts here as well as some detail on our favourites.<br />
</p><br />
<div class="more-box more-box-bottom"><a href="https://2014.igem.org/Team:Imperial/Parts">read more...</a></div><br />
<br />
</div><br />
<br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2>Results</h2><br />
<p>Our experiments yielded many results. They are collected in full here.<br />
</p><br />
<div class="more-box more-box-bottom"><a href="hhttps://2014.igem.org/Team:Imperial/Results">read more...</a></div><br />
<br />
</div><br />
<br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2>Judging Criteria</h2><br />
<p>We fulfilled all the requirements needed to achieve a gold medal. A summary of these can be found here.<br />
</p><br />
<div class="more-box more-box-bottom"><a href="https://2014.igem.org/Team:Imperial/Judging_Criteria">read more...</a></div><br />
<br />
</div><br />
<br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2>Interlab Study</h2><br />
<p>We participated in the interlab study to measure fluorescence from the same three genetic devices for GFP expression. This exciting experiment will allow the robustness of parts against a variety of different protocols and lab techniques to be assessed. </p><br />
<div class="more-box more-box-bottom"><a href="https://2014.igem.org/Team:Imperial/InterLab_Study">read more...</a></div><br />
<br />
<br />
</div><br />
<br />
</div><br />
<br />
</div><br />
</div><br />
<br />
<br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>HChughtaihttp://2014.igem.org/Team:Imperial/Templates:headerTeam:Imperial/Templates:header2014-10-18T03:02:23Z<p>HChughtai: </p>
<hr />
<div><html><br />
<br />
<head><br />
<meta charset="utf-8"><br />
<meta name="viewport" content="width=device-width, initial-scale=1.0"><br />
<title>Imperial iGEM 2014</title><br />
<link rel="stylesheet" href="http://code.jquery.com/ui/1.11.1/themes/smoothness/jquery-ui.css"><br />
<link rel="stylesheet" href="https://2014.igem.org/Team:Imperial/Resources/CSS:pure-nr?action=raw&ctype=text/css"><br />
<link rel="stylesheet" href="https://2014.igem.org/Team:Imperial/Resources/CSS:pure-skin?action=raw&ctype=text/css"><br />
<link rel="stylesheet" href="https://2014.igem.org/Team:Imperial/Resources/CSS:wiki?action=raw&ctype=text/css"><br />
<link rel="stylesheet" href="https://2014.igem.org/Team:Imperial/Resources/CSS:main?action=raw&ctype=text/css"><br />
<link rel="stylesheet" href="https://2014.igem.org/Team:Imperial/Resources/CSS:bxslider?action=raw&ctype=text/css"><br />
<link rel="stylesheet" href="https://2014.igem.org/Team:Imperial/Resources/CSS:colorbox?action=raw&ctype=text/css"><br />
<link rel="stylesheet" href="https://2014.igem.org/Team:Imperial/Resources/CSS:timeline?action=raw&ctype=text/css"><br />
<br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,300,700' rel='stylesheet' type='text/css'><br />
<link href='http://fonts.googleapis.com/css?family=Noto+Sans:400,700,400italic,700italic' rel='stylesheet' type='text/css'><br />
<br />
<br />
<script src="http://yui.yahooapis.com/3.17.2/build/yui/yui-min.js"></script><br />
<script src="http://ajax.googleapis.com/ajax/libs/jquery/1.11.1/jquery.min.js"></script><br />
<script src="http://code.jquery.com/ui/1.11.1/jquery-ui.js"></script><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:bxslider?action=raw&ctype=text/js"></script><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:team?action=raw&ctype=text/js"></script><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:log?action=raw&ctype=text/js"></script><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:subNav?action=raw&ctype=text/js"></script><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:bind-polyfill?action=raw&ctype=text/js"></script><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:smooth-scroll?action=raw&ctype=text/js"></script><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:colorbox?action=raw&ctype=text/js"></script><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<script><br />
$(document).ready(function () {<br />
$('.bxslider').bxSlider({<br />
<br />
});<br />
YUI({<br />
classNamePrefix: 'pure'<br />
}).use('gallery-sm-menu', function (Y) {<br />
<br />
var horizontalMenu = new Y.Menu({<br />
container: '#main_nav',<br />
sourceNode: '#std-menu-items',<br />
orientation: 'horizontal',<br />
hideOnOutsideClick: false,<br />
hideOnClick: false<br />
});<br />
<br />
horizontalMenu.render();<br />
horizontalMenu.show();<br />
<br />
});<br />
$(".youtube").colorbox({<br />
iframe: true,<br />
innerWidth: 640,<br />
innerHeight: 390<br />
});<br />
<br />
$(".iframe").colorbox({<br />
iframe: true,<br />
width: "80%",<br />
height: "80%"<br />
});<br />
$(".accordion").accordion({<br />
heightStyle: "content",<br />
collapsible: true,<br />
active: false<br />
});<br />
smoothScroll.init({<br />
offset: 40<br />
<br />
});<br />
<br />
<br />
});<br />
</script><br />
<br />
<br />
<script><br />
(function (i, s, o, g, r, a, m) {<br />
i['GoogleAnalyticsObject'] = r;<br />
i[r] = i[r] || function () {<br />
(i[r].q = i[r].q || []).push(arguments)<br />
}, i[r].l = 1 * new Date();<br />
a = s.createElement(o),<br />
m = s.getElementsByTagName(o)[0];<br />
a.async = 1;<br />
a.src = g;<br />
m.parentNode.insertBefore(a, m)<br />
})(window, document, 'script', '//www.google-analytics.com/analytics.js', 'ga');<br />
<br />
ga('create', 'UA-54018926-1', 'auto');<br />
ga('send', 'pageview');<br />
</script><br />
</head><br />
<br />
<br />
<body><br />
<div class="wrapper"><br />
<div class="header"><br />
<br />
<div class="header-banner"><br />
<div class="left"><br />
<a href="https://2014.igem.org/Team:Imperial"><img id="logo-img" src="https://static.igem.org/mediawiki/2014/e/e1/IC14-logo.png"></a><br />
<a style="text-decoration: none" href="https://2014.igem.org/Team:Imperial"><h1 id="Logo">Aqualose</h1></a><br />
</div><br />
<div class="right"><br />
<br />
<a target="_blank" href="http://twitter.com/imperialigem"><br />
<img class="social" src="https://static.igem.org/mediawiki/2014/3/37/IC14-logo-twitter.png"><br />
</a><br />
<a target="_blank" href="http://www.facebook.com/imperialigem2014"><br />
<img class="social" src="https://static.igem.org/mediawiki/2014/8/87/IC14-logo-facebook.png"><br />
</a><br />
<a target="_blank" href="http://www.imperial.ac.uk/"><br />
<img class="social" src="https://static.igem.org/mediawiki/2014/3/38/IC14-logo-imperial-black.png"><br />
</a><br />
<a target="_blank" href="https://2014.igem.org/"><br />
<img class="social" src="https://static.igem.org/mediawiki/2014/1/12/IC14-logo-igem.png"><br />
</a><br />
</div><br />
<br />
</div><br />
<br />
<br />
<div id="main_nav" class="pure-menu pure-menu-open pure-menu-horizontal"><br />
<ul id="std-menu-items"><br />
<li> <a href=#>Project</a><br />
<ul><br />
<li> <a href="https://2014.igem.org/Team:Imperial/Project">Overview</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Project_Background">Background</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Gluconacetobacter"><em>G. xylinus</em></a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/EColi"><em>E. coli</em></a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/coculture">Co-culture</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Functionalisation">Functionalisation</a><br />
</li><br />
<br />
<li><a href="https://2014.igem.org/Team:Imperial/Mass_Production_and_Processing">Mass Production and Processing</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Mechanical_Testing">Mechanical Testing</a><br />
</li><br />
</ul><br />
</li><br />
<li> <a href=#>Achievements</a><br />
<ul><br />
<li> <a href="https://2014.igem.org/Team:Imperial/Achievements">Overview</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Parts">Parts</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Results">Results</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Judging_Criteria">Judging Criteria</a><br />
</li><br />
<li> <a href="https://2014.igem.org/Team:Imperial/InterLab_Study">Interlab Study</a><br />
</li><br />
</ul><br />
</li><br />
<br />
<br />
<li> <a href=#>Application</a><br />
<ul><br />
<li><a href="https://2014.igem.org/Team:Imperial/Implementation">Implementation</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Water_Filtration">Water Filtration</a><br />
</li><br />
<br />
<br />
</ul><br />
</li><br />
<br />
<br />
<br />
<br />
<br />
<li> <a href=#>Policy & Practices</a><br />
<ul><br />
<li> <a href="https://2014.igem.org/Team:Imperial/Policy_and_Practices">Overview</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Informing_Design">Informing Design</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Water_Report">Water Report</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/The_i_in_iGEM">The i in iGEM</a><br />
</li><br />
<br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Outreach">Outreach</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Collaborations">Collaborations</a><br />
</li><br />
<br />
<br />
</ul><br />
</li><br />
<li> <a href=#>Modelling</a><br />
<ul><br />
<li> <a href="https://2014.igem.org/Team:Imperial/Modelling">Overview</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Induction_Model">Induction Model</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/CBD_Kinetics_Model">CBD Kinetics Model</a><br />
</li><br />
<!--<li><a href="https://2014.igem.org/Team:Imperial/Pellicle_Model">Pellicle Model</a><br />
</li>--><br />
<li><a href="https://2014.igem.org/Team:Imperial/Nutrient_Diffusion_Simulations">Nutrient Diffusion Simulations</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/BioHackspace_Model">BioHackspace Model</a><br />
</li><br />
<br />
</ul><br />
</li><br />
<br />
<li> <a href=#>Notebook</a><br />
<ul><br />
<li> <a href="https://2014.igem.org/Team:Imperial/Notebook">Overview</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Lab-book">Lab-book</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Protocols">Protocols</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Brainstorming">Brainstorming</a><br />
</li><br />
</ul><br />
</li><br />
<br />
<li> <a href="https://2014.igem.org/Team:Imperial/Safety">Safety</a><br />
</li><br />
<br />
<li><a href="https://2014.igem.org/Team:Imperial/Art_and_Design">Art & Design</a><br />
</li><br />
<br />
<li> <a href="#">Team</a><br />
<ul><br />
<li><a href="https://igem.org/Team.cgi?id=1321">Official Profile</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Students">Students</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Instructors_and_Advisors">Instructors and Advisors</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Sponsors">Sponsors</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Attributions">Attributions</a><br />
</li><br />
</ul><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<br />
<br />
</body><br />
<br />
</html></div>HChughtaihttp://2014.igem.org/Team:Imperial/ModellingTeam:Imperial/Modelling2014-10-18T03:01:19Z<p>HChughtai: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<br />
<body><br />
<div class="content-wrapper"><br />
<h1>Modelling</h1><br />
<div class="pure-g"><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2>Introduction</h2><br />
<p>We approached cellulose production and modification with several key questions: Which conditions produce the greatest yields? When should we induce over-production? How efficient will our functionalised cellulose be? We performed in-silico experiments, informed by our wet-lab work, to study growth, cellulose synthesis and the activity of our biomaterial. The results were integrated back into our experiments to enhance the production and function of our biomaterial.</p><br />
<br />
</div><br />
<br />
</div><br />
<br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<img class="bg" src="https://static.igem.org/mediawiki/2014/1/15/IC14-modelling-wowcode.png"><br />
<br />
</div><br />
<br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2>Induction Model</h2><br />
<p><em>ATCC53582</em> is capable of inducible high yielding bacterial cellulose production controlled by IPTG concentrations. This model predicts the optimal time of inducing cellulose production during bacterial population growth in order to maximise yields. </p><br />
<div class="more-box more-box-bottom"><a href="https://2014.igem.org/Team:Imperial/Induction_Model">read more...</a></div><br />
<br />
</div><br />
<br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2>CBD Kinetics Model</h2><br />
<p> The kinetics of attaching cellulose-binding domains (CBDs) to cellulose can be modelled using differential equations. This model calculates the time required for a specified percentage of binding sites on bacterial cellulose to be saturated given an initial concentration of available CBDs.</p><br />
<div class="more-box more-box-bottom"><a href="https://2014.igem.org/Team:Imperial/CBD_Kinetics_Model">read more...</a></div><br />
<br />
</div><br />
<br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2>Nutrient Diffusion Simulations</h2><br />
<p> This approach simulates the growth and maintenance of cell population under satisfied nutrient condition as well as taking individual cell motility into consideration and attempting to capture the decision making and orienting processes of each cell. </p><br />
<div class="more-box more-box-bottom"><a href="2014.igem.org/Team:Imperial/Nutrient_Diffusion_Simulations">read more...</a></div><br />
<br />
</div><br />
<br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2>BioHackspace Model</h2><br />
<p>The collaboration is dedicated to provide <a target="blank_" href="https://2014.igem.org/Team:London_BioHackspace">London BioHackspace iGEM Team</a> an easy approach to simulate the 3D shape of their bacterial cellulose (BC) sculpture. </p><br />
<div class="more-box more-box-bottom"><a href="https://2014.igem.org/Team:Imperial/BioHackspace_Model">read more...</a></div><br />
<br />
</div><br />
<br />
</div><br />
<br />
</div><br />
</div><br />
</body><br />
<br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>HChughtaihttp://2014.igem.org/Team:Imperial/Nutrient_Diffusion_SimulationsTeam:Imperial/Nutrient Diffusion Simulations2014-10-18T02:59:07Z<p>HChughtai: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Nutrient Diffusion Simulations</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#introduction">Introduction</a><br />
</li><br />
<br />
<li><a data-scroll href="#part1">Part One: Growth and Maintenance Simulation</a><br />
</li><br />
<li><a data-scroll href="#part2" >Part Two: Orientation and Mobility Consideration</a><br />
</li><br />
<br />
<li><a data-scroll href="#code">Appendix: Code</a><br />
</li><br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<br />
<section id="introduction"><br />
<h2>Introduction</h2><br />
<img style="display:inline-block;float:right" src="https://static.igem.org/mediawiki/2014/3/36/IC14-NDS-scale.png"><br />
<p>The model has two parts: first part of the model simulates the growth and maintenance of cell population under satisfied nutrient condition. The second part of the model takes individual cell motility into consideration and attempted to capture the decision making and orienting processes of each cell. The main difference between two parts is that the first part considers population-level cellular activity while the second part considers cells individually with each cell having a specific coordinate.</p><br />
<br />
</section><br />
<section id="part1"><br />
<h2>Part One: Growth and Maintenance Simulation</h2><br />
<h3>Description</h3><br />
<p>Based on the assumption that the pellicle growth is linearly proportional to glucose, acetate and oxygen consumption, a model is constructed to visualise the varying two dimensional profile of nutrient concentration. In particular, this is done with respect to nutrient depletion, periodic addition and diffusion within the culture environment. The model can be used to identify regions suitable for cell growth based on local nutrient concentration profiles. As result, a map of cell density distribution can be obtained.</p><br />
<h3>Simulations of Nutrient Profiles</h3><br />
<h4>Oxygen Profile</h4><br />
<figure class="content-image image-half"><br />
<iframe style="float:left" class="image-full" width="560" height="315" src="//www.youtube.com/embed//uTE9gG5VoLU?rel=0" frameborder="0" allowfullscreen></iframe><br />
<figcaption>A video demonstration for the model GUI</figcaption><br />
</figure><br />
<br />
<h4>Glucose Profile</h4><br />
<figure class="content-image image-half"><br />
<iframe class="image-full" width="560" height="315" src="//www.youtube.com/embed//k0gkzAL831M?rel=0" frameborder="0" allowfullscreen></iframe><br />
<figcaption>A video demonstration for the model GUI</figcaption><br />
</figure><br />
<h3>Simulation Conditions</h3><br />
<ol><br />
<li>Cell growth occurs only when nutrient conditions are satisfied and cell growth is dependent on local oxygen, glucose and acetate concentration;</li><br />
<li>For unit cell, uptake of nutrient for maintenance is constant;</li><br />
<li>Cell population is increasing exponentially;</li><br />
<li>Bacterial cellulose is only produced with the presence of cells and BC production is linearly proportional to cell population;</li><br />
<li>Glucose consumption for bacterial cellulose is linearly proportional to cell population where glucose is directed to both cellulose production and cell growth and maintenance.</li><br />
<li>Nutrients (glucose and acetate) are added periodically on the top of the media.</li><br />
</ol><br />
<h3>Interaction with Wetlab</h3><br />
<p>By simulating the nutrient diffusion and depletion processes, the model can be used to compute a nutrient addition schedule and to simulate the impact of different nutrient supply rates.</p><br />
<br />
</section><br />
<br />
<br />
<section id="part2"><br />
<h2>Part Two: Orientation and Mobility Consideration</h2><br />
<img style="display:inline-block;float:right" src="https://static.igem.org/mediawiki/2014/3/36/IC14-NDS-scale.png"><br />
<h3>Description</h3><br />
<p>Based on the nutrient profiles obtained from simulations of the first part of the model, the second part is designed to account for cell movement along high-nutrient gradients. This second part of the model thus aims to capture chemotaxis, i.e. the ability of cells to sense their surrounding nutrient environment and consequently move towards nutrient-rich regions.</p><br />
<h3>Simulations of Nutrient Profiles</h3><br />
<h4>Oxygen Profile</h4><br />
<figure class="content-image image-half"><br />
<iframe class="image-full" width="560" height="315" src="//www.youtube.com/embed//sCjRg3AxT_w?rel=0" frameborder="0" allowfullscreen></iframe><br />
<figcaption>A video demonstration for the model GUI</figcaption><br />
</figure><br />
<br />
<h4>Glucose Profile</h4><br />
<figure class="content-image image-half"><br />
<iframe class="image-full" width="560" height="315" src="//www.youtube.com/embed//2717wJxAxYg?rel=0" frameborder="0" allowfullscreen></iframe><br />
<figcaption>A video demonstration for the model GUI</figcaption><br />
</figure><br />
<h3>Simulation Conditions</h3><br />
<p>Based on the simulation conditions described in part one of the model, the second part of the model is used to capture the effects of cell movement towards nutrient rich regions (chemotaxis). The “decision” for cell movement is based on the cell’s need for nutrient, i.e. acetate or glucose. The cell will first make a decision about its nutrient need according to its local nutrient status: if the local nutrient concentration does not meet its growth requirements, then the cell will move towards the closest region with a richer nutrient concentration. Otherwise, the cell will either stay where it is or move randomly around its current position.</p><br />
<h3>Interaction with Wetlab</h3><br />
<p>Model simulations provide a visual representation of cell movement, which, in turn, allows for a better understanding of cell location and topological density within the system. The model also provides a means to confirm the observation that BC is mainly produced at the surface of the liquid media (where cells have an adequate access to oxygen), which also has an implication on the upregulating effect of oxygen on BC production.</p><br />
<br />
</section><br />
<br />
<br />
<section id="code"><br />
<h2>Appendix: Code</h2><br />
<br />
<p>The code for this model can be found here: <a href="https://static.igem.org/mediawiki/2014/6/63/Nurient_Diffusion_Simulations_Imperial_iGEM_2014.m">Nutrient_Diffusion_Simulations_Imperial_iGEM_2014.m</a></p><br />
</section><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>HChughtaihttp://2014.igem.org/Team:Imperial/Nutrient_Diffusion_SimulationsTeam:Imperial/Nutrient Diffusion Simulations2014-10-18T02:58:00Z<p>HChughtai: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Nutrient Diffusion Simulations</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#introduction">Introduction</a><br />
</li><br />
<br />
<li><a data-scroll href="#part1">Part One: Growth and Maintenance Simulation</a><br />
</li><br />
<li><a data-scroll href="#part2" >Part Two: Orientation and Mobility Consideration</a><br />
</li><br />
<br />
<li><a data-scroll href="#code">Appendix: Code</a><br />
</li><br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<br />
<section id="introduction"><br />
<h2>Introduction</h2><br />
<img style="display:inline-block;float:right" src="https://static.igem.org/mediawiki/2014/3/36/IC14-NDS-scale.png"><br />
<p>The model has two parts: first part of the model simulates the growth and maintenance of cell population under satisfied nutrient condition. The second part of the model takes individual cell motility into consideration and attempted to capture the decision making and orienting processes of each cell. The main difference between two parts is that the first part considers population-level cellular activity while the second part considers cells individually with each cell having a specific coordinate.</p><br />
<br />
</section><br />
<section id="part1"><br />
<h2>Part One: Growth and Maintenance Simulation</h2><br />
<h3>Description</h3><br />
<p>Based on the assumption that the pellicle growth is linearly proportional to glucose, acetate and oxygen consumption, a model is constructed to visualise the varying two dimensional profile of nutrient concentration. In particular, this is done with respect to nutrient depletion, periodic addition and diffusion within the culture environment. The model can be used to identify regions suitable for cell growth based on local nutrient concentration profiles. As result, a map of cell density distribution can be obtained.</p><br />
<h3>Simulations of Nutrient Profiles</h3><br />
<h4>Oxygen Profile</h4><br />
<figure class="content-image image-half"><br />
<iframe style="float:left" class="image-full" width="560" height="315" src="//www.youtube.com/embed//uTE9gG5VoLU?rel=0" frameborder="0" allowfullscreen></iframe><br />
<figcaption>A video demonstration for the model GUI</figcaption><br />
</figure><br />
<br />
<h4>Glucose Profile</h4><br />
<figure class="content-image image-half"><br />
<iframe class="image-full" width="560" height="315" src="//www.youtube.com/embed//k0gkzAL831M?rel=0" frameborder="0" allowfullscreen></iframe><br />
<figcaption>A video demonstration for the model GUI</figcaption><br />
</figure><br />
<h3>Simulation Conditions</h3><br />
<ol><br />
<li>Cell growth occurs only when nutrient conditions are satisfied and cell growth is dependent on local oxygen, glucose and acetate concentration;</li><br />
<li>For unit cell, uptake of nutrient for maintenance is constant;</li><br />
<li>Cell population is increasing exponentially;</li><br />
<li>Bacterial cellulose is only produced with the presence of cells and BC production is linearly proportional to cell population;</li><br />
<li>Glucose consumption for bacterial cellulose is linearly proportional to cell population where glucose is directed to both cellulose production and cell growth and maintenance.</li><br />
<li>Nutrients (glucose and acetate) are added periodically on the top of the media.</li><br />
</ol><br />
<h3>Interaction with Wetlab</h3><br />
<p>By simulating the nutrient diffusion and depletion processes, the model can be used to compute a nutrient addition schedule and to simulate the impact of different nutrient supply rates.</p><br />
<br />
</section><br />
<br />
<br />
<section id="part2"><br />
<h2>Part Two: Orientation and Mobility Consideration</h2><br />
<h3>Description</h3><br />
<p>Based on the nutrient profiles obtained from simulations of the first part of the model, the second part is designed to account for cell movement along high-nutrient gradients. This second part of the model thus aims to capture chemotaxis, i.e. the ability of cells to sense their surrounding nutrient environment and consequently move towards nutrient-rich regions.</p><br />
<h3>Simulations of Nutrient Profiles</h3><br />
<h4>Oxygen Profile</h4><br />
<figure class="content-image image-half"><br />
<iframe class="image-full" width="560" height="315" src="//www.youtube.com/embed//sCjRg3AxT_w?rel=0" frameborder="0" allowfullscreen></iframe><br />
<figcaption>A video demonstration for the model GUI</figcaption><br />
</figure><br />
<br />
<h4>Glucose Profile</h4><br />
<figure class="content-image image-half"><br />
<iframe class="image-full" width="560" height="315" src="//www.youtube.com/embed//2717wJxAxYg?rel=0" frameborder="0" allowfullscreen></iframe><br />
<figcaption>A video demonstration for the model GUI</figcaption><br />
</figure><br />
<h3>Simulation Conditions</h3><br />
<p>Based on the simulation conditions described in part one of the model, the second part of the model is used to capture the effects of cell movement towards nutrient rich regions (chemotaxis). The “decision” for cell movement is based on the cell’s need for nutrient, i.e. acetate or glucose. The cell will first make a decision about its nutrient need according to its local nutrient status: if the local nutrient concentration does not meet its growth requirements, then the cell will move towards the closest region with a richer nutrient concentration. Otherwise, the cell will either stay where it is or move randomly around its current position.</p><br />
<h3>Interaction with Wetlab</h3><br />
<p>Model simulations provide a visual representation of cell movement, which, in turn, allows for a better understanding of cell location and topological density within the system. The model also provides a means to confirm the observation that BC is mainly produced at the surface of the liquid media (where cells have an adequate access to oxygen), which also has an implication on the upregulating effect of oxygen on BC production.</p><br />
<br />
</section><br />
<br />
<br />
<section id="code"><br />
<h2>Appendix: Code</h2><br />
<br />
<p>The code for this model can be found here: <a href="https://static.igem.org/mediawiki/2014/6/63/Nurient_Diffusion_Simulations_Imperial_iGEM_2014.m">Nutrient_Diffusion_Simulations_Imperial_iGEM_2014.m</a></p><br />
</section><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>HChughtaihttp://2014.igem.org/Team:Imperial/Nutrient_Diffusion_SimulationsTeam:Imperial/Nutrient Diffusion Simulations2014-10-18T02:57:00Z<p>HChughtai: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Nutrient Diffusion Simulations</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#introduction">Introduction</a><br />
</li><br />
<br />
<li><a data-scroll href="#part1">Part One: Growth and Maintenance Simulation</a><br />
</li><br />
<li><a data-scroll href="#part2" >Part Two: Orientation and Mobility Consideration</a><br />
</li><br />
<br />
<li><a data-scroll href="#code">Appendix: Code</a><br />
</li><br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<br />
<section id="introduction"><br />
<h2>Introduction</h2><br />
<p>The model has two parts: first part of the model simulates the growth and maintenance of cell population under satisfied nutrient condition. The second part of the model takes individual cell motility into consideration and attempted to capture the decision making and orienting processes of each cell. The main difference between two parts is that the first part considers population-level cellular activity while the second part considers cells individually with each cell having a specific coordinate.</p><br />
<br />
</section><br />
<section id="part1"><br />
<h2>Part One: Growth and Maintenance Simulation</h2><br />
<h3>Description</h3><br />
<p>Based on the assumption that the pellicle growth is linearly proportional to glucose, acetate and oxygen consumption, a model is constructed to visualise the varying two dimensional profile of nutrient concentration. In particular, this is done with respect to nutrient depletion, periodic addition and diffusion within the culture environment. The model can be used to identify regions suitable for cell growth based on local nutrient concentration profiles. As result, a map of cell density distribution can be obtained.</p><br />
<h3>Simulations of Nutrient Profiles</h3><br />
<h4>Oxygen Profile</h4><br />
<figure class="content-image image-half"><br />
<iframe style="float:left" class="image-full" width="560" height="315" src="//www.youtube.com/embed//uTE9gG5VoLU?rel=0" frameborder="0" allowfullscreen></iframe><br />
<img style="display:inline-block;float:right" src="https://static.igem.org/mediawiki/2014/3/36/IC14-NDS-scale.png"><br />
<figcaption>A video demonstration for the model GUI</figcaption><br />
</figure><br />
<br />
<h4>Glucose Profile</h4><br />
<figure class="content-image image-half"><br />
<iframe class="image-full" width="560" height="315" src="//www.youtube.com/embed//k0gkzAL831M?rel=0" frameborder="0" allowfullscreen></iframe><br />
<figcaption>A video demonstration for the model GUI</figcaption><br />
</figure><br />
<h3>Simulation Conditions</h3><br />
<ol><br />
<li>Cell growth occurs only when nutrient conditions are satisfied and cell growth is dependent on local oxygen, glucose and acetate concentration;</li><br />
<li>For unit cell, uptake of nutrient for maintenance is constant;</li><br />
<li>Cell population is increasing exponentially;</li><br />
<li>Bacterial cellulose is only produced with the presence of cells and BC production is linearly proportional to cell population;</li><br />
<li>Glucose consumption for bacterial cellulose is linearly proportional to cell population where glucose is directed to both cellulose production and cell growth and maintenance.</li><br />
<li>Nutrients (glucose and acetate) are added periodically on the top of the media.</li><br />
</ol><br />
<h3>Interaction with Wetlab</h3><br />
<p>By simulating the nutrient diffusion and depletion processes, the model can be used to compute a nutrient addition schedule and to simulate the impact of different nutrient supply rates.</p><br />
<br />
</section><br />
<br />
<br />
<section id="part2"><br />
<h2>Part Two: Orientation and Mobility Consideration</h2><br />
<h3>Description</h3><br />
<p>Based on the nutrient profiles obtained from simulations of the first part of the model, the second part is designed to account for cell movement along high-nutrient gradients. This second part of the model thus aims to capture chemotaxis, i.e. the ability of cells to sense their surrounding nutrient environment and consequently move towards nutrient-rich regions.</p><br />
<h3>Simulations of Nutrient Profiles</h3><br />
<h4>Oxygen Profile</h4><br />
<figure class="content-image image-half"><br />
<iframe class="image-full" width="560" height="315" src="//www.youtube.com/embed//sCjRg3AxT_w?rel=0" frameborder="0" allowfullscreen></iframe><br />
<figcaption>A video demonstration for the model GUI</figcaption><br />
</figure><br />
<br />
<h4>Glucose Profile</h4><br />
<figure class="content-image image-half"><br />
<iframe class="image-full" width="560" height="315" src="//www.youtube.com/embed//2717wJxAxYg?rel=0" frameborder="0" allowfullscreen></iframe><br />
<figcaption>A video demonstration for the model GUI</figcaption><br />
</figure><br />
<h3>Simulation Conditions</h3><br />
<p>Based on the simulation conditions described in part one of the model, the second part of the model is used to capture the effects of cell movement towards nutrient rich regions (chemotaxis). The “decision” for cell movement is based on the cell’s need for nutrient, i.e. acetate or glucose. The cell will first make a decision about its nutrient need according to its local nutrient status: if the local nutrient concentration does not meet its growth requirements, then the cell will move towards the closest region with a richer nutrient concentration. Otherwise, the cell will either stay where it is or move randomly around its current position.</p><br />
<h3>Interaction with Wetlab</h3><br />
<p>Model simulations provide a visual representation of cell movement, which, in turn, allows for a better understanding of cell location and topological density within the system. The model also provides a means to confirm the observation that BC is mainly produced at the surface of the liquid media (where cells have an adequate access to oxygen), which also has an implication on the upregulating effect of oxygen on BC production.</p><br />
<br />
</section><br />
<br />
<br />
<section id="code"><br />
<h2>Appendix: Code</h2><br />
<br />
<p>The code for this model can be found here: <a href="https://static.igem.org/mediawiki/2014/6/63/Nurient_Diffusion_Simulations_Imperial_iGEM_2014.m">Nutrient_Diffusion_Simulations_Imperial_iGEM_2014.m</a></p><br />
</section><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>HChughtaihttp://2014.igem.org/Team:Imperial/Nutrient_Diffusion_SimulationsTeam:Imperial/Nutrient Diffusion Simulations2014-10-18T02:56:10Z<p>HChughtai: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Nutrient Diffusion Simulations</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#introduction">Introduction</a><br />
</li><br />
<br />
<li><a data-scroll href="#part1">Part One: Growth and Maintenance Simulation</a><br />
</li><br />
<li><a data-scroll href="#part2" >Part Two: Orientation and Mobility Consideration</a><br />
</li><br />
<br />
<li><a data-scroll href="#code">Appendix: Code</a><br />
</li><br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<br />
<section id="introduction"><br />
<h2>Introduction</h2><br />
<p>The model has two parts: first part of the model simulates the growth and maintenance of cell population under satisfied nutrient condition. The second part of the model takes individual cell motility into consideration and attempted to capture the decision making and orienting processes of each cell. The main difference between two parts is that the first part considers population-level cellular activity while the second part considers cells individually with each cell having a specific coordinate.</p><br />
<br />
</section><br />
<section id="part1"><br />
<h2>Part One: Growth and Maintenance Simulation</h2><br />
<h3>Description</h3><br />
<p>Based on the assumption that the pellicle growth is linearly proportional to glucose, acetate and oxygen consumption, a model is constructed to visualise the varying two dimensional profile of nutrient concentration. In particular, this is done with respect to nutrient depletion, periodic addition and diffusion within the culture environment. The model can be used to identify regions suitable for cell growth based on local nutrient concentration profiles. As result, a map of cell density distribution can be obtained.</p><br />
<h3>Simulations of Nutrient Profiles</h3><br />
<h4>Oxygen Profile</h4><br />
<figure class="content-image image-half"><br />
<iframe style="float:left" class="image-full" width="560" height="315" src="//www.youtube.com/embed//uTE9gG5VoLU?rel=0" frameborder="0" allowfullscreen></iframe><br />
<img style="float:right" src="https://static.igem.org/mediawiki/2014/3/36/IC14-NDS-scale.png"><br />
<figcaption>A video demonstration for the model GUI</figcaption><br />
</figure><br />
<br />
<h4>Glucose Profile</h4><br />
<figure class="content-image image-half"><br />
<iframe class="image-full" width="560" height="315" src="//www.youtube.com/embed//k0gkzAL831M?rel=0" frameborder="0" allowfullscreen></iframe><br />
<figcaption>A video demonstration for the model GUI</figcaption><br />
</figure><br />
<h3>Simulation Conditions</h3><br />
<ol><br />
<li>Cell growth occurs only when nutrient conditions are satisfied and cell growth is dependent on local oxygen, glucose and acetate concentration;</li><br />
<li>For unit cell, uptake of nutrient for maintenance is constant;</li><br />
<li>Cell population is increasing exponentially;</li><br />
<li>Bacterial cellulose is only produced with the presence of cells and BC production is linearly proportional to cell population;</li><br />
<li>Glucose consumption for bacterial cellulose is linearly proportional to cell population where glucose is directed to both cellulose production and cell growth and maintenance.</li><br />
<li>Nutrients (glucose and acetate) are added periodically on the top of the media.</li><br />
</ol><br />
<h3>Interaction with Wetlab</h3><br />
<p>By simulating the nutrient diffusion and depletion processes, the model can be used to compute a nutrient addition schedule and to simulate the impact of different nutrient supply rates.</p><br />
<br />
</section><br />
<br />
<br />
<section id="part2"><br />
<h2>Part Two: Orientation and Mobility Consideration</h2><br />
<h3>Description</h3><br />
<p>Based on the nutrient profiles obtained from simulations of the first part of the model, the second part is designed to account for cell movement along high-nutrient gradients. This second part of the model thus aims to capture chemotaxis, i.e. the ability of cells to sense their surrounding nutrient environment and consequently move towards nutrient-rich regions.</p><br />
<h3>Simulations of Nutrient Profiles</h3><br />
<h4>Oxygen Profile</h4><br />
<figure class="content-image image-half"><br />
<iframe class="image-full" width="560" height="315" src="//www.youtube.com/embed//sCjRg3AxT_w?rel=0" frameborder="0" allowfullscreen></iframe><br />
<figcaption>A video demonstration for the model GUI</figcaption><br />
</figure><br />
<br />
<h4>Glucose Profile</h4><br />
<figure class="content-image image-half"><br />
<iframe class="image-full" width="560" height="315" src="//www.youtube.com/embed//2717wJxAxYg?rel=0" frameborder="0" allowfullscreen></iframe><br />
<figcaption>A video demonstration for the model GUI</figcaption><br />
</figure><br />
<h3>Simulation Conditions</h3><br />
<p>Based on the simulation conditions described in part one of the model, the second part of the model is used to capture the effects of cell movement towards nutrient rich regions (chemotaxis). The “decision” for cell movement is based on the cell’s need for nutrient, i.e. acetate or glucose. The cell will first make a decision about its nutrient need according to its local nutrient status: if the local nutrient concentration does not meet its growth requirements, then the cell will move towards the closest region with a richer nutrient concentration. Otherwise, the cell will either stay where it is or move randomly around its current position.</p><br />
<h3>Interaction with Wetlab</h3><br />
<p>Model simulations provide a visual representation of cell movement, which, in turn, allows for a better understanding of cell location and topological density within the system. The model also provides a means to confirm the observation that BC is mainly produced at the surface of the liquid media (where cells have an adequate access to oxygen), which also has an implication on the upregulating effect of oxygen on BC production.</p><br />
<br />
</section><br />
<br />
<br />
<section id="code"><br />
<h2>Appendix: Code</h2><br />
<br />
<p>The code for this model can be found here: <a href="https://static.igem.org/mediawiki/2014/6/63/Nurient_Diffusion_Simulations_Imperial_iGEM_2014.m">Nutrient_Diffusion_Simulations_Imperial_iGEM_2014.m</a></p><br />
</section><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>HChughtaihttp://2014.igem.org/Team:Imperial/Nutrient_Diffusion_SimulationsTeam:Imperial/Nutrient Diffusion Simulations2014-10-18T02:55:27Z<p>HChughtai: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Nutrient Diffusion Simulations</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#introduction">Introduction</a><br />
</li><br />
<br />
<li><a data-scroll href="#part1">Part One: Growth and Maintenance Simulation</a><br />
</li><br />
<li><a data-scroll href="#part2" >Part Two: Orientation and Mobility Consideration</a><br />
</li><br />
<br />
<li><a data-scroll href="#code">Appendix: Code</a><br />
</li><br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<br />
<section id="introduction"><br />
<h2>Introduction</h2><br />
<p>The model has two parts: first part of the model simulates the growth and maintenance of cell population under satisfied nutrient condition. The second part of the model takes individual cell motility into consideration and attempted to capture the decision making and orienting processes of each cell. The main difference between two parts is that the first part considers population-level cellular activity while the second part considers cells individually with each cell having a specific coordinate.</p><br />
<br />
</section><br />
<section id="part1"><br />
<h2>Part One: Growth and Maintenance Simulation</h2><br />
<h3>Description</h3><br />
<p>Based on the assumption that the pellicle growth is linearly proportional to glucose, acetate and oxygen consumption, a model is constructed to visualise the varying two dimensional profile of nutrient concentration. In particular, this is done with respect to nutrient depletion, periodic addition and diffusion within the culture environment. The model can be used to identify regions suitable for cell growth based on local nutrient concentration profiles. As result, a map of cell density distribution can be obtained.</p><br />
<h3>Simulations of Nutrient Profiles</h3><br />
<h4>Oxygen Profile</h4><br />
<figure class="content-image image-half"><br />
<iframe class="image-full" width="560" height="315" src="//www.youtube.com/embed//uTE9gG5VoLU?rel=0" frameborder="0" allowfullscreen></iframe><br />
<img class="image-right" src="https://static.igem.org/mediawiki/2014/3/36/IC14-NDS-scale.png"><br />
<figcaption>A video demonstration for the model GUI</figcaption><br />
</figure><br />
<br />
<h4>Glucose Profile</h4><br />
<figure class="content-image image-half"><br />
<iframe class="image-full" width="560" height="315" src="//www.youtube.com/embed//k0gkzAL831M?rel=0" frameborder="0" allowfullscreen></iframe><br />
<figcaption>A video demonstration for the model GUI</figcaption><br />
</figure><br />
<h3>Simulation Conditions</h3><br />
<ol><br />
<li>Cell growth occurs only when nutrient conditions are satisfied and cell growth is dependent on local oxygen, glucose and acetate concentration;</li><br />
<li>For unit cell, uptake of nutrient for maintenance is constant;</li><br />
<li>Cell population is increasing exponentially;</li><br />
<li>Bacterial cellulose is only produced with the presence of cells and BC production is linearly proportional to cell population;</li><br />
<li>Glucose consumption for bacterial cellulose is linearly proportional to cell population where glucose is directed to both cellulose production and cell growth and maintenance.</li><br />
<li>Nutrients (glucose and acetate) are added periodically on the top of the media.</li><br />
</ol><br />
<h3>Interaction with Wetlab</h3><br />
<p>By simulating the nutrient diffusion and depletion processes, the model can be used to compute a nutrient addition schedule and to simulate the impact of different nutrient supply rates.</p><br />
<br />
</section><br />
<br />
<br />
<section id="part2"><br />
<h2>Part Two: Orientation and Mobility Consideration</h2><br />
<h3>Description</h3><br />
<p>Based on the nutrient profiles obtained from simulations of the first part of the model, the second part is designed to account for cell movement along high-nutrient gradients. This second part of the model thus aims to capture chemotaxis, i.e. the ability of cells to sense their surrounding nutrient environment and consequently move towards nutrient-rich regions.</p><br />
<h3>Simulations of Nutrient Profiles</h3><br />
<h4>Oxygen Profile</h4><br />
<figure class="content-image image-half"><br />
<iframe class="image-full" width="560" height="315" src="//www.youtube.com/embed//sCjRg3AxT_w?rel=0" frameborder="0" allowfullscreen></iframe><br />
<figcaption>A video demonstration for the model GUI</figcaption><br />
</figure><br />
<br />
<h4>Glucose Profile</h4><br />
<figure class="content-image image-half"><br />
<iframe class="image-full" width="560" height="315" src="//www.youtube.com/embed//2717wJxAxYg?rel=0" frameborder="0" allowfullscreen></iframe><br />
<figcaption>A video demonstration for the model GUI</figcaption><br />
</figure><br />
<h3>Simulation Conditions</h3><br />
<p>Based on the simulation conditions described in part one of the model, the second part of the model is used to capture the effects of cell movement towards nutrient rich regions (chemotaxis). The “decision” for cell movement is based on the cell’s need for nutrient, i.e. acetate or glucose. The cell will first make a decision about its nutrient need according to its local nutrient status: if the local nutrient concentration does not meet its growth requirements, then the cell will move towards the closest region with a richer nutrient concentration. Otherwise, the cell will either stay where it is or move randomly around its current position.</p><br />
<h3>Interaction with Wetlab</h3><br />
<p>Model simulations provide a visual representation of cell movement, which, in turn, allows for a better understanding of cell location and topological density within the system. The model also provides a means to confirm the observation that BC is mainly produced at the surface of the liquid media (where cells have an adequate access to oxygen), which also has an implication on the upregulating effect of oxygen on BC production.</p><br />
<br />
</section><br />
<br />
<br />
<section id="code"><br />
<h2>Appendix: Code</h2><br />
<br />
<p>The code for this model can be found here: <a href="https://static.igem.org/mediawiki/2014/6/63/Nurient_Diffusion_Simulations_Imperial_iGEM_2014.m">Nutrient_Diffusion_Simulations_Imperial_iGEM_2014.m</a></p><br />
</section><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>HChughtaihttp://2014.igem.org/Team:Imperial/Nutrient_Diffusion_SimulationsTeam:Imperial/Nutrient Diffusion Simulations2014-10-18T02:54:36Z<p>HChughtai: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Nutrient Diffusion Simulations</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#introduction">Introduction</a><br />
</li><br />
<br />
<li><a data-scroll href="#part1">Part One: Growth and Maintenance Simulation</a><br />
</li><br />
<li><a data-scroll href="#part2" >Part Two: Orientation and Mobility Consideration</a><br />
</li><br />
<br />
<li><a data-scroll href="#code">Appendix: Code</a><br />
</li><br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<br />
<section id="introduction"><br />
<h2>Introduction</h2><br />
<p>The model has two parts: first part of the model simulates the growth and maintenance of cell population under satisfied nutrient condition. The second part of the model takes individual cell motility into consideration and attempted to capture the decision making and orienting processes of each cell. The main difference between two parts is that the first part considers population-level cellular activity while the second part considers cells individually with each cell having a specific coordinate.</p><br />
<br />
</section><br />
<section id="part1"><br />
<h2>Part One: Growth and Maintenance Simulation</h2><br />
<h3>Description</h3><br />
<p>Based on the assumption that the pellicle growth is linearly proportional to glucose, acetate and oxygen consumption, a model is constructed to visualise the varying two dimensional profile of nutrient concentration. In particular, this is done with respect to nutrient depletion, periodic addition and diffusion within the culture environment. The model can be used to identify regions suitable for cell growth based on local nutrient concentration profiles. As result, a map of cell density distribution can be obtained.</p><br />
<h3>Simulations of Nutrient Profiles</h3><br />
<h4>Oxygen Profile</h4><br />
<figure class="content-image image-half"><br />
<iframe class="image-full" width="560" height="315" src="//www.youtube.com/embed//uTE9gG5VoLU?rel=0" frameborder="0" allowfullscreen></iframe><br />
<img src="https://static.igem.org/mediawiki/2014/3/36/IC14-NDS-scale.png"><br />
<figcaption>A video demonstration for the model GUI</figcaption><br />
</figure><br />
<br />
<h4>Glucose Profile</h4><br />
<figure class="content-image image-half"><br />
<iframe class="image-full" width="560" height="315" src="//www.youtube.com/embed//k0gkzAL831M?rel=0" frameborder="0" allowfullscreen></iframe><br />
<figcaption>A video demonstration for the model GUI</figcaption><br />
</figure><br />
<h3>Simulation Conditions</h3><br />
<ol><br />
<li>Cell growth occurs only when nutrient conditions are satisfied and cell growth is dependent on local oxygen, glucose and acetate concentration;</li><br />
<li>For unit cell, uptake of nutrient for maintenance is constant;</li><br />
<li>Cell population is increasing exponentially;</li><br />
<li>Bacterial cellulose is only produced with the presence of cells and BC production is linearly proportional to cell population;</li><br />
<li>Glucose consumption for bacterial cellulose is linearly proportional to cell population where glucose is directed to both cellulose production and cell growth and maintenance.</li><br />
<li>Nutrients (glucose and acetate) are added periodically on the top of the media.</li><br />
</ol><br />
<h3>Interaction with Wetlab</h3><br />
<p>By simulating the nutrient diffusion and depletion processes, the model can be used to compute a nutrient addition schedule and to simulate the impact of different nutrient supply rates.</p><br />
<br />
</section><br />
<br />
<br />
<section id="part2"><br />
<h2>Part Two: Orientation and Mobility Consideration</h2><br />
<h3>Description</h3><br />
<p>Based on the nutrient profiles obtained from simulations of the first part of the model, the second part is designed to account for cell movement along high-nutrient gradients. This second part of the model thus aims to capture chemotaxis, i.e. the ability of cells to sense their surrounding nutrient environment and consequently move towards nutrient-rich regions.</p><br />
<h3>Simulations of Nutrient Profiles</h3><br />
<h4>Oxygen Profile</h4><br />
<figure class="content-image image-half"><br />
<iframe class="image-full" width="560" height="315" src="//www.youtube.com/embed//sCjRg3AxT_w?rel=0" frameborder="0" allowfullscreen></iframe><br />
<figcaption>A video demonstration for the model GUI</figcaption><br />
</figure><br />
<br />
<h4>Glucose Profile</h4><br />
<figure class="content-image image-half"><br />
<iframe class="image-full" width="560" height="315" src="//www.youtube.com/embed//2717wJxAxYg?rel=0" frameborder="0" allowfullscreen></iframe><br />
<figcaption>A video demonstration for the model GUI</figcaption><br />
</figure><br />
<h3>Simulation Conditions</h3><br />
<p>Based on the simulation conditions described in part one of the model, the second part of the model is used to capture the effects of cell movement towards nutrient rich regions (chemotaxis). The “decision” for cell movement is based on the cell’s need for nutrient, i.e. acetate or glucose. The cell will first make a decision about its nutrient need according to its local nutrient status: if the local nutrient concentration does not meet its growth requirements, then the cell will move towards the closest region with a richer nutrient concentration. Otherwise, the cell will either stay where it is or move randomly around its current position.</p><br />
<h3>Interaction with Wetlab</h3><br />
<p>Model simulations provide a visual representation of cell movement, which, in turn, allows for a better understanding of cell location and topological density within the system. The model also provides a means to confirm the observation that BC is mainly produced at the surface of the liquid media (where cells have an adequate access to oxygen), which also has an implication on the upregulating effect of oxygen on BC production.</p><br />
<br />
</section><br />
<br />
<br />
<section id="code"><br />
<h2>Appendix: Code</h2><br />
<br />
<p>The code for this model can be found here: <a href="https://static.igem.org/mediawiki/2014/6/63/Nurient_Diffusion_Simulations_Imperial_iGEM_2014.m">Nutrient_Diffusion_Simulations_Imperial_iGEM_2014.m</a></p><br />
</section><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>HChughtaihttp://2014.igem.org/File:IC14-NDS-scale.pngFile:IC14-NDS-scale.png2014-10-18T02:53:18Z<p>HChughtai: </p>
<hr />
<div></div>HChughtaihttp://2014.igem.org/Team:Imperial/Templates:headerTeam:Imperial/Templates:header2014-10-18T02:49:34Z<p>HChughtai: </p>
<hr />
<div><html><br />
<br />
<head><br />
<meta charset="utf-8"><br />
<meta name="viewport" content="width=device-width, initial-scale=1.0"><br />
<title>Imperial iGEM 2014</title><br />
<link rel="stylesheet" href="http://code.jquery.com/ui/1.11.1/themes/smoothness/jquery-ui.css"><br />
<link rel="stylesheet" href="https://2014.igem.org/Team:Imperial/Resources/CSS:pure-nr?action=raw&ctype=text/css"><br />
<link rel="stylesheet" href="https://2014.igem.org/Team:Imperial/Resources/CSS:pure-skin?action=raw&ctype=text/css"><br />
<link rel="stylesheet" href="https://2014.igem.org/Team:Imperial/Resources/CSS:wiki?action=raw&ctype=text/css"><br />
<link rel="stylesheet" href="https://2014.igem.org/Team:Imperial/Resources/CSS:main?action=raw&ctype=text/css"><br />
<link rel="stylesheet" href="https://2014.igem.org/Team:Imperial/Resources/CSS:bxslider?action=raw&ctype=text/css"><br />
<link rel="stylesheet" href="https://2014.igem.org/Team:Imperial/Resources/CSS:colorbox?action=raw&ctype=text/css"><br />
<link rel="stylesheet" href="https://2014.igem.org/Team:Imperial/Resources/CSS:timeline?action=raw&ctype=text/css"><br />
<br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,300,700' rel='stylesheet' type='text/css'><br />
<link href='http://fonts.googleapis.com/css?family=Noto+Sans:400,700,400italic,700italic' rel='stylesheet' type='text/css'><br />
<br />
<br />
<script src="http://yui.yahooapis.com/3.17.2/build/yui/yui-min.js"></script><br />
<script src="http://ajax.googleapis.com/ajax/libs/jquery/1.11.1/jquery.min.js"></script><br />
<script src="http://code.jquery.com/ui/1.11.1/jquery-ui.js"></script><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:bxslider?action=raw&ctype=text/js"></script><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:team?action=raw&ctype=text/js"></script><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:log?action=raw&ctype=text/js"></script><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:subNav?action=raw&ctype=text/js"></script><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:bind-polyfill?action=raw&ctype=text/js"></script><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:smooth-scroll?action=raw&ctype=text/js"></script><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:colorbox?action=raw&ctype=text/js"></script><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<script><br />
$(document).ready(function () {<br />
$('.bxslider').bxSlider({<br />
<br />
});<br />
YUI({<br />
classNamePrefix: 'pure'<br />
}).use('gallery-sm-menu', function (Y) {<br />
<br />
var horizontalMenu = new Y.Menu({<br />
container: '#main_nav',<br />
sourceNode: '#std-menu-items',<br />
orientation: 'horizontal',<br />
hideOnOutsideClick: false,<br />
hideOnClick: false<br />
});<br />
<br />
horizontalMenu.render();<br />
horizontalMenu.show();<br />
<br />
});<br />
$(".youtube").colorbox({<br />
iframe: true,<br />
innerWidth: 640,<br />
innerHeight: 390<br />
});<br />
<br />
$(".iframe").colorbox({<br />
iframe: true,<br />
width: "80%",<br />
height: "80%"<br />
});<br />
$(".accordion").accordion({<br />
heightStyle: "content",<br />
collapsible: true,<br />
active: false<br />
});<br />
smoothScroll.init({<br />
offset: 40<br />
<br />
});<br />
<br />
<br />
});<br />
</script><br />
<br />
<br />
<script><br />
(function (i, s, o, g, r, a, m) {<br />
i['GoogleAnalyticsObject'] = r;<br />
i[r] = i[r] || function () {<br />
(i[r].q = i[r].q || []).push(arguments)<br />
}, i[r].l = 1 * new Date();<br />
a = s.createElement(o),<br />
m = s.getElementsByTagName(o)[0];<br />
a.async = 1;<br />
a.src = g;<br />
m.parentNode.insertBefore(a, m)<br />
})(window, document, 'script', '//www.google-analytics.com/analytics.js', 'ga');<br />
<br />
ga('create', 'UA-54018926-1', 'auto');<br />
ga('send', 'pageview');<br />
</script><br />
</head><br />
<br />
<br />
<body><br />
<div class="wrapper"><br />
<div class="header"><br />
<br />
<div class="header-banner"><br />
<div class="left"><br />
<a href="https://2014.igem.org/Team:Imperial"><img id="logo-img" src="https://static.igem.org/mediawiki/2014/e/e1/IC14-logo.png"></a><br />
<a style="text-decoration: none" href="https://2014.igem.org/Team:Imperial"><h1 id="Logo">Aqualose</h1></a><br />
</div><br />
<div class="right"><br />
<br />
<a target="_blank" href="http://twitter.com/imperialigem"><br />
<img class="social" src="https://static.igem.org/mediawiki/2014/3/37/IC14-logo-twitter.png"><br />
</a><br />
<a target="_blank" href="http://www.facebook.com/imperialigem2014"><br />
<img class="social" src="https://static.igem.org/mediawiki/2014/8/87/IC14-logo-facebook.png"><br />
</a><br />
<a target="_blank" href="http://www.imperial.ac.uk/"><br />
<img class="social" src="https://static.igem.org/mediawiki/2014/3/38/IC14-logo-imperial-black.png"><br />
</a><br />
<a target="_blank" href="https://2014.igem.org/"><br />
<img class="social" src="https://static.igem.org/mediawiki/2014/1/12/IC14-logo-igem.png"><br />
</a><br />
</div><br />
<br />
</div><br />
<br />
<br />
<div id="main_nav" class="pure-menu pure-menu-open pure-menu-horizontal"><br />
<ul id="std-menu-items"><br />
<li> <a href=#>Project</a><br />
<ul><br />
<li> <a href="https://2014.igem.org/Team:Imperial/Project">Overview</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Project_Background">Background</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Gluconacetobacter"><em>G. xylinus</em></a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/EColi"><em>E. coli</em></a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/coculture">Co-culture</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Functionalisation">Functionalisation</a><br />
</li><br />
<br />
<li><a href="https://2014.igem.org/Team:Imperial/Mass_Production_and_Processing">Mass Production and Processing</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Mechanical_Testing">Mechanical Testing</a><br />
</li><br />
</ul><br />
</li><br />
<li> <a href=#>Achievements</a><br />
<ul><br />
<li> <a href="https://2014.igem.org/Team:Imperial/Achievements">Overview</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Parts">Parts</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Results">Results</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Judging_Criteria">Judging Criteria</a><br />
</li><br />
<li> <a href="https://2014.igem.org/Team:Imperial/InterLab_Study">Interlab Study</a><br />
</li><br />
</ul><br />
</li><br />
<br />
<br />
<li> <a href=#>Application</a><br />
<ul><br />
<li><a href="https://2014.igem.org/Team:Imperial/Implementation">Implementation</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Water_Filtration">Water Filtration</a><br />
</li><br />
<br />
<br />
</ul><br />
</li><br />
<br />
<br />
<br />
<br />
<br />
<li> <a href=#>Policy & Practices</a><br />
<ul><br />
<li> <a href="https://2014.igem.org/Team:Imperial/Policy_and_Practices">Overview</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Informing_Design">Informing Design</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Water_Report">Water Report</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/The_i_in_iGEM">The i in iGEM</a><br />
</li><br />
<br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Outreach">Outreach</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Collaborations">Collaborations</a><br />
</li><br />
<br />
<br />
</ul><br />
</li><br />
<li> <a href=#>Modelling</a><br />
<ul><br />
<li> <a href="https://2014.igem.org/Team:Imperial/Modelling">Overview</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Induction_Model">Induction Model</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/CBD_Kinetics_Model">CBD Kinetics Model</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Pellicle_Model">Pellicle Model</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Nutrient_Diffusion_Simulations">Nutrient Diffusion Simulations</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/BioHackspace_Model">BioHackspace Model</a><br />
</li><br />
<br />
</ul><br />
</li><br />
<br />
<li> <a href=#>Notebook</a><br />
<ul><br />
<li> <a href="https://2014.igem.org/Team:Imperial/Notebook">Overview</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Lab-book">Lab-book</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Protocols">Protocols</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Brainstorming">Brainstorming</a><br />
</li><br />
</ul><br />
</li><br />
<br />
<li> <a href="https://2014.igem.org/Team:Imperial/Safety">Safety</a><br />
</li><br />
<br />
<li><a href="https://2014.igem.org/Team:Imperial/Art_and_Design">Art & Design</a><br />
</li><br />
<br />
<li> <a href="#">Team</a><br />
<ul><br />
<li><a href="https://igem.org/Team.cgi?id=1321">Official Profile</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Students">Students</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Instructors_and_Advisors">Instructors and Advisors</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Sponsors">Sponsors</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Attributions">Attributions</a><br />
</li><br />
</ul><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<br />
<br />
</body><br />
<br />
</html></div>HChughtaihttp://2014.igem.org/Team:Imperial/Nutrient_Diffusion_SimulationsTeam:Imperial/Nutrient Diffusion Simulations2014-10-18T02:48:44Z<p>HChughtai: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Nutrient Diffusion Simulations</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#introduction">Introduction</a><br />
</li><br />
<br />
<li><a data-scroll href="#part1">Part One: Growth and Maintenance Simulation</a><br />
</li><br />
<li><a data-scroll href="#part2" >Part Two: Orientation and Mobility Consideration</a><br />
</li><br />
<br />
<li><a data-scroll href="#code">Appendix: Code</a><br />
</li><br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<br />
<section id="introduction"><br />
<h2>Introduction</h2><br />
<p>The model has two parts: first part of the model simulates the growth and maintenance of cell population under satisfied nutrient condition. The second part of the model takes individual cell motility into consideration and attempted to capture the decision making and orienting processes of each cell. The main difference between two parts is that the first part considers population-level cellular activity while the second part considers cells individually with each cell having a specific coordinate.</p><br />
<br />
</section><br />
<section id="part1"><br />
<h2>Part One: Growth and Maintenance Simulation</h2><br />
<h3>Description</h3><br />
<p>Based on the assumption that the pellicle growth is linearly proportional to glucose, acetate and oxygen consumption, a model is constructed to visualise the varying two dimensional profile of nutrient concentration. In particular, this is done with respect to nutrient depletion, periodic addition and diffusion within the culture environment. The model can be used to identify regions suitable for cell growth based on local nutrient concentration profiles. As result, a map of cell density distribution can be obtained.</p><br />
<h3>Simulations of Nutrient Profiles</h3><br />
<h4>Oxygen Profile</h4><br />
<figure class="content-image image-half"><br />
<iframe class="image-full" width="560" height="315" src="//www.youtube.com/embed//uTE9gG5VoLU?rel=0" frameborder="0" allowfullscreen></iframe><br />
<figcaption>A video demonstration for the model GUI</figcaption><br />
</figure><br />
<br />
<h4>Glucose Profile</h4><br />
<figure class="content-image image-half"><br />
<iframe class="image-full" width="560" height="315" src="//www.youtube.com/embed//k0gkzAL831M?rel=0" frameborder="0" allowfullscreen></iframe><br />
<figcaption>A video demonstration for the model GUI</figcaption><br />
</figure><br />
<h3>Simulation Conditions</h3><br />
<ol><br />
<li>Cell growth occurs only when nutrient conditions are satisfied and cell growth is dependent on local oxygen, glucose and acetate concentration;</li><br />
<li>For unit cell, uptake of nutrient for maintenance is constant;</li><br />
<li>Cell population is increasing exponentially;</li><br />
<li>Bacterial cellulose is only produced with the presence of cells and BC production is linearly proportional to cell population;</li><br />
<li>Glucose consumption for bacterial cellulose is linearly proportional to cell population where glucose is directed to both cellulose production and cell growth and maintenance.</li><br />
<li>Nutrients (glucose and acetate) are added periodically on the top of the media.</li><br />
</ol><br />
<h3>Interaction with Wetlab</h3><br />
<p>By simulating the nutrient diffusion and depletion processes, the model can be used to compute a nutrient addition schedule and to simulate the impact of different nutrient supply rates.</p><br />
<br />
</section><br />
<br />
<br />
<section id="part2"><br />
<h2>Part Two: Orientation and Mobility Consideration</h2><br />
<h3>Description</h3><br />
<p>Based on the nutrient profiles obtained from simulations of the first part of the model, the second part is designed to account for cell movement along high-nutrient gradients. This second part of the model thus aims to capture chemotaxis, i.e. the ability of cells to sense their surrounding nutrient environment and consequently move towards nutrient-rich regions.</p><br />
<h3>Simulations of Nutrient Profiles</h3><br />
<h4>Oxygen Profile</h4><br />
<figure class="content-image image-half"><br />
<iframe class="image-full" width="560" height="315" src="//www.youtube.com/embed//sCjRg3AxT_w?rel=0" frameborder="0" allowfullscreen></iframe><br />
<figcaption>A video demonstration for the model GUI</figcaption><br />
</figure><br />
<br />
<h4>Glucose Profile</h4><br />
<figure class="content-image image-half"><br />
<iframe class="image-full" width="560" height="315" src="//www.youtube.com/embed//2717wJxAxYg?rel=0" frameborder="0" allowfullscreen></iframe><br />
<figcaption>A video demonstration for the model GUI</figcaption><br />
</figure><br />
<h3>Simulation Conditions</h3><br />
<p>Based on the simulation conditions described in part one of the model, the second part of the model is used to capture the effects of cell movement towards nutrient rich regions (chemotaxis). The “decision” for cell movement is based on the cell’s need for nutrient, i.e. acetate or glucose. The cell will first make a decision about its nutrient need according to its local nutrient status: if the local nutrient concentration does not meet its growth requirements, then the cell will move towards the closest region with a richer nutrient concentration. Otherwise, the cell will either stay where it is or move randomly around its current position.</p><br />
<h3>Interaction with Wetlab</h3><br />
<p>Model simulations provide a visual representation of cell movement, which, in turn, allows for a better understanding of cell location and topological density within the system. The model also provides a means to confirm the observation that BC is mainly produced at the surface of the liquid media (where cells have an adequate access to oxygen), which also has an implication on the upregulating effect of oxygen on BC production.</p><br />
<br />
</section><br />
<br />
<br />
<section id="code"><br />
<h2>Appendix: Code</h2><br />
<br />
<p>The code for this model can be found here: <a href="https://static.igem.org/mediawiki/2014/6/63/Nurient_Diffusion_Simulations_Imperial_iGEM_2014.m">Nutrient_Diffusion_Simulations_Imperial_iGEM_2014.m</a></p><br />
</section><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>HChughtaihttp://2014.igem.org/Team:Imperial/Nutrient_Diffusion_SimulationsTeam:Imperial/Nutrient Diffusion Simulations2014-10-18T02:47:33Z<p>HChughtai: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Nutrient Diffusion Simulations</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#introduction">Introduction</a><br />
</li><br />
<br />
<li><a data-scroll href="#maths">Mathematical Background</a><br />
</li><br />
<li><a data-scroll href="#lab" >Wet-Lab Interaction</a><br />
</li><br />
<li><a data-scroll href="#results" >Results & Conclusions</a><br />
</li><br />
<li><a data-scroll href="#references">References</a><br />
</li><br />
<li><a data-scroll href="#code">Code</a><br />
</li><br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<br />
<section id="introduction"><br />
<h2>Introduction</h2><br />
<p>The model has two parts: first part of the model simulates the growth and maintenance of cell population under satisfied nutrient condition. The second part of the model takes individual cell motility into consideration and attempted to capture the decision making and orienting processes of each cell. The main difference between two parts is that the first part considers population-level cellular activity while the second part considers cells individually with each cell having a specific coordinate.</p><br />
<br />
</section><br />
<section id="part1"><br />
<h2>Part One: Growth and Maintenance Simulation</h2><br />
<h3>Description</h3><br />
<p>Based on the assumption that the pellicle growth is linearly proportional to glucose, acetate and oxygen consumption, a model is constructed to visualise the varying two dimensional profile of nutrient concentration. In particular, this is done with respect to nutrient depletion, periodic addition and diffusion within the culture environment. The model can be used to identify regions suitable for cell growth based on local nutrient concentration profiles. As result, a map of cell density distribution can be obtained.</p><br />
<h3>Simulations of Nutrient Profiles</h3><br />
<h4>Oxygen Profile</h4><br />
<figure class="content-image image-half"><br />
<iframe class="image-full" width="560" height="315" src="//www.youtube.com/embed//uTE9gG5VoLU?rel=0" frameborder="0" allowfullscreen></iframe><br />
<figcaption>A video demonstration for the model GUI</figcaption><br />
</figure><br />
<br />
<h4>Glucose Profile</h4><br />
<figure class="content-image image-half"><br />
<iframe class="image-full" width="560" height="315" src="//www.youtube.com/embed//k0gkzAL831M?rel=0" frameborder="0" allowfullscreen></iframe><br />
<figcaption>A video demonstration for the model GUI</figcaption><br />
</figure><br />
<h3>Simulation Conditions</h3><br />
<ol><br />
<li>Cell growth occurs only when nutrient conditions are satisfied and cell growth is dependent on local oxygen, glucose and acetate concentration;</li><br />
<li>For unit cell, uptake of nutrient for maintenance is constant;</li><br />
<li>Cell population is increasing exponentially;</li><br />
<li>Bacterial cellulose is only produced with the presence of cells and BC production is linearly proportional to cell population;</li><br />
<li>Glucose consumption for bacterial cellulose is linearly proportional to cell population where glucose is directed to both cellulose production and cell growth and maintenance.</li><br />
<li>Nutrients (glucose and acetate) are added periodically on the top of the media.</li><br />
</ol><br />
<h3>Interaction with Wetlab</h3><br />
<p>By simulating the nutrient diffusion and depletion processes, the model can be used to compute a nutrient addition schedule and to simulate the impact of different nutrient supply rates.</p><br />
<br />
</section><br />
<br />
<br />
<section id="part2"><br />
<h2>Part One: Orientation and Mobility Consideration</h2><br />
<h3>Description</h3><br />
<p>Based on the nutrient profiles obtained from simulations of the first part of the model, the second part is designed to account for cell movement along high-nutrient gradients. This second part of the model thus aims to capture chemotaxis, i.e. the ability of cells to sense their surrounding nutrient environment and consequently move towards nutrient-rich regions.</p><br />
<h3>Simulations of Nutrient Profiles</h3><br />
<h4>Oxygen Profile</h4><br />
<figure class="content-image image-half"><br />
<iframe class="image-full" width="560" height="315" src="//www.youtube.com/embed//sCjRg3AxT_w?rel=0" frameborder="0" allowfullscreen></iframe><br />
<figcaption>A video demonstration for the model GUI</figcaption><br />
</figure><br />
<br />
<h4>Glucose Profile</h4><br />
<figure class="content-image image-half"><br />
<iframe class="image-full" width="560" height="315" src="//www.youtube.com/embed//2717wJxAxYg?rel=0" frameborder="0" allowfullscreen></iframe><br />
<figcaption>A video demonstration for the model GUI</figcaption><br />
</figure><br />
<h3>Simulation Conditions</h3><br />
<p>Based on the simulation conditions described in part one of the model, the second part of the model is used to capture the effects of cell movement towards nutrient rich regions (chemotaxis). The “decision” for cell movement is based on the cell’s need for nutrient, i.e. acetate or glucose. The cell will first make a decision about its nutrient need according to its local nutrient status: if the local nutrient concentration does not meet its growth requirements, then the cell will move towards the closest region with a richer nutrient concentration. Otherwise, the cell will either stay where it is or move randomly around its current position.</p><br />
<h3>Interaction with Wetlab</h3><br />
<p>Model simulations provide a visual representation of cell movement, which, in turn, allows for a better understanding of cell location and topological density within the system. The model also provides a means to confirm the observation that BC is mainly produced at the surface of the liquid media (where cells have an adequate access to oxygen), which also has an implication on the upregulating effect of oxygen on BC production.</p><br />
<br />
</section><br />
<br />
<br />
<section id="code"><br />
<h2>Appendix: Code</h2><br />
<br />
<p>The code for this model can be found here: <a href="https://static.igem.org/mediawiki/2014/6/63/Nurient_Diffusion_Simulations_Imperial_iGEM_2014.m">Nutrient_Diffusion_Simulations_Imperial_iGEM_2014.m</a></p><br />
</section><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>HChughtaihttp://2014.igem.org/File:Nurient_Diffusion_Simulations_Imperial_iGEM_2014.mFile:Nurient Diffusion Simulations Imperial iGEM 2014.m2014-10-18T02:47:04Z<p>HChughtai: </p>
<hr />
<div></div>HChughtaihttp://2014.igem.org/Team:Imperial/Nutrient_Diffusion_SimulationsTeam:Imperial/Nutrient Diffusion Simulations2014-10-18T02:45:06Z<p>HChughtai: Created page with "{{:Team:Imperial/Templates:header}} <html> <body> <div class="content-wrapper"> <div class="pure-g"> <div class="pure-u-1-1 main"> ..."</p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Pellicle Model</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#introduction">Introduction</a><br />
</li><br />
<br />
<li><a data-scroll href="#maths">Mathematical Background</a><br />
</li><br />
<li><a data-scroll href="#lab" >Wet-Lab Interaction</a><br />
</li><br />
<li><a data-scroll href="#results" >Results & Conclusions</a><br />
</li><br />
<li><a data-scroll href="#references">References</a><br />
</li><br />
<li><a data-scroll href="#code">Code</a><br />
</li><br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<br />
<section id="introduction"><br />
<h2>Introduction</h2><br />
<p>The model has two parts: first part of the model simulates the growth and maintenance of cell population under satisfied nutrient condition. The second part of the model takes individual cell motility into consideration and attempted to capture the decision making and orienting processes of each cell. The main difference between two parts is that the first part considers population-level cellular activity while the second part considers cells individually with each cell having a specific coordinate.</p><br />
<br />
</section><br />
<section id="part1"><br />
<h2>Part One: Growth and Maintenance Simulation</h2><br />
<h3>Description</h3><br />
<p>Based on the assumption that the pellicle growth is linearly proportional to glucose, acetate and oxygen consumption, a model is constructed to visualise the varying two dimensional profile of nutrient concentration. In particular, this is done with respect to nutrient depletion, periodic addition and diffusion within the culture environment. The model can be used to identify regions suitable for cell growth based on local nutrient concentration profiles. As result, a map of cell density distribution can be obtained.</p><br />
<h3>Simulations of Nutrient Profiles</h3><br />
<h4>Oxygen Profile</h4><br />
<figure class="content-image image-half"><br />
<iframe class="image-full" width="560" height="315" src="//www.youtube.com/embed//uTE9gG5VoLU?rel=0" frameborder="0" allowfullscreen></iframe><br />
<figcaption>A video demonstration for the model GUI</figcaption><br />
</figure><br />
<br />
<h4>Glucose Profile</h4><br />
<figure class="content-image image-half"><br />
<iframe class="image-full" width="560" height="315" src="//www.youtube.com/embed//k0gkzAL831M?rel=0" frameborder="0" allowfullscreen></iframe><br />
<figcaption>A video demonstration for the model GUI</figcaption><br />
</figure><br />
<h3>Simulation Conditions</h3><br />
<ol><br />
<li>Cell growth occurs only when nutrient conditions are satisfied and cell growth is dependent on local oxygen, glucose and acetate concentration;</li><br />
<li>For unit cell, uptake of nutrient for maintenance is constant;</li><br />
<li>Cell population is increasing exponentially;</li><br />
<li>Bacterial cellulose is only produced with the presence of cells and BC production is linearly proportional to cell population;</li><br />
<li>Glucose consumption for bacterial cellulose is linearly proportional to cell population where glucose is directed to both cellulose production and cell growth and maintenance.</li><br />
<li>Nutrients (glucose and acetate) are added periodically on the top of the media.</li><br />
</ol><br />
<h3>Interaction with Wetlab</h3><br />
<p>By simulating the nutrient diffusion and depletion processes, the model can be used to compute a nutrient addition schedule and to simulate the impact of different nutrient supply rates.</p><br />
<br />
</section><br />
<br />
<br />
<section id="part2"><br />
<h2>Part One: Orientation and Mobility Consideration</h2><br />
<h3>Description</h3><br />
<p>Based on the nutrient profiles obtained from simulations of the first part of the model, the second part is designed to account for cell movement along high-nutrient gradients. This second part of the model thus aims to capture chemotaxis, i.e. the ability of cells to sense their surrounding nutrient environment and consequently move towards nutrient-rich regions.</p><br />
<h3>Simulations of Nutrient Profiles</h3><br />
<h4>Oxygen Profile</h4><br />
<figure class="content-image image-half"><br />
<iframe class="image-full" width="560" height="315" src="//www.youtube.com/embed//sCjRg3AxT_w?rel=0" frameborder="0" allowfullscreen></iframe><br />
<figcaption>A video demonstration for the model GUI</figcaption><br />
</figure><br />
<br />
<h4>Glucose Profile</h4><br />
<figure class="content-image image-half"><br />
<iframe class="image-full" width="560" height="315" src="//www.youtube.com/embed//2717wJxAxYg?rel=0" frameborder="0" allowfullscreen></iframe><br />
<figcaption>A video demonstration for the model GUI</figcaption><br />
</figure><br />
<h3>Simulation Conditions</h3><br />
<p>Based on the simulation conditions described in part one of the model, the second part of the model is used to capture the effects of cell movement towards nutrient rich regions (chemotaxis). The “decision” for cell movement is based on the cell’s need for nutrient, i.e. acetate or glucose. The cell will first make a decision about its nutrient need according to its local nutrient status: if the local nutrient concentration does not meet its growth requirements, then the cell will move towards the closest region with a richer nutrient concentration. Otherwise, the cell will either stay where it is or move randomly around its current position.</p><br />
<h3>Interaction with Wetlab</h3><br />
<p>Model simulations provide a visual representation of cell movement, which, in turn, allows for a better understanding of cell location and topological density within the system. The model also provides a means to confirm the observation that BC is mainly produced at the surface of the liquid media (where cells have an adequate access to oxygen), which also has an implication on the upregulating effect of oxygen on BC production.</p><br />
<br />
</section><br />
<br />
<br />
<br />
<section id="code"><br />
<h3>Code</h3><br />
<br />
</section><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>HChughtaihttp://2014.igem.org/Team:Imperial/The_i_in_iGEMTeam:Imperial/The i in iGEM2014-10-18T02:34:51Z<p>HChughtai: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<br />
<!-- <script src="https://2014.igem.org/Team:Imperial/Resources/JS:highmaps?action=raw&ctype=text/js"></script> --><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:highcharts?action=raw&ctype=text/js"></script><br />
<script src="http://code.highcharts.com/maps/modules/map.js"></script><br />
<br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:data?action=raw&ctype=text/js"></script><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:exporting?action=raw&ctype=text/js"></script><br />
<script src="http://code.highcharts.com/mapdata/custom/world-robinson-highres.js"></script><br />
<br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:maps?action=raw&ctype=text/js"></script><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:charts?action=raw&ctype=text/js"></script><br />
<script><br />
$(document).ready(function () {<br />
$('#bxslider').bxSlider({<br />
<br />
});<br />
});<br />
</script><br />
<body><br />
<!--End of Header section--><br />
<br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>The i in iGEM</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#introduction" >Introduction</a><br />
</li><br />
<li><a data-scroll href="#english" >Lingua Academica</a><br />
</li><br />
<li><a data-scroll href="#methods" >Methods</a><br />
</li><br />
<li><a data-scroll href="#countries" >The Countries</a><br />
</li><br />
<li><a data-scroll href="#language" >The Language</a><br />
</li><br />
<li><a data-scroll href="#judges">The Judges</a><br />
</li><br />
<li><a data-scroll href="#recommendations">Recommendations</a><br />
</li><br />
<li><a data-scroll href="#references">References</a><br />
</li><br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p>As an international competition, every year iGEM welcomes teams from a great range of countries, with a variety of languages spoken amongst its teams and judges. This part of our Policy & Practices seeks to understand the effect of English as the <em>lingua franca</em> of science on the participation and outcome of the competition. In order to achieve this we have looked into the different nationalities of the teams and finalists and the different lingual backgrounds of teams and finalists over the years. We derived our conclusions by comparing this data with factors such as academic output and impact of their countries of origins, the lingual background of the iGEM judges, the international rankings of their universities and the English Proficiency Index of their countries of origin.</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>Key Points </h2><br />
<ul><br />
<li>Universities participating in iGEM have large proportions of international students.</li><br />
<br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<br />
<section id="introduction"><br />
<h2>Introduction</h2><br />
<br />
<p>iGEM stands for ‘International Genetically Engineered Machine” and as the first word of this acronym indicates, countries and universities from all over the world are well represented. The iGEM competition has grown into a diverse community with a great range of nationalities, cultures and languages represented. The competition took its name in 2005, when 14 teams from 4 different countries came together to develop novel ideas based on synthetic biology. At that time, German and English were the only two languages represented. Since then, the competition has grown, reaching the 100 team milestone in 2009 and climbing to a staggering 245 teams from 32 different countries with 20 languages this year, its 10th anniversary. The competition has been expanding in all directions. Different teams compete in different tracks, for different awards and there is now a separation between undergraduate and overgraduate teams.<br />
</p><br />
<p>The language that all the teams communicate their project is English, as per <em>lingua academica</em>. In the spirit of synthetic biology, where standardization and application of the same principals throughout the discipline is promoted, it is certainly essential that all the stakeholders have a common language of communication. Rapid international expansion and the necessity of a single language however present many challenges which need to be addressed.<br />
</p><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<div id="TeamCountryLanguage" style="max-width: 900px"></div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<section id="introduction"><br />
<h2>English as the <em>lingua franca</em> of science</h2><br />
<p>The vast volume of scientific information available in today’s “Information Age” demands effective management and distribution to individuals and institutions. Such communication of ideas across cultures and national borders requires the use of a common language. During the 20th century, English became the primary language for international communication in science and business (Tardy 2006) and English-speaking countries (mainly US and the UK) are the major players in the distribution and generation of knowledge, as demonstrated by their domination in the university and journal rankings.</p> <br />
<p>The status of English as <em>lingua academica</em> does not come without its controversies. In non-English speaking countries, the main role of English is the reporting of professional knowledge, rather than direct communication between scholars. Whilst non-native English speaking scientists may have a good level of competency in jargon and understanding written English they are still at a disadvantage when called to communicate their complex ideas in an international setting. According to SCImago Journal & Country Rankings (SJR 2014), the majority of high impact journals are in English. This forces many non-English speaking scientists and engineers to communicate their science in English, in order to gain status and recognition. This is an additional disadvantage the researchers, who are trying to conduct high impact science from a nation with peripheral status (Tardy 2006).</p><br />
<p>Other effects of the language barrier can be seen in international scientific collaborations. It is well established that the growing importance of international scientific collaborations requires not only common knowledge and understanding of the scientific terminology, but also clear communication. Using a common language is the intuitive way to achieve this and English has been filling that role (Hwang 2012). Again, non-native speakers are at a disadvantage, Babcock and Du-Babcok (2001) explain that “in communication encounters, low proficiency second-language speakers contribute fewer ideas than do fluent second-language speakers or first-language speakers”. Interestingly a study conducted by Ylvanez and Shrum in 2009 showed that a reason behind the collaboration between Philippine and Japanese scientists and engineers was their similar, low levels of English competency (Ylvanez & Shrum 2009), reflecting perhaps a method of compromise so the voices of both sides can be heard equally.<br />
</p><br />
<br />
<div class="bxslider" style="height:500px"><br />
<div id="CitableDocuments" style="max-width: 900px;height:450px"></div><br />
<div id="Citations" style="max-width: 900px"></div><br />
<br />
<div id="EPI" style="max-width: 900px"></div><br />
<br />
<div id="journalRanking" style="max-width: 900px"></div><br />
<br />
<div id="QS_Biological" style="max-width: 900px"></div><br />
<br />
<div id="QS_Overall" style="max-width: 900px"></div><br />
</div><br />
<br />
<br />
<br />
</section><br />
<br />
<br />
</section><br />
<section id="methods"><br />
<h2>Study Methods</h2><br />
<p>Language data was collected as follows: We looked into all the teams that participated in iGEM over the years (iGEM 2004 – 2014) and looked into the country. If the country has only one official language, that is considered the language of the team. For countries with more than one official languages, we looked into the specific language of the institution, as well as the location of the institution within the country (for example, in India and Canada, different languages are spoken in geographical regions). In order to get a better insight in the finalists of previous years, we contacted students of this year’s team from the same university and, when possible, members of the finalist team. That gave us a good insight into the teaching methods of their university, attitude to iGEM and how that reflects on the result of the competition. QS rankings was our university ranking system of choice, because it put a lot of gravity in Academic reputation of the institutions and citations per faculty, while it did not ignore the universities’ diversity, by looking into the international student ratio and the international staff ratio (QS 2014).<br />
</p><br />
<p>For data on judges The iGEM organization publishes the names of the participating judges from the year 2009 up to 2013. Between 2011 and 2013, when the regional jamborees occurred, there is a record of judges that were part of the regionals, as well as the championships. Our first assumption was that all judges speak English. We then took each name and tried to match it to an individual and via online CVs, LinkedIn, academic and business profiles we tried to discover the lingual background of the particular individuals. The best case scenario was people listing the languages they can speak (and their level of competency) in their CVs and LinkedIn. If that was not the case, we moved to the university they come from and where they gained their undergraduate degree from. Finally, some judges mentioned their country of origin in their business/ academic profiles and the language was matched. While we recognize that a lot of mistakes could have been made in the process, we tried to be as precise as possible throughout the procedure.</p> <br />
<br />
</section><br />
<br />
<section id="countries"><br />
<h2>The Countries and Continents</h2><br />
<p>Over the years, 43 different countries have participated in the competition.<br />
North America is home to iGEM and the continent with most participating teams. With 33 of its universities in the top 100 of the QS rankings, it’s arguably the leading continent in academia. Over the years, 453 teams originate from the continent, mostly from the United States. Over the years, the US has had teams in the finalists (top 6), 9 times.<br />
Alongside North America, Europe was one of the initial participants in the competition when it became international in 2005. It has been represented by 343 universities and colleges over the years. Home to 41 of the 100 top universities in the world, according to QS rankings, Europe attracts a large student population from around the world to its academic institutions. Universities in the UK and Germany have had particularly strong presence in iGEM. European teams have been finalists in the competition an amazing 26 times, more than any other continent in the history of the competition. The best year for Europe was 2009, when all the finalists originated from the continent. Last year, all of the Undergraduate finalists and 2 out of the 3 overgraduate finalists where European teams.</p><br />
<p>Asia is the continent whose participation in the competition has seen the most rapid increase. Between 2010 and 2014 the participation of Asian teams has grown 115% percent, compared to the 76% of Europe, 79% of North America and the 91% growth in the competition overall. The key player here is China, which has seen a huge 455% increase in number of teams, significantly more than any other participating country. Despite the growth of the continent in the competition, this has not translated into finalists. Only 12% of finalists come from Asia, a mere 5 out of 41 previous finalists. No more than one Asian team has been a finalist per year.<br />
</p><br />
<br />
<h3>Case Study: China and the USA</h3><br />
<p>Consider two examples: On one hand, we have the USA, visible in the first map as the country with most citable publications (87,600). It keeps its throne in the second map with almost 2 million citations. Here it should be noted that the second country, Germany, ranks to only around half a million.</p><br />
<p>On the other hand, we have China. In the second place, with 37,225 citable documents, it slips to place 6 when it comes to citations. With about 285,000 citations, it falls below countries like the UK and France that occupy the 6th (20,065 publications) and 8th (13,652 publications) place respectively in the citable documents ranking.</p> <br />
<p>For the h-index of both countries, which measures the <em>productivity and impact of published work of a scientist or scholar</em>, the US maintains the top spot, while China slips to 13th. The UK, which only produces around 60% of citable documents compared to China, is placed 3<sup>rd</sup>. Australia, with less than 8,000 citable publications, is ranked just 2 places below China (SJR 2014). It seems language barriers can reduce impact of published work from non-native English speaking countries. Whilst many cultural and socioeconomic factors contribute to the discrepancy between China’s publishing output and h-index rankings language also has a role to play (Moed 2002)</p><br />
<br />
<br />
<h3>University Case studies: Team Members are Multinational</h3><br />
<p>Needs and introductory sentence e.g. iGEM is international between teams but also within teams. The competition attracts top universities and top universities attract students from around the world.</p><br />
<p>In the UK, 18% of the student population comes from outside the country. That translates to about 425,000 students. If we take a look specifically into institutions that have the longest history of participation in iGEM, the numbers are even higher: In our very own Imperial College London, 44% of the students come outside of the UK. Cambridge, the first UK University to participate in the competition has a population of 33% foreign students and the University of Edinburgh includes 35% non-UK students in its body (UKISA 2013).<br />
Moving to Germany, a similar story unfolds: 11.3%, or 282,201 of the students come from outside the country (DAAD 2014). In the two universities with the longest history in the competition, University of Heidelberg and University of Freiburg, 17.1% and 15% of the students respectively come from outside of Germany (NUS International Relations Office 2014) (University of Heidelberg 2014).</p><br />
<p>Finally, the United States of America. In 2013, it was reported that about 820,000 non US nationals were enrolled in US universities. That makes up only 3.3% percent of the population. If we look specifically though into universities that have been participating in iGEM for a while, those percentages shift dramatically. MIT, birthplace of the competition, 28.63% of the students are international (MIT ISO 2014). In Purdue University, another early iGEM participant, the percentage is 15% for undergraduates and 38% for graduate students (Purdue 2012).</p><br />
<p>Currently, there is no way of knowing this however since iGEM does not record the nationality of participants. As a result, the i in iGEM refers only to the origin of the participant universities, rather than the participating individuals. Countries with no representation through teams in the competition are still represented by individuals. Just within the history of Imperial College iGEM there are students from 5 different countries with no official participation in the competition: Cyprus, Estonia, Greece, Pakistan and Slovakia (Imperial iGEM wiki 2008, 2009, 2011, and 2014).</p><br />
<br />
<br />
<div id="PercentageInternational" style="max-width: 900px"></div><br />
<br />
<p>Many internationally educated scholars end up returning to their home country or wishing to have an impact on its scientific output. A study conducted by the University of California, Berkeley in 2009 showed that only 10% of Chinese, 6% of Indian and 15% of European students were intending to stay in the US post studies (Wadhwa 2009). A survey conducted in Europe by the ICEF monitor reveals that only 12.5% of the students studying abroad in the UK, France, the Netherlands, Sweden and Germany wish to stay in those countries 5 years after their graduation. The majority of them plan to return back home (SVR 2012). It is likely that when returning home many of these scientists will establish themselves in their field of interest, using the skills they acquired from their studies abroad. In the case of iGEM, people that seek to participate in the competition have a keen interest in Synthetic Biology and it is common for alumni to consider a career in the field. Since Synthetic Biology is such a young and ever expanding discipline, it is not unlikely that iGEM alumni that come from countries with no previous history in the competition, will return home and try to set the scene for the growth of SynBio and even iGEM itself.</p><br />
<p>Although a significant number of countries enters the competition every year, the top 6 is occupied only by very few of them, as demonstrated in the map (Heatmap with top 6).<br />
</p> <br />
<br />
<div id="Top10Countries" style="max-width: 900px"></div><br />
<br />
<div id="Finalists" style="max-width: 900px"></div><br />
<br />
<h3>Case studies</h3><br />
<h4>China</h4><br />
<p>The country with the biggest growth in participation is China. As seen in the figure, the participation of Chinese teams has leaped from 9 in 2010 to a staggering 50 within the last four years. Although the number of Chinese teams is on the rise, this is not reflected in the annual top 6 teams in the competition. There has been only one finalist team in 2013, 2011, 2010 and 2007 and none in any other years. The teams come from some of the highest ranked universities in the country (QS 2013) and as noted previously, China is placed 2<sup>nd</sup> in the citable publications rankings (SJR 2014). Therefore the result seems unexpected for a country with such strong presence in the competition and significant academic reputation. Many factors are at play here but it is certainly a consideration that the country is ranked in place 34 out of 60 in the EF proficiency index (EF English Proficiency Index 2014), classified as ‘low’. This can have a significant impact in the communication of the project which turn affects its competition performance.</p><br />
<br />
<br />
<h4>Case study: Germany, a success story</h4><br />
<p>Germany is a country that frequents the top 6 of the competition, and the non-English speaking country with most finalists in its history. Last year Germany dominated iGEM: 3 out of the 6 finalists came from the country. In Undergrad, the winner and 1<sup>st</sup> runner up were teams from German universities. There are many factors to which the success of Germany can be attributed. With 3 universities in the world top 100 according to QS, it is second only to Switzerland to non-English speaking countries with a strong presence in the rankings. Producing the 5nd highest number of citable publications, it is ranked 2<sup>nd</sup> to publication cites and enjoys the 2<sup>nd</sup> highest H index, it is a major player in the scientific community. It comes as no surprise that it attracts a large number of international students that seek to be educated in one of its institutions. Additionally, it is ranked 13<sup>th</sup> in the EF English Proficiency Index, with classification ‘High Proficiency’. Also, before the dawn of English in the 20th century, German held the status of <em>lingua academica</em> and a lot of core scientific knowledge is accessible to its speakers. All these facts combined make a strong case for well-rounded teams, that do not only come from a strong scientific background, but can also can effectively communicate their projects.</p><br />
<br />
<br />
<h4>Japan versus the Netherlands</h4><br />
<p>Japan and the Netherlands are two countries with a long history in the competition. Starting in 2007 and 2008 respectively, both have been consistently represented since. Japan has 5 universities in the top 100 (QS 2014) compared to the 6 in the Netherlands (QS, 2014). Japan is the 3<sup>rd </sup>country in the world in citable publications output, while the Netherlands is ranked 12<sup>th </sup>. The gap closed when we look into Cites rankings, where Japan ranks 4<sup>th</sup> and the Netherlands ranks 9<sup>th</sup>. Finally, in terms of H index, the countries are closely comparable with Japan placed 5<sup>th</sup> and the Netherlands 6<sup>th</sup> (SJR 2014).</p><br />
<p>Even though the academic performance of these countries in science/engineering generally, as well as Biotechnology specifically, is similar, their performance in iGEM is not. Japan has averaged 8 teams in the competition every year, while the Netherlands have had only 4, yet Japan has never been a finalist in the competition, while Netherlands has had a winner already (2012) and has been a finalist twice on top of this. It is perhaps a contributing factor that the Netherlands are ranked 3<sup>rd</sup> in the EF English Proficiency index, while Japan falls 26<sup>th</sup> out of 60 (EF English Proficiency Index 2014).</p><br />
</section><br />
<br />
<section id="language"><br />
<h2>The Language</h2><br />
<p>Another dimension of the inter-nationality of iGEM is the different languages represented in the competition. In the last 5 years, at least 20 different languages are represented. The usual, widely spoken internationally, are English, Mandarin, Spanish, German and French, while some less widely spoken languages, such as Finnish, Kazakh, Nepalese and Hungarian have made appearances.</p><br />
<p>The dominant language of the competition is English, with about 40% of the participants coming from English-speaking universities. That means that 60% of the participants come from different lingual backgrounds. The second greatest presence is Mandarin (spoken by Chinese and Taiwanese teams) and there is a strong presence of Romance and Germanic languages (Spanish, French, German, Dutch), coming from the European and Latin American participants.</p><br />
<br />
<div id="LanguageFamily" style="max-width: 900px"></div><br />
<br />
<br />
<h3>Insight into the finalists</h3><br />
<p>We had a chance to speak to all but two of the non-English speaking finalists in order to get a better insight into the challenges of the language barrier. The overwhelming majority of the successful European teams (examples include Paris Bettencourt, Groningen, Bielefeld and TU Delft) have noted that their teams include many international students. Classes are taught in both the language native to their university and English, with students offered a choice on the language of their thesis or having to write in English (Valencia). In cases where courses were not taught in English (Bielefeld), seminars that included both home and international students where Anglophone. Additionally, due to the composition of their research labs in some certain cases communication between the team members is in English.<br />
Speaking with a former member of a past team of Slovenia gave us quite a different picture compared to the rest of the European teams. As explained to us, the team was made purely of home students with Slovenian being the language of communication within the team. The majority of the material at their university has been taught in their native language, although the teaching material was in English, exposing the students in English scientific writing. Additionally, their advisors where all Slovenian PhD students that carried the majority of their studies in the native country. It needs to be noted though that when asked, that the team members were able to communicate their projects in English with ease. That could possibly be explained by Slovenia’s high ranking in the PE English Proficiency Index (10th place).<br />
</p><br />
<p>When we spoke to the Asian teams, they painted a different picture. The teams are composed exclusively by home students (in the case of ZJU China, this was because their team was composed mainly by undergraduate students, when most of the international students are postgraduate) and the primary teaching and communication is done in their native language. On the other hand, some of the teaching mediums (textbooks, Powepoint slides) are in English. The exception to this was Peking. In their university material is taught in both Chinese and English, while the students participate in classes of English for academic writing. Finally, the team composition (for this year, at least) is not entirely of home students, as an exchange student from an American university has joint.<br />
In addition to language differences, other contrasting attitudes towards the competition emerged which may also be factors affecting team performance. European teams may start brainstorming throughout their Spring term, but official work in their project is conducted mainly during an intense summer term. On the other hand, for the Asian teams iGEM is a more spread out, year-long endeavor, with the project starting even before registration for some (SYSU China).<br />
</p><br />
<br />
</section><br />
<section id="judges"><br />
<h2>The Judges</h2><br />
<p>Another aspect we have considered this year is the nationality and languages of judges recruited for the competition. As an international competition, it is expected and desired for the judges to reflect this. The majority come from participating universities and of course have a background in Synthetic Biology as scientists, engineers or social scientists in the field.<br />
From 2009 to 2013, approximately 40% of the judges are able to speak one or more languages in addition to English. Although this is generally good, specific languages are often under represented amongst the judges. A good example is the representation of Mandarin, in 2013 less than 5% of the judges were speakers, whereas 20% of the teams (over 40 from China and Taiwan) spoke the language, however the percentage is more balanced in other years .<br />
</p><br />
<br />
<div id="MultilingualJudges" style="max-width: 900px"></div><br />
<br />
<br />
<p>Over the years, the percentage of multilingual judges has remained relatively constant. The dominant second languages are Mandarin or French with German and Japanese also being well represented. All these languages are spoken in countries with a consistent presence in the competition.</p><br />
<br />
<div id="JudgesTop5Languages" style="max-width: 900px"></div><br />
<br />
<p>A case could be made that the lingual abilities of judges should not be playing a role in the competition. This is partially true, as all of the teams are expected to present their projects in English, up to the standards of the international scientific community. On the other hand we can argue that it is easier for scientists with a foreign background to understand and appreciate the additional challenges for teams where English is not their first language. Like the teams, these scientists are also called to break through language barriers in order to gain their rightful recognition in the field.</p><br />
<br />
<div id="JudgesAndTeams" style="max-width: 900px;height:450px"></div><br />
<br />
<br />
<br />
<br />
</section><br />
<section id="recommendations" class="content"><br />
<div class="pure-g"><br />
<div class="pure-u-1-1"><br />
<h2>Recommendations</h2><br />
<p>Through the data and observations considered here and discussions with linguists and universities that deal with a large influx of international students, we offer a list of recommendations that could reduce the language barrier in iGEM and it could help non-English speaking teams to communicate their projects in a more effective way.</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h3>For the Teams</h3><br />
<ul><br />
<li>Create an ‘At a Glance’ page written in perfect English. The most effective way of doing so is by writing the page in your native language as well as possible and give it to a bilingual person (in your language and English) to translate. This way the major parts of your project (overview, results, and conclusions) are not lost in translation and the judges can quickly have a look through them.</li><br />
<li>Outsource. A lot of students and scholars in many universities participating in iGEM come from abroad and may have been educated partially in English. Ask their input when writing your wiki, preparing your presentation or making your poster. Otherwise, you can find native speakers of your language in a different iGEM team, preferably one from an English-speaking university. You can ask for their help and form a collaboration.</li><br />
<li>Visualize. Try to communicate your project as visually as possible. Make animations of your systems, take a lot of pictures of your experiments and create very detailed graphs, symbols and photographs. This is an effective way English is taught as a foreign language and it can be used the other way around.</li><br />
<br />
</ul><br />
<br />
</div><br />
<div class="pure-u-1-2"><br />
<h3>For iGEM</h3><br />
<ul><br />
<li>Create a database of nationalities of the participating students. This could give a greater insight in how truly international iGEM is. A few of the alumni could go back to their home countries and establish Synthetic Biology hubs, even iGEM teams. With Synthetic Biology being a new, ever expanding field, it is good to keep an eye on where the next innovation will appear.</li><br />
<li>Create a database of languages spoken by the participating students and make it public. This can promote collaborations between the teams and enhance the community feeling. Teams with problems in English can contact students from different teams that speak their language in order to seek help.</li><br />
<li>Promote participation of judges from more diverse backgrounds, especially from countries and universities that may not be present in the competition that year or never. This is a great opportunity for expanding the global community of iGEM and Synthetic Biology.</li><br />
<br />
</ul><br />
</div><br />
</div><br />
<br />
</section><br />
<br />
<section id="references"><br />
<h2>References</h2><br />
<ul><br />
<li>Balán, J. (2012). Research universities in Latin America: the challenges of growth and institutional diversity. <em>Social Research: An International Quarterly</em>, 79(3), 741-770.</li><br />
<li>Deutscher Akademischer Austausch Dienst (DAAD). (2014). <em>http://www.wissenschaftweltoffen.de/daten/1/1/1?lang=en</em>. Retrieved from http://www.wissenschaftweltoffen.de/daten/1/1/1?lang=en </li><br />
<li>Expert Council of German Foundations on Integration and Migration (SVR). (2012). <em>The Staying Intentions of International Students in Five EU Countries</em>. Retrieved from <a href="http://www.svr-migration.de/content/wp-content/uploads/2012/04/Study_Mobile_Talent_Engl.pdf"></a> </li><br />
<li>Ef.co.uk, (2014). Overview | EF Proficiency Index. [online] Available at: http://www.ef.co.uk/epi/ [Accessed 18 Oct. 2014]</li>.<br />
<li>Igem.org, (2014). Main Page - ung.igem.org. [online] Available at: <a href="https://igem.org"></a> [Accessed 18 Oct. 2014].</li><br />
<li>Hwang, K. (2012). Effects of the language barrier on processes and performance of international scientific collaboration, collaborators’ participation, organizational integrity, and interorganizational relationships. <em>Science Communication</em>, 1075547012437442.</li><br />
<li>Moed, H. F. (2002). Measuring China" s research performance using the Science Citation Index. Scientometrics, 53(3), 281-296.</li><br />
<li>NUS International Relations Office. (2014). University-Wide Partner Universities, Albert-Ludwig University of Freiburg (University of Freiburg) . Retrieved from <em>http://www.nus.edu.sg/iro/sep/partners/pu/germany/uni-freiburg.html</em> - See more at: http://reffor.us/index.php#sthash.pgroXNVN.dpuf</li><br />
<li>Purdue Marketing &amp; Media, P. (2014). Purdue News - Purdue's international student population ranks 2nd for public schools. [online] Purdue.edu. Available at: <a href="http://www.purdue.edu/newsroom/releases/2012/Q4/purdues-international-student-population-ranks-2nd-for-public-schools.html"></a> [Accessed 18 Oct. 2014].</li><br />
<li>Scimagojr.com, (2014). Scimago Journal & Country Rank. [online] Available at: <a href="http://www.scimagojr.com/index.php"></a> [Accessed 18 Oct. 2014].</li><br />
<li>Tardy, C. (2004). The role of English in scientific communication:< i> lingua franca</i> or< i> Tyrannosaurus rex?</i>. <em>Journal of English for Academic Purposes</em>, 3(3), 247-269.</li><br />
<li>Topuniversities.com, (2014). University Rankings | Top Universities. [online] Available at: <a href="http://www.topuniversities.com/university-rankings"></a> [Accessed 18 Oct. 2014].</li><br />
<li>UK Council for International Student Affairs (UKISA). (2013). International student statistics: UK higher education . Retrieved from <a href="http://www.ukcisa.org.uk/Info-for-universities-colleges--schools/Policy-research--statistics/Research--statistics/International-students-in-UK-HE/#International-%28non-UK%29-students-in-UK-HE-in-2012-13"></a></li><br />
<li>University of Heidelberg. (2014). <em>Facts and figures - Students and early career researchers</em>. Retrieved from <a href="http://www.uni-heidelberg.de/university/statistics/students.html"></a> </li><br />
<li>Wadhwa, V., Saxenian, A., Freeman, R. B., & Salkever, A. (2009). <em>Losing the world's best and brightest: America's new immigrant entrepreneurs, part V. Part V</em> (March 19, 2009).</li><br />
<li>Web.mit.edu, (2014). MIT Facts 2014: International Students and Scholars. [online] Available at: <a href="http://web.mit.edu/facts/international.html"></a> [Accessed 18 Oct. 2014].</li><br />
<br />
<li>Ynalvez, M. A., & Shrum, W. M. (2009). International graduate science training and scientific collaboration. International Sociology, 24(6), 870-901.</li><br />
<br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<br />
<br />
<br />
<br />
<br />
</ul><br />
</section><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<script src="http://code.highcharts.com/mapdata/custom/world-robinson-highres.js"></script><br />
<br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>HChughtaihttp://2014.igem.org/Team:Imperial/Informing_DesignTeam:Imperial/Informing Design2014-10-18T02:34:21Z<p>HChughtai: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Informing Design</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#july" >July</a><br />
</li><br />
<li><a data-scroll href="#august">August</a><br />
</li><br />
<li><a data-scroll href="#september">September</a><br />
</li><br />
</ul><br />
<br class="clearLeft"/><br />
</div><br />
</div><br />
</div><br />
</div><br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p>We spoke with individuals and organisations who have interests in water treatment and bacterial cellulose in order to direct the development of our project. This included discussions with academics, industry and NGOs. These talks allowed to us to draw on previous experience in cellulose biosynthesis and processing as well as see how our solution could appropriately fit in with current processes.</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>Key Achievements</h2><br />
<ul><br />
<li>Spoke with water treatment experts to find out about the problem and what specific contaminants can be tackled</li><br />
<li>Discussed with industry how our project could be developed to fit in with existing infrastructure</li><br />
</ul><br />
</div><br />
<br />
<br />
<br />
</div><br />
</section><br />
<div class="pure-g"><br />
<div class="pure-u-1-1"><br />
<section id="july"><br />
<figure class="content-image image-right image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/8/81/IC14-informed-templeton.jpg"><br />
<figcaption>Dr. Michael Templeton</figcaption><br />
</figure><br />
<h2>22/07/14 - Dr. Michael Templeton (Civil Engineering, Imperial College)<br />
</h2><br />
<br />
<p>Dr Michael R. Templeton is a chartered civil engineer and Senior Lecturer in Public Health Engineering at Imperial College. He is Chair of the Water Supply and Quality Panel, at the Chartered Institution of Water and Environmental Management (CIWEM) and an active member of the ICE Water Expert Panel.</p><br />
<p>Some problems that he thought were compelling enough to warrant novel synthetic biology solutions were large-scale desalination, improved hygiene and sanitation in lesser developed regions, and more sensitive water filtration. He was personally enthusiastic about the potential of Synthetic Biology, but of course brought up the uneasiness that we could encounter with the proposed use of micro-organisms in a drinking water treatment. This was an influential opinion in finally deciding to have a biologically-inert filter, one that is produced by the engineered bacteria but is eventually eliminated from the final usable product.. </p><br />
<br />
<p>We discussed the possibility of improving upon current systems, which prompted him to mention the Kanchan arsenic filter - a low-tech solution that has proven to be a long-lasting and cost-efficient one in developing countries, particularly due the accidental formation of a contaminant-eliminating top layer of helpful bacteria called a 'schmutzdecke', and iron nails incorporated to bind arsenic. Here was an example of how biology can improve existing systems, as well as a reminder of the robustness of current slow sand filters.</p><br />
<p> Among the information he shared with us on the current water systems in place in the UK, he mentioned metaldehyde - a main component in slug-targeting pesticide - as one of many contaminants that currently cannot be removed. Pesticide regulations in the EU make this an issue for water suppliers. Currently, water treatment simply minimises the unwanted contaminants in water by diluting contaminants to qualify below the threshold, rather than removing it entirely. From this, we started thinking of other region-specific contaminants and realised there was room for a modular adaptable filtering system. <br />
</p><br />
<h2>22/07/14 - Dr. Andreas Mautner (PaCE, Imperial College)</h2><br />
<p>Dr. Andreas Mautner is a Postdoctoral member at the Polymer and Composite Engineering group at Imperial College London, led by Prof Alexander Bismark. Dr. Mautner’s work focuses on the development of filtering membranes for sustainable water treatment. Specifically, he targets fertilizers, pesticides, heavy metal ions and microbial contamination for further industrial applications.</p><br />
<p>We met with Dr. Mautner to discuss his findings on cellulose-based filters, their characteristics, limitations, and scope for improvement by biological engineering. Amongst other issues, we discussed the biological characteristics of cellulose that could be improved. We also talked about the limitations of the current chemical functionalisation of cellulose, mainly based on the chemical attachment of functional groups. The latter very much reinforced our aims to functionalise our pellicles by both the non-covalent and covalent attachment of biologically-derived proteins of interest, due to their higher affinity for their cognate targets.<br />
</p><br />
<p>Furthermore, he described in detail a variety of post-processing steps and post-production treatment of cellulose pellicles, which became a fundamental pillar of our cellulose post-processing side project.</p><br />
<h2>24/07/14 - Prof. Nigel Graham (Civil Engineering, Imperial College)</h2><br />
<p>Professor Nigel J.D. Graham is an elected Fellow of the International Water Association, and a co-recipient of the Institution of Civil Engineers Telford Gold Medal in 2010. He is the Head of the Environmental and Water Resource Engineering Section and Professor of Environmental Engineering. His research covers the field of Unit Processes for Water and Wastewater Treatment, and Water Supply Engineering.</p><br />
<p>The intention behind our meeting was to compare and expand our knowledge on water treatment processes in different countries, in order to identify an avenue in which our idea could align with. He also brought up an important point that efficiency and lifespan are likely to be at opposing ends. We have seen this as a problem for Thames Water where their membranes require flushing every several minutes, as they are filtering to very high purity standards. This concept caused us to consider the idea of a specific but reusable filter, that functions with a controllable elution. </p><br />
<br />
<br />
<h2>28/07/14 - Dr. Sandy Cairncross (LSHTM)</h2><br />
<p>Dr. Sandy Cairncross is a Professor of Environmental Health at the London School of Hygiene and Tropical medicine (LSHTM) with a vast career spanning water, sanitation and public health implementation in developing countries. Two of our team members met with Dr. Cairncross to discuss using our bacterial cellulose biomaterial as a point-of-use filter in areas where people do not have access to clean drinking water. In the meeting he emphasised that water quantity, rather than quality, is often the crucial factor that reduces incidence of hygiene illnesses such as diarrhoea, and warned that ‘temporary’ solutions such as point-of-use filters can end up becoming inadequate permanent solutions, which reduce governmental focus on improving infrastructure. We also discussed other contexts where our filter could be used such as disaster zones and army transport vans. An enlightening meeting, we re-examined our end application to think about more industrial settings.<br />
</p><br />
<h2>30/07/14 - WaterAid</h2><br />
<figure class="content-image image-left image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/e/e0/IC14-informed-wateraid.jpg"><br />
<figcaption></figcaption><br />
</figure><br />
<p>WaterAid is an international NGO that works worldwide to deliver clean water and sanitation through sustainable, long-term solutions. We visited their London based global office to speak with Ray Heslop, an Engineering Advisor and founder member of the Northumbrian WaterAid Committee. From him we learnt about the importance of sustainable, appropriate solutions, as well as some of the current water distribution and treatment methods. We were informed that it is far easier and preferable to protect a clean water source than attempt to treat a contaminated one. This lead to us to reconsider our initial idea of targeting our bacterial cellulose filter to underdeveloped countries and instead focus on ones with some water infrastructure.</p><br />
<br />
<br />
</section><br />
</div><br />
<div class="pure-u-1-1"><br />
<section id="august"><br />
<br />
<br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/4/41/IC14-informed-thames.jpg"><br />
<figcaption>The team and Dr. Michael Chipps (Thames Water) </figcaption><br />
</figure><br />
<h2>21/08/14 - Thames Water</h2><br />
<p>We also considered the use of our filter in current industrial processes in developed countries. We got in contact with Thames Water, who is the private utility company responsible for water supply and waste water treatment in large parts of London. At their treatment facility we learnt from Dr. Michael Chipps (Principal Research Scientist) and his colleagues in innovation about how water is treated at an industrial scale using a variety of techniques. These included techniques we had come across previously such as slow-sand filters and activated carbon as well as some new methods that they were investigating. Of particular interest were membrane bioreactors and the issues surrounding current cellulose acetate membranes.<br />
</p><br />
<br />
<br />
<br />
</section><br />
</div><br />
<div class="pure-u-1-1"><br />
<section id="september"><br />
<h2>02/09/14 - Médecins Sans Frontières </h2><br />
<p>We considered that our filter may find applications in areas of disaster where more immediate aid and provision of potable water may be required. Our meeting with Dr. Biserka Pop Stefanija, a Water Sanitation Advisor from (MSF) gave us insights into how our filter would be better suited to use by organisations such as MSF in bulk treatment for temporary storage and distribution than as a point of use filter.<br />
</p><br />
<p>From our meeting we learnt how it is important to rapidly set up water treatment and provision facilities when responding to crises. Not only is this vital for drinking and prevention of disease, it also allows medics to provide their services effectively. Water is viewed as part of public health rather than a commodity. An interesting part of our discussion was how it was important to engage with the community when providing technological solutions. If the water treatment procedure is too much of a hassle, it simply won’t be used and so will have no effect. Cultural/traditional ideas and political propaganda may also halt the uptake of new technologies. This is something we would have to consider in the future.<br />
<br />
</p><br />
<br />
</section><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
</div><br />
<br />
</div><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>HChughtaihttp://2014.igem.org/Team:Imperial/Water_FiltrationTeam:Imperial/Water Filtration2014-10-18T02:31:35Z<p>HChughtai: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Water Filtration</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#Introduction">Introduction</a><br />
</li><br />
<li><a data-scroll href="#Turbidity">Turbidity</a><br />
</li><br />
<li><a data-scroll href="#Phytochelatin-dCBD metal binding assay">Phytochelatin-dCBD metal binding assay</a><br />
</li><br />
<li><a data-scroll href="#Nickel filtration assay">Nickel filtration assay</a><br />
</li><br />
<li><a data-scroll href="#References">References</a><br />
</li><br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
</div><br />
</div><br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p>By attaching functional proteins to cellulose we can expand it's properties and selectivity capture specific contaminants in water. We used five different cellulose binding domains and fused them to different metal binding proteins, and sfGFP. We performed assays to test the binding of the CBD fusions to our cellulose.</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>Key Achievements </h2><br />
<ul><br />
<li>Made cellulose binding domains</li><br />
<br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<div class="pure-g"><br />
<div class="pure-u-1-1"><br />
<section id="Introduction"><br />
<h2>Introduction</h2><br />
<p><br />
Water is typically purified by passing it through layers of porous materials, each specially selected for its ability to remove specific forms of contamination. All porous materials can filter particles by size, many have extra capabilities thanks to their chemical properties. For example, charcoal - or activated carbon - is a porous component of household and industrial water filters that can also bind large or electron-rich molecules via the van der Waals forces, and catalyse the breakdown of other chemicals such as molecular chlorine. While there are many different types of filters, we can categorise and compare them using their measurable physical and chemical properties. The key physical properties are:</p><br />
<p><br />
<ul><br />
<li><br />
Pore size - average or maximum size of pores in the material</li><br />
<li><br />
Porosity - volume of the filter not occupied by solid material</li><br />
<li><br />
Tortuosity - length of paths through the filter compared with a straight line</li><br />
<li><br />
Adhesion - the strength of hydrogen bond interactions between the fluid and filter</li><br />
<li><br />
Kinetic rate constants - parameters defining how the filter material affects chemical reactions in the fluid</li><br />
</ul><br />
</p><br />
<p><br />
These properties contribute to the filter’s flow rate, measured in units of fluid filtered per unit surface area of the filter per unit time (e.g. Ga m<sup>-2</sup> h<sup>-1</sup>). Altering the filter’s flow rate generally affects the filter’s efficiency at removing its targets, as increasing the flow rate typically involves increasing the pore size or reducing the surface area of the filter in contact with the fluid. This trade-off is the main hurdle in industrial water filtration, where demands for high-quality filtration require very low flow rates. Industrial processes are further complicated by blockage of the pores, fouling of the filter by organisms and the lack of a complete set of materials that will exhaustively filter all contaminants - heavy metal ions, small organic molecules and non-polar compounds remain difficult to filter without prior chemical treatments that themselves need to be filtered out.</p><br />
</section><br />
</div><br />
<div class="pure-u-1-1"><br />
<section id="Turbidity"><br />
<h2>Turbidity</h2><br />
<p><br />
Ultrafiltration membranes remove particulates by size exclusion. Our bacterial cellulose membranes completely removed turbidity from input water outputting clean, potable water.<br />
Input water containing 1% w/v organic solids from Imperial College Queens lawn was vortexed then 3ml passed through filters of 25cm3 area. Turbidity of flowthrough was measured in a spectrophotometer, absorbance at OD<sub>500</sub> as recommended by Epa (1993).<br />
</p><br />
<figure class="content-image image-full"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/3/31/IMG_20141017_132653.jpg"><br />
<figcaption>Figure 1: The picture shows different amount of colouring in the water representing the debris left after filtering water mixed with dirt using different filter methods. From left to right: Unfiltered water, tissue paper filtered water, filter paper filtered water, bacterial cellulose filtered water, clean distilled water.</figcaption><br />
</figure><br />
<br />
</section><br />
<section id="Phytochelatin-dCBD metal binding assay"><br />
<h2>Phytochelatin-dCBD metal binding assay</h2><br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/c/c7/IC14-Metal-binding-result-table.PNG"><br />
<figcaption>Figure 1:</figcaption><br />
</figure><br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/4/45/IC14-metal-binding-first-wash-EDTA.png"><br />
<figcaption>Figure 2:</figcaption><br />
</figure><br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/3/34/IC14-metal-binding-avg-conc-second-wash.png"><br />
<figcaption>Figure 3:</figcaption><br />
</figure><br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/1/1e/IC14-avg-nickel-1st-2nd-wash.png "><br />
<figcaption>Figure 4:</figcaption><br />
</figure><br />
</section><br />
<section id="Nickel filtration assay"><br />
<h2>Nickel filtration assay</h2><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/9/9d/IC14-Water_filtration_pictures.png"><br />
<figcaption>Figure X: The set up for the nickel filtration assay. A) The coffee press used for the mounting of the cellulose and for filtration process. B) Cellulose without attached phytochelatin-dCBD protein. C) Functionalised cellulose with attached phytochelatin-dCBD protein.</figcaption><br />
</figure><br />
<p><br />
The nickel ions are an example of heavy metals, poisonous even in relatively small concentrations in water and notoriously difficult to filter with current filtration methods. Therefore our filtration concept was tested against a concentration of nickel in water that far exceeds the safe limits. We have attempted to filter high amount of nickel (250 μM) through the cellulose filters grown by the <em>G. Xylinus</em> ATCC53582 strain (<a href=”http://parts.igem.org/Part:BBa_K1321305”>K1321305</a>). The phytochelatin-dCBD fusion (<a href=”http://parts.igem.org/Part:BBa_K1321110”>K1321110</a>) was coated on the surface of the cellulose to make a nickel specific functionalised ultra filtration membrane. To test the two membranes we have used coffee press. As a control measure we have also attempted to the filter the nickel solution through the cellulose that was not further functionalised. Obtained filtrates have been quantified and analysed using Mass Spectrometry.<br />
</p><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
<br />
<br />
<h3>Results</h3><br />
</div><br />
<div class="pure-u-1-2"><br />
<figure class="content-image image-full"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/7/7b/IC14-Nickel_filtered_functionalised_cellulose.png"><br />
<figcaption>Figure Y: Here shown is the decrease in the nickel content of the filtered nickel solution. The filtrate was obtained afer filtering with the phytochelatin-dCBD functionalised cellulose membrane. The concentration of unfiltered solution is provided as control.</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<figure class="content-image image-full"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/f/f1/Nickel_filtered_cellulose_vs_functionalised.png"><br />
<figcaption>Figure Z: Here shown is the difference in the decrease of the nickel content when filtered with cellulose compared with the functionalised cellulose with phytochelatin-dCBD.</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-1"><br />
<p><br />
From the results in figure Y, it can be seen that the cellulose functionalised with phytochelatin-dCBD (<a href="http://parts.igem.org/Part:BBa_K1321110">K1321110</a>) is able to decrease the nickel content in the filtrate by 95%. This shows that the ultrafiltration method with functional protein domains on the cellulose is working and is a viable option for heavy metal removal from polluted water. Also the results observed in figure Z shows that the non-functionalised cellulose is able to remove nickel from water, and the functionalisation of the cellulose further increases the incremental decrease of the nickel content in the filtrate by an approximate further half. The results presented suggest that bacterial cellulose is a good method for removing nickel from water and functionalisation of the cellulose provides a further decrease in the final concentration of the nickel filtrate.</p><br />
<p><br />
This mechanism shows that the cellulose itself is able to remove contaminants from water, in this particular example Ni<sup>2+</sup>. It shows good ability to remove nickel ions, possibly due to nickel ion small size and hydrophillic nature. It is also shown that the functionalisation of the cellulose with the specific heavy metal binding chelating protein fusion with a cellulose binding domain provides an extra incremental decrease in the Ni<sup>2+</sup> concentration found in the filtrate. It is possible that depending on the nature of the contaminant, the incremental change provided by the functionalisation step can be increased. This can be of specific importance for the contaminants that cannot be caught by the inherent filtration ability of the cellulose material.</p><br />
</div><br />
<br />
<br />
</section><br />
</div><br />
<div class="pure-u-1-1"><br />
<section id="References"><br />
<h2>References</h2><br />
<br />
</section><br />
</div><br />
</div><br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>HChughtaihttp://2014.igem.org/Team:Imperial/NotebookTeam:Imperial/Notebook2014-10-18T02:30:17Z<p>HChughtai: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<div class="content-wrapper"><br />
<h1>Notebook</h1><br />
<div class="pure-g"><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2>Introduction</h2><br />
<p>We’ve spent the last four months working on our project. We’ve had a great time on the project through successes and failures.This section serves as a record of the time spent on our work.</p><br />
<br />
</div><br />
<br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<img class="bg" src="https://static.igem.org/mediawiki/2014/e/ef/IC14-notebook-image2.jpg"><br />
<br />
</div><br />
<br />
</div><br />
<br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2>Brainstorming</h2><br />
<p>Our idea was generated from weeks of intense brainstorming and development. See some of the ideas we rejected here.</p><br />
<div class="more-box more-box-bottom"><a href="https://2014.igem.org/Team:Imperial/Brainstorming">read more...</a></div><br />
</div><br />
<br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2>Lab book</h2><br />
<p>Find details of all our lab work here. We compiled separate lab-books for each part of our project.</p><br />
<div class="more-box more-box-bottom"><a href="https://2014.igem.org/Team:Imperial/Lab-book">read more...</a></div><br />
<br />
</div><br />
<br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2>Protocols</h2><br />
<p>We believe that science should be open to all and that anyone should be able to reproduce our work. We have provided all the protocols we used in our experiments for both E. coli and Gluconacetobacter. Find them here.</p><br />
<div class="more-box more-box-bottom"><a href="https://2014.igem.org/Team:Imperial/Protocols">read more...</a></div><br />
<br />
</div><br />
<br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<img class="bg" src="https://static.igem.org/mediawiki/2014/1/12/IC14-fish.jpg"><br />
<br />
</div><br />
<br />
</div><br />
<br />
<br />
</div><br />
</div><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>HChughtaihttp://2014.igem.org/File:IC14-fish.jpgFile:IC14-fish.jpg2014-10-18T02:30:08Z<p>HChughtai: </p>
<hr />
<div></div>HChughtaihttp://2014.igem.org/Team:Imperial/Templates:headerTeam:Imperial/Templates:header2014-10-18T02:26:40Z<p>HChughtai: </p>
<hr />
<div><html><br />
<br />
<head><br />
<meta charset="utf-8"><br />
<meta name="viewport" content="width=device-width, initial-scale=1.0"><br />
<title>Imperial iGEM 2014</title><br />
<link rel="stylesheet" href="http://code.jquery.com/ui/1.11.1/themes/smoothness/jquery-ui.css"><br />
<link rel="stylesheet" href="https://2014.igem.org/Team:Imperial/Resources/CSS:pure-nr?action=raw&ctype=text/css"><br />
<link rel="stylesheet" href="https://2014.igem.org/Team:Imperial/Resources/CSS:pure-skin?action=raw&ctype=text/css"><br />
<link rel="stylesheet" href="https://2014.igem.org/Team:Imperial/Resources/CSS:wiki?action=raw&ctype=text/css"><br />
<link rel="stylesheet" href="https://2014.igem.org/Team:Imperial/Resources/CSS:main?action=raw&ctype=text/css"><br />
<link rel="stylesheet" href="https://2014.igem.org/Team:Imperial/Resources/CSS:bxslider?action=raw&ctype=text/css"><br />
<link rel="stylesheet" href="https://2014.igem.org/Team:Imperial/Resources/CSS:colorbox?action=raw&ctype=text/css"><br />
<link rel="stylesheet" href="https://2014.igem.org/Team:Imperial/Resources/CSS:timeline?action=raw&ctype=text/css"><br />
<br />
<link href='http://fonts.googleapis.com/css?family=Oxygen:400,300,700' rel='stylesheet' type='text/css'><br />
<link href='http://fonts.googleapis.com/css?family=Noto+Sans:400,700,400italic,700italic' rel='stylesheet' type='text/css'><br />
<br />
<br />
<script src="http://yui.yahooapis.com/3.17.2/build/yui/yui-min.js"></script><br />
<script src="http://ajax.googleapis.com/ajax/libs/jquery/1.11.1/jquery.min.js"></script><br />
<script src="http://code.jquery.com/ui/1.11.1/jquery-ui.js"></script><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:bxslider?action=raw&ctype=text/js"></script><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:team?action=raw&ctype=text/js"></script><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:log?action=raw&ctype=text/js"></script><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:subNav?action=raw&ctype=text/js"></script><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:bind-polyfill?action=raw&ctype=text/js"></script><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:smooth-scroll?action=raw&ctype=text/js"></script><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:colorbox?action=raw&ctype=text/js"></script><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<script><br />
$(document).ready(function () {<br />
$('.bxslider').bxSlider({<br />
<br />
});<br />
YUI({<br />
classNamePrefix: 'pure'<br />
}).use('gallery-sm-menu', function (Y) {<br />
<br />
var horizontalMenu = new Y.Menu({<br />
container: '#main_nav',<br />
sourceNode: '#std-menu-items',<br />
orientation: 'horizontal',<br />
hideOnOutsideClick: false,<br />
hideOnClick: false<br />
});<br />
<br />
horizontalMenu.render();<br />
horizontalMenu.show();<br />
<br />
});<br />
$(".youtube").colorbox({<br />
iframe: true,<br />
innerWidth: 640,<br />
innerHeight: 390<br />
});<br />
<br />
$(".iframe").colorbox({<br />
iframe: true,<br />
width: "80%",<br />
height: "80%"<br />
});<br />
$(".accordion").accordion({<br />
heightStyle: "content",<br />
collapsible: true,<br />
active: false<br />
});<br />
smoothScroll.init({<br />
offset: 40<br />
<br />
});<br />
<br />
<br />
});<br />
</script><br />
<br />
<br />
<script><br />
(function (i, s, o, g, r, a, m) {<br />
i['GoogleAnalyticsObject'] = r;<br />
i[r] = i[r] || function () {<br />
(i[r].q = i[r].q || []).push(arguments)<br />
}, i[r].l = 1 * new Date();<br />
a = s.createElement(o),<br />
m = s.getElementsByTagName(o)[0];<br />
a.async = 1;<br />
a.src = g;<br />
m.parentNode.insertBefore(a, m)<br />
})(window, document, 'script', '//www.google-analytics.com/analytics.js', 'ga');<br />
<br />
ga('create', 'UA-54018926-1', 'auto');<br />
ga('send', 'pageview');<br />
</script><br />
</head><br />
<br />
<br />
<body><br />
<div class="wrapper"><br />
<div class="header"><br />
<br />
<div class="header-banner"><br />
<div class="left"><br />
<a href="https://2014.igem.org/Team:Imperial"><img id="logo-img" src="https://static.igem.org/mediawiki/2014/e/e1/IC14-logo.png"></a><br />
<a style="text-decoration: none" href="https://2014.igem.org/Team:Imperial"><h1 id="Logo">Aqualose</h1></a><br />
</div><br />
<div class="right"><br />
<br />
<a target="_blank" href="http://twitter.com/imperialigem"><br />
<img class="social" src="https://static.igem.org/mediawiki/2014/3/37/IC14-logo-twitter.png"><br />
</a><br />
<a target="_blank" href="http://www.facebook.com/imperialigem2014"><br />
<img class="social" src="https://static.igem.org/mediawiki/2014/8/87/IC14-logo-facebook.png"><br />
</a><br />
<a target="_blank" href="http://www.imperial.ac.uk/"><br />
<img class="social" src="https://static.igem.org/mediawiki/2014/3/38/IC14-logo-imperial-black.png"><br />
</a><br />
<a target="_blank" href="https://2014.igem.org/"><br />
<img class="social" src="https://static.igem.org/mediawiki/2014/1/12/IC14-logo-igem.png"><br />
</a><br />
</div><br />
<br />
</div><br />
<br />
<br />
<div id="main_nav" class="pure-menu pure-menu-open pure-menu-horizontal"><br />
<ul id="std-menu-items"><br />
<li> <a href=#>Project</a><br />
<ul><br />
<li> <a href="https://2014.igem.org/Team:Imperial/Project">Overview</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Project_Background">Background</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Gluconacetobacter"><em>G. xylinus</em></a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/EColi"><em>E. coli</em></a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/coculture">Co-culture</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Functionalisation">Functionalisation</a><br />
</li><br />
<br />
<li><a href="https://2014.igem.org/Team:Imperial/Mass_Production_and_Processing">Mass Production and Processing</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Mechanical_Testing">Mechanical Testing</a><br />
</li><br />
</ul><br />
</li><br />
<li> <a href=#>Achievements</a><br />
<ul><br />
<li> <a href="https://2014.igem.org/Team:Imperial/Achievements">Overview</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Parts">Parts</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Results">Results</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Judging_Criteria">Judging Criteria</a><br />
</li><br />
<li> <a href="https://2014.igem.org/Team:Imperial/InterLab_Study">Interlab Study</a><br />
</li><br />
</ul><br />
</li><br />
<br />
<br />
<li> <a href=#>Application</a><br />
<ul><br />
<li><a href="https://2014.igem.org/Team:Imperial/Implementation">Implementation</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Water_Filtration">Water Filtration</a><br />
</li><br />
<br />
<br />
</ul><br />
</li><br />
<br />
<br />
<br />
<br />
<br />
<li> <a href=#>Policy & Practices</a><br />
<ul><br />
<li> <a href="https://2014.igem.org/Team:Imperial/Policy_and_Practices">Overview</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Informing_Design">Informing Design</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Water_Report">Water Report</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/The_i_in_iGEM">The i in iGEM</a><br />
</li><br />
<br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Outreach">Outreach</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Collaborations">Collaborations</a><br />
</li><br />
<br />
<br />
</ul><br />
</li><br />
<li> <a href=#>Modelling</a><br />
<ul><br />
<li> <a href="https://2014.igem.org/Team:Imperial/Modelling">Overview</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Induction_Model">Induction Model</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/CBD_Kinetics_Model">CBD Kinetics Model</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Pellicle_Model">Pellicle Model</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/BioHackspace_Model">BioHackspace Model</a><br />
</li><br />
<br />
</ul><br />
</li><br />
<br />
<li> <a href=#>Notebook</a><br />
<ul><br />
<li> <a href="https://2014.igem.org/Team:Imperial/Notebook">Overview</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Lab-book">Lab-book</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Protocols">Protocols</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Brainstorming">Brainstorming</a><br />
</li><br />
</ul><br />
</li><br />
<br />
<li> <a href="https://2014.igem.org/Team:Imperial/Safety">Safety</a><br />
</li><br />
<br />
<li><a href="https://2014.igem.org/Team:Imperial/Art_and_Design">Art & Design</a><br />
</li><br />
<br />
<li> <a href="#">Team</a><br />
<ul><br />
<li><a href="https://igem.org/Team.cgi?id=1321">Official Profile</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Students">Students</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Instructors_and_Advisors">Instructors and Advisors</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Sponsors">Sponsors</a><br />
</li><br />
<li><a href="https://2014.igem.org/Team:Imperial/Attributions">Attributions</a><br />
</li><br />
</ul><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<br />
<br />
</body><br />
<br />
</html></div>HChughtaihttp://2014.igem.org/Team:Imperial/timelineTeam:Imperial/timeline2014-10-18T02:26:19Z<p>HChughtai: Blanked the page</p>
<hr />
<div></div>HChughtaihttp://2014.igem.org/Team:Imperial/ResultsTeam:Imperial/Results2014-10-18T02:23:36Z<p>HChughtai: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Results</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#overview">Overview</a><br />
</li><br />
<li><a data-scroll href="#result1">RESULT 1</a><br />
</li><br />
<li><a data-scroll href="#result2">RESULT 2</a><br />
</li><br />
<li><a data-scroll href="#result3">RESULT 3</a><br />
</li><br />
<li><a data-scroll href="#result4">RESULT 4</a><br />
</li><br />
<li><a data-scroll href="#result5">RESULT 5</a><br />
</li><br />
<br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<section id="overview"><br />
<h2>Overview</h2><br />
<p>Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.</p><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
</section><br />
<section id="result1"><br />
<h2>HEADLINE RESULT OVERVIEW 1</h2><br />
<p>Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.</p><br />
<br />
</section><br />
<section id="result2"><br />
<h2>HEADLINE RESULT OVERVIEW 2</h2><br />
<p>Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.</p><br />
<br />
</section><br />
<section id="result3"><br />
<h2>HEADLINE RESULT OVERVIEW 3</h2><br />
<p>Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.</p><br />
<br />
</section><br />
<section id="result4"><br />
<h2>HEADLINE RESULT OVERVIEW 4</h2><br />
<p>Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.</p><br />
<br />
</section><br />
<section id="result5"><br />
<h2>HEADLINE RESULT OVERVIEW 5</h2><br />
<p>Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.</p><br />
<br />
</section><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>HChughtaihttp://2014.igem.org/Team:Imperial/ResultsTeam:Imperial/Results2014-10-18T02:23:10Z<p>HChughtai: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Background</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#overview">Overview</a><br />
</li><br />
<li><a data-scroll href="#result1">RESULT 1</a><br />
</li><br />
<li><a data-scroll href="#result2">RESULT 2</a><br />
</li><br />
<li><a data-scroll href="#result3">RESULT 3</a><br />
</li><br />
<li><a data-scroll href="#result4">RESULT 4</a><br />
</li><br />
<li><a data-scroll href="#result5">RESULT 5</a><br />
</li><br />
<br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<section id="overview"><br />
<h2>What we achieved...</h2><br />
<p>Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.</p><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
</section><br />
<section id="result1"><br />
<h2>HEADLINE RESULT OVERVIEW 1</h2><br />
<p>Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.</p><br />
<br />
</section><br />
<section id="result2"><br />
<h2>HEADLINE RESULT OVERVIEW 2</h2><br />
<p>Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.</p><br />
<br />
</section><br />
<section id="result3"><br />
<h2>HEADLINE RESULT OVERVIEW 3</h2><br />
<p>Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.</p><br />
<br />
</section><br />
<section id="result4"><br />
<h2>HEADLINE RESULT OVERVIEW 4</h2><br />
<p>Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.</p><br />
<br />
</section><br />
<section id="result5"><br />
<h2>HEADLINE RESULT OVERVIEW 5</h2><br />
<p>Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.</p><br />
<br />
</section><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>HChughtaihttp://2014.igem.org/Team:Imperial/ResultsTeam:Imperial/Results2014-10-18T02:22:16Z<p>HChughtai: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Background</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#overview">Overview</a><br />
</li><br />
<li><a data-scroll href="#result1">RESULT 1</a><br />
</li><br />
<li><a data-scroll href="#result2">RESULT 2</a><br />
</li><br />
<li><a data-scroll href="#result3">RESULT 3</a><br />
</li><br />
<li><a data-scroll href="#result4">RESULT 4</a><br />
</li><br />
<li><a data-scroll href="#result5">RESULT 5</a><br />
</li><br />
<br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<section id="overview"><br />
<h2>What we achieved...</h2><br />
<p></p><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
</section><br />
<section id="result1"><br />
<h2>HEADLINE RESULT OVERVIEW 1</h2><br />
<p></p><br />
<br />
</section><br />
<section id="result2"><br />
<h2>HEADLINE RESULT OVERVIEW 2</h2><br />
<p></p><br />
<br />
</section><br />
<section id="result3"><br />
<h2>HEADLINE RESULT OVERVIEW 3</h2><br />
<p></p><br />
<br />
</section><br />
<section id="result4"><br />
<h2>HEADLINE RESULT OVERVIEW 4</h2><br />
<p></p><br />
<br />
</section><br />
<section id="result5"><br />
<h2>HEADLINE RESULT OVERVIEW 5</h2><br />
<p></p><br />
<br />
</section><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>HChughtaihttp://2014.igem.org/Team:Imperial/Mechanical_TestingTeam:Imperial/Mechanical Testing2014-10-18T02:15:10Z<p>HChughtai: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Mechanical Testing</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#introduction">Introduction</a><br />
</li><br />
<li><a data-scroll href="#methods">Methods</a><br />
</li><br />
<br />
<br />
<li><a data-scroll href="#results">Results</a><br />
</li><br />
<li><a data-scroll href="#discussion">Discussion</a><br />
</li><br />
<li><a data-scroll href="#limitations">Limitations</a><br />
</li><br />
<li><a data-scroll href="#manufacturing">Manufacturing Relevance</a><br />
</li><br />
<li><a data-scroll href="#appendix">Appendix</a><br />
</li><br />
<li><a data-scroll href="#references">References</a><br />
</li><br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
</div><br />
</div><br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p>To check the feasibility of using our bacterial cellulose as a customisable ultrafiltration membrane, the mechanical properties were tested. For this to work, we checked the tensile strength of our filter, calculated the shear stress and estimated the processing method that produces membrane with the longest life-time. Our ultimate tensile stress calculated matched with literature values of bacterial cellulose within standard deviation, and the data analysis provided the insight to use non-blended cellulose rather than blended..</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>Key Achievements </h2><br />
<ul><br />
<li>Introduced a new aspect to the manufacturing track in terms of quantitatively characterising the mechanical properties of our product, bacterial cellulose<br />
</li><br />
<li>Quantified the tensile stress-strain properties of our bacterial cellulose.<br />
</li><br />
<li>Established the feasibility of using bacterial cellulose as a customisable ultrafiltration membrane with water pressures of 75 bar within a conservative safety margin.<br />
</li><br />
<li>Discovered that non-blended compared to blended bacterial cellulose was significantly more ductile, and would have longer life time as a water filter, which informed the choice of cellulose for the final product.<br />
</li><br />
<li>Tested and analysed 20 samples of bacterial cellulose test pieces.<br />
</li><br />
<li>Created a size and quality optimised gif for visualisation of the experiment and written protocol for future iGEM teams to do the same.<br />
</li><br />
<br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<div class="pure-g"><br />
<div class="pure-u-1-1"><br />
<section id="introduction"><br />
<h2>Introduction</h2><br />
<br />
<br />
<br />
<img class="content-image image-full" src="https://static.igem.org/mediawiki/2014/6/60/IC14-MechTest-CelluloseTest.jpg"><br />
<br />
<br />
<br />
<div class="right"><br />
<img class="content-image" src="https://static.igem.org/mediawiki/2014/e/e3/IC14-MechTest-CBIS1.jpg" width=150><br />
<br/><br />
<img class="content-image" src="https://static.igem.org/mediawiki/2014/f/f7/IC14-MechTest-CBIS2.jpg" width=100><br />
<br />
</div><br />
<br/><br />
<p><em>“How long would the bacterial cellulose water filter last? What will be the pressure we can apply on to it?”</em> - Dr. Chipps (Principal Research Scientist at Thames Water)</p><br />
<p>The most accessible method of finding an answer to Dr. Chipps’ questions is to asses the quality of our material by pulling a test piece until it breaks, a tensile test. The quality of our bacterial cellulose will determine the water pressure that can be applied to it in when used as a customisable ultrafiltration membrane. Since the water pressure is a major limiting factor of the flow rates produced in such a setting, a key step to establishing the feasibility of our project is to perform a tensile test.</p><br />
<p>Tensile testing of bacterial cellulose is a common way of characterising and comparing its mechanical properties (Khesk 2006, Cheng 2009, Shezad 2010) and provides an indication of the orientation of the fibres in the bacterial cellulose pellicle. Another advantage is that for a polycrystalline material like bacterial cellulose grown in static media, the shear stress, directly related to hydrostatic water pressure, can be interpolated based on Von Mises Criterion.</p><br />
<p>Therefore, we contacted Dr. Angelo Karunaratne of the Royal British Legion Centre of Blast Injury Studies at Imperial College, requesting access to test samples in an Instron 5866 materials testing machine (Instron Inc., Norwood, USA). For this test our aim was to calculate the young’s modulus, ultimate tensile stress, yield stress and strain at failure.</p><br />
<br />
</section><br />
</div><br />
<div class="pure-u-1-1"><br />
<section id="methods"><br />
<h2>Methods</h2><br />
<br />
<br />
<br />
<br />
<br />
<br />
<figure class="content-image image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/6/60/IC14-MechTest-Instron.jpg"><br />
<figcaption>Figure 1: Instron 5866 materials testing machine</figcaption><br />
</figure><br />
<br />
<figure class="content-image image-right image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/9/92/IC14-MechTest-Test2b.jpg"><br />
<figcaption>Figure 2b: Actual test state: tensile testing state of thin bacterial cellulose pellicle<br />
</figcaption><br />
</figure><br />
<br />
<figure class="content-image image-right image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/0/03/IC14-MechTest-Test2a.jpg"><br />
<figcaption>Figure 2a: Dumbbell shape used as the shape for testing</figcaption><br />
<br />
</figure><br />
<br />
<br />
<p>Samples were prepared by oven drying at 60 C for 6 hours between VWR 413 filter paper, without pressure. Subsequently, samples were kept at room temperature (20 C) before testing. Cellulose was cut into 0.1 mm x 11 mm x 32 mm dumbbell shapes as shown in figure 2 a, following the shape recommended by ISO 527-3 guidelines for determination of tensile properties of plastics. Dumbbell shapes have the advantage of avoiding stress concentration at the clamps, and the dimensions chosen had sufficiently similar small width to large width ratio to literature dimensions (0.16mm × 100mm × 150mm) to allow for comparison across studies (Sherif 2006). A digital vernier calliper was used to measure the thickness of each of the samples. 9 samples were used for the main cellulose fabric intended for water filtration, 2 were used for blended cellulose samples due to limited availability.</p><br />
<br />
<figure style="float:left;margin:10px;"><br />
<img src="https://static.igem.org/mediawiki/2014/5/53/IC14-BC_tensile_test.gif" width="200"><br />
<figcaption>Figure 3: Cellulose failing under stress</figcaption><br />
</figure><br />
<p>The test involves clamping test pieces into the instron machine, moving the upper clamp upwards at a specific elongation time, set to 20 mm/min to match that of existing literature (Sherif, 2006) and tracking the tensile force of the BC sample until the sample fails. Stress() was calculated as the tensile force divided by the cross sectional area measured as width x thickness. Young’s modulus (E) was calculated as stress/strain in the linear section of the average graph. Strain () was calculated as L/L0where L is the elongation from the initial length L0. Samples were tested until visually confirming failure as shown in figure 3.</p><br />
<br />
<br />
<p>Two main sample types were tested. The BC pellicles intended for water filtration were immersed in a solution of Wizz Active Oxygen Fabric Stain Remover dissolved in distilled water. After 4 days, the pellicles were removed from the container, cut into squares of 5cm by 5cm, and allowed to dry between VWR 413 filter paper in an oven at 60 ⁰C for 3 hours. Then, the BC layered in filter paper was moved to room temperature, folded in Blue Roll, clamped between heatproof mats with mechanical clamps and left for 24 hours. This type of cellulose will be referred to as non-blended BC.</p><br />
<p>Alternative BC samples were treated in a 0.1 M NaOH solution in 80C for 3 hours, upon which it was dried off with blue roll and immersed in distilled water. After being in the distilled water solution for 12 hours, the BC was dried of with blue roll and blended in a Jamie Oliver food processor for 12 min at speed 2.</p><br />
<figure class="content-image image-half "><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/2/2e/IC14-MechTest-ActiveOxygen.jpg"><br />
<figcaption>Figure 4: Active Oxygen Fabric Stain Remover treated BC for 4 days</figcaption><br />
</figure><br />
<br />
<figure class="content-image image-half "><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/d/d2/IC14-MechTest-Blended.png"><br />
<figcaption>Figure 5: a) 0.1 M NaOH treated BC, blended and spread onto VWR 413 filter paper to dry b) Phillips Jamie Oliver Blender that produced the BC of part a.</figcaption><br />
</figure><br />
<br />
</section><br />
</div><br />
<div class="pure-u-1-1"><br />
<section id="results"><br />
<h2>Results</h2><br />
<figure class="content-image"><br />
<table class="tg image-full"><br />
<tr><br />
<th class="tg-e3zv">Sample processing</th><br />
<th class="tg-e3zv">Ultimate tensile stress (MPa)</th><br />
<th class="tg-e3zv">Yield stress (Mpa)</th><br />
<th class="tg-e3zv">Young's modulus (Mpa)</th><br />
<th class="tg-e3zv">Strain at break (%)</th><br />
</tr><br />
<tr><br />
<td class="tg-e3zv">Non-blended bacterial cellulose</td><br />
<td class="tg-031e">29.9 ± 6.4</td><br />
<td class="tg-031e">25.2 ± 7.2</td><br />
<td class="tg-031e">1.5 ± 0.1</td><br />
<td class="tg-031e">21 ± 3</td><br />
</tr><br />
<tr><br />
<td class="tg-e3zv">Blended bacterial cellulose</td><br />
<td class="tg-031e">208 ± 80</td><br />
<td class="tg-031e">155 ± 11</td><br />
<td class="tg-031e">50.5 ± 1</td><br />
<td class="tg-031e">4.1 ± 0.9</td><br />
</tr><br />
</table><br />
<figcaption>Table 1</figcaption><br />
</figure><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<figure class="content-image image-full "><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/1/15/IC14-MechTest-6.png"><br />
<figcaption>Figure 6: Tensile Stress-Strain Graph of Bacterial Cellulose</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<figure class="content-image image-full "><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/4/4b/IC14-MechTest-7.png"><br />
<figcaption>Figure 7: Average Tensile Stress-Strain Graph of Bacterial Cellulose</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<figure class="content-image image-full "><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/9/9b/IC14-MechTest-8.png"><br />
<figcaption>Figure 8: Tensile Stress-Strain Graph of Blended Bacterial Cellulose</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<figure class="content-image image-full "><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/0/03/IC14-MechTest-9.png"><br />
<figcaption>Figure 9: Tensile Stress Average of Blended Cellulose</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<figure class="content-image image-full "><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/e/eb/IC14-MechTest-9.5.png"><br />
<figcaption>Figure 10: Mechanical Properties of Blended vs. Non-Blended Cellulose</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<figure class="content-image image-full "><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/5/56/IC14-MechTest-10.png"><br />
<figcaption>Figure 11: Average Tensile Stress of Blended and Non-Blended Cellulose</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-1"><br />
<p>The results of the mechanical tests of blended BC and non-blended BC are shown in table 1. The corresponding measurement data are shown in figure 3 and 4. As shown in table 1, the E, and of non-blended BC was 1.52 MPa, 30 MPa and 35%, respectively. 9 samples were tested to account for variability in cellulose samples produced as graphed in figure 5. The tensile stress is equal within standard deviation to that of 34 MPa found by (Chen 2009), indicating literature levels of tensile strength of the material produced.</p><br />
<p>As shown in table 1, the yield stress of blended cellulose is 178 MPa higher than that of non-blended cellulose whilst the strain at break was 4% for blended compared to 21% for non-blended cellulose. This indicates that blended cellulose is more brittle than non-blended, making non-blended cellulose a more promising candidate for water filtration. This is because brittle materials are more prone to fatigue-crack propagation (Ritchie 1998) when exposed to cyclic loading characteristic to the use of ultrafiltration membranes, giving brittle materials a shorter expected life time.</p><br />
</div><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
</section><br />
</div><br />
<div class="pure-u-1-1"><br />
<section id="discussion"><br />
<h2>Discussion</h2><br />
<p>What is the maximum water pressure that can be applied?</p><br />
<p>For the cellulose tested with an ultimate tensile stress of 30 MPa and a yield stress of 27 MPa, it is possible to estimate the maximum pressure that our bacterial cellulose filter can sustain by calculating the maximum shear stress (τ). Based on the work of (Jajuee 2006) on membrane filtration, it can be assume that shear stress is the most considerable force acting on the customised cellulose membrane. Combining this with the assumption that non-blended bacterial cellulose is ductile due to being polycrystalline (Tischer 2010), as can be seen in the gif of figure 3 and by the large plastic region shown in figure 7, the Von Mises Criterion can be used to calculate the shear stress. This relates shear stress to yield stress by: σ=√3 τ.Hence, the maximum shear stress is 15.5 MPa. Now, a safety factor of 2 would ensure safe usage of the cellulose membrane, thus a shear stress of half the theoretical maximum shear stress i.e. 7.5 MPa is the advisable working shear stress. This correlates to a hydrostatic pressure of 75 bar, which more than suffices for the pressure ranges of 0.3-3 bar used in ultrafiltration membranes (Reclamation Fact Sheet)</p><br />
</section><br />
<br />
<section id="limitations"><br />
<h2>Limitations</h2><br />
<p>In addition to tensile testing, it would be ideal to perform a fatigue stress test as a material like a water filter loaded over many cycles is more likely to fail due to fatigue than tensile loading, which expectedly occur at lower rates than the ultimate tensile stress predicted. To accommodate for this limitation, the cellulose we have produced is being tested by Professor Alexander Bismarck’s group at University of Vienna, which will also provide measurements of its permeability i.e. flow rates at different water pressures. These results are on their way as we speak.</p><br />
</section><br />
<section id="manufacturing"><br />
<h2>Relevance to Manufacturing track</h2><br />
<p>To the best of our knowledge, characterising the mechanical properties of the various products produced in the iGEM Manufacturing Track has been rather overlooked by previous teams, despite these being key determinants of the feasibility of a product such as biomaterials, glue or polymers for real life implementation. Based on previous year’s lack of tensile test or other more advanced material property tests, we hypothesise that this may be due to limited time and lack of templates for data processing. To accommodate for this lack, we have included a template for analysis of tensile stress-strain data in the appendix, which should reduce the time spent on such endeavours and encourage others to explore the quality of their product.</p><br />
</section><br />
<section id="appendix"><br />
<h2>Appendix</h2><br />
<p>Raw and processed data included for future iGEM teams to use as template for data processing: <a href="https://static.igem.org/mediawiki/2014/8/82/IC14-Mechanical_Properties_Tensile.xls">IC14-Mechanical_Properties_Tensile.xls</a><br />
</p><br />
</section><br />
<br />
<br />
<section id="references"><br />
<h2>References</h2><br />
<ul><br />
<li>Anon, ISO 527-3 official guidelines. Available at: http://211.67.52.20:8088/xitong/BZ\9524171.pdf [Accessed October 12, 2014].</li><br />
<li>Anon, Von Mises Stress. Available at: http://www.continuummechanics.org/cm/vonmisesstress.html [Accessed October 12, 2014].</li><br />
<li>Cheng, K.-C., Catchmark, J.M. & Demirci, A., 2009. Effect of different additives on bacterial cellulose production by Acetobacter xylinum and analysis of material property. Cellulose, 16(6), pp.1033–1045. Available at: http://www.scopus.com/inward/record.url?eid=2-s2.0-72849151190&partnerID=tZOtx3y1 [Accessed September 12, 2014].</li><br />
<li>Con-Serv Water, Operation and Maintenance Manual. Available at: [http://www.con-servwater.com/uploads/CON-SERV_6_GPM_UF_SYSTEM_OPERATING_MANUAL_7-28-11_Rev.pdf] [Accessed October 12, 2014].</li><br />
<li>Jajuee, B. et al., 2006. Measurements and CFD simulations of gas holdup and liquid velocity in novel airlift membrane contactor. AIChE Journal, 52(12), pp.4079–4089. Available at: http://doi.wiley.com/10.1002/aic.11010 [Accessed October 16, 2014].</li><br />
<li>Keshk, S., 2006. Physical properties of bacterial cellulose sheets produced in presence of lignosulfonate. Enzyme and Microbial Technology, 40(1), pp.9–12. Available at: http://www.sciencedirect.com/science/article/pii/S0141022906004078 [Accessed October 13, 2014].</li><br />
<li>Shezad, O. et al., 2010. Physicochemical and mechanical characterization of bacterial cellulose produced with an excellent productivity in static conditions using a simple fed-batch cultivation strategy. Carbohydrate Polymers, 82(1), pp.173–180. Available at: http://www.sciencedirect.com/science/article/pii/S0144861710003334 [Accessed October 12, 2014].</li><br />
<li>Tischer, P.C.S.F. et al., 2010. Nanostructural reorganization of bacterial cellulose by ultrasonic treatment. Biomacromolecules, 11(5), pp.1217–24. Available at: http://dx.doi.org/10.1021/bm901383a [Accessed October 17, 2014].</li><br />
<br />
<br />
<br />
<br />
<br />
</ul><br />
</section><br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>HChughtaihttp://2014.igem.org/Team:Imperial/Mechanical_TestingTeam:Imperial/Mechanical Testing2014-10-18T02:13:48Z<p>HChughtai: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Mechanical Testing</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#introduction">Introduction</a><br />
</li><br />
<li><a data-scroll href="#methods">Methods</a><br />
</li><br />
<br />
<br />
<li><a data-scroll href="#results">Results</a><br />
</li><br />
<li><a data-scroll href="#discussion">Discussion</a><br />
</li><br />
<li><a data-scroll href="#limitations">Limitations</a><br />
</li><br />
<li><a data-scroll href="#manufacturing">Manufacturing Relevance</a><br />
</li><br />
<li><a data-scroll href="#appendix">Appendix</a><br />
</li><br />
<li><a data-scroll href="#references">References</a><br />
</li><br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
</div><br />
</div><br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p>To check the feasibility of using our bacterial cellulose as a customisable ultrafiltration membrane, the mechanical properties were tested. For this to work, we checked the tensile strength of our filter, calculated the shear stress and estimated the processing method that produces membrane with the longest life-time. Our ultimate tensile stress calculated matched with literature values of bacterial cellulose within standard deviation, and the data analysis provided the insight to use non-blended cellulose rather than blended..</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>Key Achievements </h2><br />
<ul><br />
<li>Introduced a new aspect to the manufacturing track in terms of quantitatively characterising the mechanical properties of our product, bacterial cellulose<br />
</li><br />
<li>Quantified the tensile stress-strain properties of our bacterial cellulose.<br />
</li><br />
<li>Established the feasibility of using bacterial cellulose as a customisable ultrafiltration membrane with water pressures of 75 bar within a conservative safety margin.<br />
</li><br />
<li>Discovered that non-blended compared to blended bacterial cellulose was significantly more ductile, and would have longer life time as a water filter, which informed the choice of cellulose for the final product.<br />
</li><br />
<li>Tested and analysed 20 samples of bacterial cellulose test pieces.<br />
</li><br />
<li>Created a size and quality optimised gif for visualisation of the experiment and written protocol for future iGEM teams to do the same.<br />
</li><br />
<br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<div class="pure-g"><br />
<div class="pure-u-1-1"><br />
<section id="introduction"><br />
<h2>Introduction</h2><br />
<br />
<br />
<br />
<img class="content-image image-full" src="https://static.igem.org/mediawiki/2014/6/60/IC14-MechTest-CelluloseTest.jpg"><br />
<br />
<br />
<br />
<div class="right"><br />
<img class="content-image" src="https://static.igem.org/mediawiki/2014/e/e3/IC14-MechTest-CBIS1.jpg" width=150><br />
<br/><br />
<img class="content-image" src="https://static.igem.org/mediawiki/2014/f/f7/IC14-MechTest-CBIS2.jpg" width=100><br />
<br />
</div><br />
<br/><br />
<p><em>“How long would the bacterial cellulose water filter last? What will be the pressure we can apply on to it?”</em> - Dr. Chipps (Principal Research Scientist at Thames Water)</p><br />
<p>The most accessible method of finding an answer to Dr. Chipps’ questions is to asses the quality of our material by pulling a test piece until it breaks, a tensile test. The quality of our bacterial cellulose will determine the water pressure that can be applied to it in when used as a customisable ultrafiltration membrane. Since the water pressure is a major limiting factor of the flow rates produced in such a setting, a key step to establishing the feasibility of our project is to perform a tensile test.</p><br />
<p>Tensile testing of bacterial cellulose is a common way of characterising and comparing its mechanical properties (Khesk 2006, Cheng 2009, Shezad 2010) and provides an indication of the orientation of the fibres in the bacterial cellulose pellicle. Another advantage is that for a polycrystalline material like bacterial cellulose grown in static media, the shear stress, directly related to hydrostatic water pressure, can be interpolated based on Von Mises Criterion.</p><br />
<p>Therefore, we contacted Dr. Angelo Karunaratne of the Royal British Legion Centre of Blast Injury Studies at Imperial College, requesting access to test samples in an Instron 5866 materials testing machine (Instron Inc., Norwood, USA). For this test our aim was to calculate the young’s modulus, ultimate tensile stress, yield stress and strain at failure.</p><br />
<br />
</section><br />
</div><br />
<div class="pure-u-1-1"><br />
<section id="methods"><br />
<h2>Methods</h2><br />
<br />
<br />
<br />
<br />
<br />
<br />
<figure class="content-image image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/6/60/IC14-MechTest-Instron.jpg"><br />
<figcaption>Figure 1: Instron 5866 materials testing machine</figcaption><br />
</figure><br />
<br />
<figure class="content-image image-right image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/9/92/IC14-MechTest-Test2b.jpg"><br />
<figcaption>Figure 2b: Actual test state: tensile testing state of thin bacterial cellulose pellicle<br />
</figcaption><br />
</figure><br />
<br />
<figure class="content-image image-right image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/0/03/IC14-MechTest-Test2a.jpg"><br />
<figcaption>Figure 2a: Dumbbell shape used as the shape for testing</figcaption><br />
<br />
</figure><br />
<br />
<br />
<p>Samples were prepared by oven drying at 60 C for 6 hours between VWR 413 filter paper, without pressure. Subsequently, samples were kept at room temperature (20 C) before testing. Cellulose was cut into 0.1 mm x 11 mm x 32 mm dumbbell shapes as shown in figure 2 a, following the shape recommended by ISO 527-3 guidelines for determination of tensile properties of plastics. Dumbbell shapes have the advantage of avoiding stress concentration at the clamps, and the dimensions chosen had sufficiently similar small width to large width ratio to literature dimensions (0.16mm × 100mm × 150mm) to allow for comparison across studies (Sherif 2006). A digital vernier calliper was used to measure the thickness of each of the samples. 9 samples were used for the main cellulose fabric intended for water filtration, 2 were used for blended cellulose samples due to limited availability.</p><br />
<br />
<figure style="float:left;margin:10px;"><br />
<img src="https://static.igem.org/mediawiki/2014/5/53/IC14-BC_tensile_test.gif" width="200"><br />
<figcaption>Figure 3: Cellulose failing under stress</figcaption><br />
</figure><br />
<p>The test involves clamping test pieces into the instron machine, moving the upper clamp upwards at a specific elongation time, set to 20 mm/min to match that of existing literature (Sherif, 2006) and tracking the tensile force of the BC sample until the sample fails. Stress() was calculated as the tensile force divided by the cross sectional area measured as width x thickness. Young’s modulus (E) was calculated as stress/strain in the linear section of the average graph. Strain () was calculated as L/L0where L is the elongation from the initial length L0. Samples were tested until visually confirming failure as shown in figure 3.</p><br />
<br />
<br />
<p>Two main sample types were tested. The BC pellicles intended for water filtration were immersed in a solution of Wizz Active Oxygen Fabric Stain Remover dissolved in distilled water. After 4 days, the pellicles were removed from the container, cut into squares of 5cm by 5cm, and allowed to dry between VWR 413 filter paper in an oven at 60 ⁰C for 3 hours. Then, the BC layered in filter paper was moved to room temperature, folded in Blue Roll, clamped between heatproof mats with mechanical clamps and left for 24 hours. This type of cellulose will be referred to as non-blended BC.</p><br />
<p>Alternative BC samples were treated in a 0.1 M NaOH solution in 80C for 3 hours, upon which it was dried off with blue roll and immersed in distilled water. After being in the distilled water solution for 12 hours, the BC was dried of with blue roll and blended in a Jamie Oliver food processor for 12 min at speed 2.</p><br />
<figure class="content-image image-half "><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/2/2e/IC14-MechTest-ActiveOxygen.jpg"><br />
<figcaption>Figure 4: Active Oxygen Fabric Stain Remover treated BC for 4 days</figcaption><br />
</figure><br />
<br />
<figure class="content-image image-half "><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/d/d2/IC14-MechTest-Blended.png"><br />
<figcaption>Figure 5: a) 0.1 M NaOH treated BC, blended and spread onto VWR 413 filter paper to dry b) Phillips Jamie Oliver Blender that produced the BC of part a.</figcaption><br />
</figure><br />
<br />
</section><br />
</div><br />
<div class="pure-u-1-1"><br />
<section id="results"><br />
<h2>Results</h2><br />
<figure class="content-image"><br />
<table class="tg image-full"><br />
<tr><br />
<th class="tg-e3zv">Sample processing</th><br />
<th class="tg-e3zv">Ultimate tensile stress (MPa)</th><br />
<th class="tg-e3zv">Yield stress (Mpa)</th><br />
<th class="tg-e3zv">Young's modulus (Mpa)</th><br />
<th class="tg-e3zv">Strain at break (%)</th><br />
</tr><br />
<tr><br />
<td class="tg-e3zv">Non-blended bacterial cellulose</td><br />
<td class="tg-031e">29.9 ± 6.4</td><br />
<td class="tg-031e">25.2 ± 7.2</td><br />
<td class="tg-031e">1.5 ± 0.1</td><br />
<td class="tg-031e">21 ± 3</td><br />
</tr><br />
<tr><br />
<td class="tg-e3zv">Blended bacterial cellulose</td><br />
<td class="tg-031e">208 ± 80</td><br />
<td class="tg-031e">155 ± 11</td><br />
<td class="tg-031e">50.5 ± 1</td><br />
<td class="tg-031e">4.1 ± 0.9</td><br />
</tr><br />
</table><br />
<figcaption>Table 1</figcaption><br />
</figure><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<figure class="content-image image-full "><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/1/15/IC14-MechTest-6.png"><br />
<figcaption>Figure 6: Tensile Stress-Strain Graph of Bacterial Cellulose</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<figure class="content-image image-full "><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/4/4b/IC14-MechTest-7.png"><br />
<figcaption>Figure 7: Average Tensile Stress-Strain Graph of Bacterial Cellulose</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<figure class="content-image image-full "><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/9/9b/IC14-MechTest-8.png"><br />
<figcaption>Figure 8: Tensile Stress-Strain Graph of Blended Bacterial Cellulose</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<figure class="content-image image-full "><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/0/03/IC14-MechTest-9.png"><br />
<figcaption>Figure 9: Tensile Stress Average of Blended Cellulose</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<figure class="content-image image-full "><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/e/eb/IC14-MechTest-9.5.png"><br />
<figcaption>Figure 10: Mechanical Properties of Blended vs. Non-Blended Cellulose</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<figure class="content-image image-full "><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/5/56/IC14-MechTest-10.png"><br />
<figcaption>Figure 11: Average Tensile Stress of Blended and Non-Blended Cellulose</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-1"><br />
<p>The results of the mechanical tests of blended BC and non-blended BC are shown in table 1. The corresponding measurement data are shown in figure 3 and 4. As shown in table 1, the E, and of non-blended BC was 1.52 MPa, 30 MPa and 35%, respectively. 9 samples were tested to account for variability in cellulose samples produced as graphed in figure 5. The tensile stress is equal within standard deviation to that of 34 MPa found by (Chen 2009), indicating literature levels of tensile strength of the material produced.</p><br />
<p>As shown in table 1, the yield stress of blended cellulose is 178 MPa higher than that of non-blended cellulose whilst the strain at break was 4% for blended compared to 21% for non-blended cellulose. This indicates that blended cellulose is more brittle than non-blended, making non-blended cellulose a more promising candidate for water filtration. This is because brittle materials are more prone to fatigue-crack propagation (Ritchie 1998) when exposed to cyclic loading characteristic to the use of ultrafiltration membranes, giving brittle materials a shorter expected life time.</p><br />
</div><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
</section><br />
</div><br />
<section id="discussion"><br />
<h2>Discussion</h2><br />
<p>What is the maximum water pressure that can be applied?</p><br />
<p>For the cellulose tested with an ultimate tensile stress of 30 MPa and a yield stress of 27 MPa, it is possible to estimate the maximum pressure that our bacterial cellulose filter can sustain by calculating the maximum shear stress (τ). Based on the work of (Jajuee 2006) on membrane filtration, it can be assume that shear stress is the most considerable force acting on the customised cellulose membrane. Combining this with the assumption that non-blended bacterial cellulose is ductile due to being polycrystalline (Tischer 2010), as can be seen in the gif of figure 3 and by the large plastic region shown in figure 7, the Von Mises Criterion can be used to calculate the shear stress. This relates shear stress to yield stress by: σ=√3 τ.Hence, the maximum shear stress is 15.5 MPa. Now, a safety factor of 2 would ensure safe usage of the cellulose membrane, thus a shear stress of half the theoretical maximum shear stress i.e. 7.5 MPa is the advisable working shear stress. This correlates to a hydrostatic pressure of 75 bar, which more than suffices for the pressure ranges of 0.3-3 bar used in ultrafiltration membranes (Reclamation Fact Sheet)</p><br />
</section><br />
<br />
<section id="limitations"><br />
<h2>Limitations</h2><br />
<p>In addition to tensile testing, it would be ideal to perform a fatigue stress test as a material like a water filter loaded over many cycles is more likely to fail due to fatigue than tensile loading, which expectedly occur at lower rates than the ultimate tensile stress predicted. To accommodate for this limitation, the cellulose we have produced is being tested by Professor Alexander Bismarck’s group at University of Vienna, which will also provide measurements of its permeability i.e. flow rates at different water pressures. These results are on their way as we speak.</p><br />
</section><br />
<section id="manufacturing"><br />
<h2>Relevance to Manufacturing track</h2><br />
<p>To the best of our knowledge, characterising the mechanical properties of the various products produced in the iGEM Manufacturing Track has been rather overlooked by previous teams, despite these being key determinants of the feasibility of a product such as biomaterials, glue or polymers for real life implementation. Based on previous year’s lack of tensile test or other more advanced material property tests, we hypothesise that this may be due to limited time and lack of templates for data processing. To accommodate for this lack, we have included a template for analysis of tensile stress-strain data in the appendix, which should reduce the time spent on such endeavours and encourage others to explore the quality of their product.</p><br />
</section><br />
<section id="appendix"><br />
<h2>Appendix</h2><br />
<p>Raw and processed data included for future iGEM teams to use as template for data processing: <a href="https://static.igem.org/mediawiki/2014/8/82/IC14-Mechanical_Properties_Tensile.xls">IC14-Mechanical_Properties_Tensile.xls</a><br />
</p><br />
</section><br />
<br />
<br />
<section id="references"><br />
<h2>References</h2><br />
<ul><br />
<li>Anon, ISO 527-3 official guidelines. Available at: http://211.67.52.20:8088/xitong/BZ\9524171.pdf [Accessed October 12, 2014].</li><br />
<li>Anon, Von Mises Stress. Available at: http://www.continuummechanics.org/cm/vonmisesstress.html [Accessed October 12, 2014].</li><br />
<li>Cheng, K.-C., Catchmark, J.M. & Demirci, A., 2009. Effect of different additives on bacterial cellulose production by Acetobacter xylinum and analysis of material property. Cellulose, 16(6), pp.1033–1045. Available at: http://www.scopus.com/inward/record.url?eid=2-s2.0-72849151190&partnerID=tZOtx3y1 [Accessed September 12, 2014].</li><br />
<li>Con-Serv Water, Operation and Maintenance Manual. Available at: [http://www.con-servwater.com/uploads/CON-SERV_6_GPM_UF_SYSTEM_OPERATING_MANUAL_7-28-11_Rev.pdf] [Accessed October 12, 2014].</li><br />
<li>Jajuee, B. et al., 2006. Measurements and CFD simulations of gas holdup and liquid velocity in novel airlift membrane contactor. AIChE Journal, 52(12), pp.4079–4089. Available at: http://doi.wiley.com/10.1002/aic.11010 [Accessed October 16, 2014].</li><br />
<li>Keshk, S., 2006. Physical properties of bacterial cellulose sheets produced in presence of lignosulfonate. Enzyme and Microbial Technology, 40(1), pp.9–12. Available at: http://www.sciencedirect.com/science/article/pii/S0141022906004078 [Accessed October 13, 2014].</li><br />
<li>Shezad, O. et al., 2010. Physicochemical and mechanical characterization of bacterial cellulose produced with an excellent productivity in static conditions using a simple fed-batch cultivation strategy. Carbohydrate Polymers, 82(1), pp.173–180. Available at: http://www.sciencedirect.com/science/article/pii/S0144861710003334 [Accessed October 12, 2014].</li><br />
<li>Tischer, P.C.S.F. et al., 2010. Nanostructural reorganization of bacterial cellulose by ultrasonic treatment. Biomacromolecules, 11(5), pp.1217–24. Available at: http://dx.doi.org/10.1021/bm901383a [Accessed October 17, 2014].</li><br />
<br />
<br />
<br />
<br />
<br />
</ul><br />
</section><br />
</div><br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>HChughtai