http://2014.igem.org/wiki/index.php?title=Special:Contributions&feed=atom&limit=100&target=Chesne+j2014.igem.org - User contributions [en]2024-03-28T08:43:05ZFrom 2014.igem.orgMediaWiki 1.16.5http://2014.igem.org/Team:Evry/Biology/GenomeAssemblyTeam:Evry/Biology/GenomeAssembly2014-10-18T03:57:23Z<p>Chesne j: </p>
<hr />
<div>{{:Team:Evry/Template:HomeIncludes}}<br />
{{:Team:Evry/Template:Menu}}<br />
{{:Team:Evry/Template:genomeAssemblyTop}}<br />
<br />
<br />
<html><br />
<br />
<h1> De novo Genome assembly</h1><br />
<br><br><br />
<div align="justify"><br />
<p><br />
In order to perform the genome assembly of our bacterium, we choose to used the velvet software. It is an algorithm base on short read sequencing alignments. This reconstruction algorithm is based on the Brujin graphs which is in graph theory a directed graph which represents overlaps between sequences of symbols, in or case our short contis DNA. We choose 4 kmer size. For the first one at 31 we obtained 1493 contigs, for a kmer size of 65, 413 contigs are obtain. For the two last kmer tested, 97 and 113 we obtained 275 and 245 contigs.The prokka software is an automated tools for genome annotation. The run take less than ten minutes, as they was proposed on their articles.In order to control the quality of our DNA seq we choose to made first a Proteome comparisons with<i> Pseudovibrio FOBEG1</i> which is our reference strain. For that purpose we decided to look at our first genome version contains 275 contigs which was provide by the Velvet de novo assembly tools. For the 5456 proteins of<i> Pseudovibrio FO-BEG1</i>, 5132 proteins (which are our reference strain) are match with a prokka anotation CDS. 5002 with a unique alignment 4936, 4687 with an alignement > 90%, 4415 > 95% and 2525 > 99%. For that purpose, we are sure that we sequenced a strain related to the <i>Pseudovibrio</i> genus.<br />
<br />
After this proteome comparison, we tried to improved our genome assembly by improved the kmer size and we saw that the contigs numbers was reduced to 245. In order to analyse the annotation and the quality of our genome annotation, we looked at four main specific annotation types such as antibiotic resitance, restriction enzyme, metals (such as cadmium, copper and mercury), and other toxic compounds (such as phenol, nitrate, nitrite).<br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<br />
<br />
<h4>Antibiotic resistance </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
Concerning the antibiotics, we look at specific antibiotics such as kanamycin, erythromycin, tetracycline, ampicillin, and chloramphenicol and other type of resistance gene. For the kanamycin and erythromycin, we found not relevant annotation. However, for the other ones, tetracycline, ampicillin, and chloramphenicol, we found specific annotations.<br />
<br />
Regarding the tetracycline, we found that it possessed one Tetracycline repressor protein class H , two Tetracycline resistance protein, class C and nine Bacterial regulatory proteins, tetR family annotated genes. This result are coincident with our experiment where we found that <i>Pseudovibrio </i>is resistant to tetracycline.<br />
<br />
About the ampicillin, one Metallo-beta-lactamase superfamily protein, Beta-lactamase, Beta-lactamase type II precursor, two Beta-lactamase precursor, Beta-lactamase hydrolase-like protein HTH-type transcriptional activator AmpR and five Putative beta-lactamase HcpC precursor were predicted by the Prokka software. Also this result is coincident with our experiment.<br />
<br />
For the Chloramphenicol antibioctics, we predicted that the chloramphenicol phosphotransferase-like protein, Chloramphenicol 3-O phosphotransferase and Chloramphenicol acetyltransferase are present in our strain. The last one is used as a reporter gene in molecular biology. But in contrary to other antibiotics, the test does not reveal, that our strain is resistant to the Chloramphenicol.<br />
<br />
Finally we look at other antibiotic resistance and we see that other antibiotics such as the Bleomycin are predicted. Bleomycin is used as a chemotherapy agents for the Hodgkin's lymphoma. Also it possessed the Multidrug resistance protein, MdtA, MdtA precursor, MdtB, MdtK, MdtN, MdtH, MdtG, which are known to play an important role in antibiotic resistance.<br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<h4>Restriction enzyme</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
During the transformation tests of our strain, we supposed that <i>Pseudovibrio Denitrificans</i>, was able to degrade DNA. Indeed all our electroporation attempts failed. They could not keep the plasmid inside them. One relevant research led us to the discovery of a Type I Restriction enzyme EcoKI. This site specific DNA methylase is not very common but can be found in a wide range of Gammaproteobacteria and so potentially into PseudoVibrio Denitrificans. We blasted the sequence of EcoRI gene with our bacteria genome, and we found that <i>Pseudovibro</i> have the gene.<br />
EcoKI recognises the sequence 5’ AAC(N)6GTGC-3’ and acts depending on the methylation state of the DNA substrate. It can be a methyltransferase or an endonuclease. Psb1c3, first plasmid that we tried to transform ( E.Coli Ori) does not have the target sequence of EcoRI. Otherwise, in one plasmid sent by Dr Thomas Drepper from Heinrich-Heine-Universität Düsseldorf, Institute of Molecular Enzyme Technology, Group of Bacterial Photobiotechnology, which was from a bacterium very closed with <i>Pseudovibro</i> and which we tried as well to transform, there is the target sequence of the enzyme. <br />
At this moment, <i>Pseudovibro</i> was not sequenced, so we could not find the localisation of the EcoKI gene. In order to integrate our constructions just in time, we opted for a transposon strategy.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/98/DNA1EvRY.jpg" style="width:50%;height:50%"/><p><br />
<i>Figure 1: Sequence of the pRhokHi vector and the hightlight of the EcoKI target sequence </i></p><br />
</div><br />
<br />
<br><br><br />
</div><br />
<h4> Nitrate/nitrite</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
Concerninrg the nitrate and nitrite a potential gene transporter NarK Nitrate/and Nitrite was predicte. Also we discovered the protein NapE was predict in the genome of Pseudovibrio Denitrificans. This enzyme is known to reduce nitrate to nitrite. Other some other genes such as Respiratory nitrate reductase 1 alpha and game chaine and other which are involve in the nitrification process. It possessed also Required for formate-dependent nitrite reduction. Not required for the biosynthesis of any of the c-type cytochromes nor for the secretion of the periplasmic cytochromes. They are involve in the reduction of nitrite to amoniac<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br> <br />
</div><br />
<h4>Cadmium</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
Concerning one of our compound target the cadmium, we were really surprised about it’s resistance to hight concentration. We found that the annotation reaveal two potentials genes for cadmium resistance. The putative cadmium-transporting ATPase involved in cadmium/zinc transport and also the Cobalt-zinc-cadmium resistance protein CzcB. CzcB has been asociated with a Gene ontology terms for Biological Process metal ion tranport and Molecular function metal ion transmembrane transporter activity. Other experiment need to be performed in order to be sure that the bacterium is resistant. A simple Northern Blot of the CzcB, mRNA will give a simple way to analyse the data and provide information of this enzyme<br />
<br />
<br />
</p><br />
</div><br />
<br><br> <br />
<h4>Copper </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
Copper is an essential heavy metal; chemical element. It plays a role in vital oxidation and reduction processes. Multicopper oxidase are enzymes able to oxidize substrate and are involved in copper homeostasis. They play a part in iron transfer and enhanced oxidase activity. <br />
The role of copper homeostasis protein is still unknown, however some studies have established a link in intracellular trafficking of CuI. Copper-transporting P-type ATPase plays an essential role in copper balance as intestinal transport of copper in mammalian. Copper-sensing transcriptional repressor CsoR is involved in the cellular response in order to increase copper concentration inside bacterium. Copper resistance protein A precursor is a soluble protein which catalyzes oxidation of Cu and interact with membrane. Periplasmic copper-binding protein (NosD) is a periplasmic protein which can insert copper into reductase apoenzyme. Copper-exporting P-type ATPase A forms a homodimer at high copper concentration and export it in co-operation with copZ. <br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Mercuric</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
Concerning the Mercure, a gene named Mercuric reductase was found. It is known to catalyzes the two-electron reduction of mercuric ions to elemental mercury using NADPH as an electron donor . That shows that potentially our bacteria can in high mercury concentration be able to survive due to the creaction of NADPH which is an important metabolite. <br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Phenol </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
One of our project aim was to degrade phenol thank to <i>Pseudovivrio denitrificans</i>. However, many organisms are able to degrade phenol by their own, anaerobia or aerobe. (Khazi Mahammedilyas Basha, 2010) Before to transform our bacterium in this way we were looking for a biodegradation pathway.<br />
As <i> Pseudovibrio denitricans</i> is an anaerobic bacterium, we have focused on the anaerobic degradation pathway for phenol.<br />
<br />
<br />
</p><br><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/9e/Phenol4.png" style="width:20%;height:20%"/><br />
<p>Figure2 : <i>Anaerobic pathway degradation for phenol</i></p></div><p><br />
In order to determine if our bacterium degrade phenol we watched if it owns different enzymes in the phenol pathway degradation.<br />
For the first enzyme; 4-hydroxybenzoate decarboxylase we found 4 coding sequence with similarity; they have an enzymatic promiscuity. The second enzyme; p-hydroxy benzoate 3-monooxygenase from the phenol degradation pathway match perfectly with our bacterium.<br />
For Protocatechuate 3, 4 dioxygenase , we have found two coding sequences corresponding.<br />
The cycloisomerase coding sequence match perfectly in our bacterium. As the previous enzyme, enol - lactonase have matching too<br />
For the transferase enzyme, we have found two similar sequence leading to promiscuity enzymes. For the two last enzymes; they gave two different final product. One of them; thiolase have 4 similar sequences leading to promiscuity enzymes, though the second one; acyltransferase have 17 similar sequences leading to promiscuity enzymes.<br />
<br />
<br />
So, this analyze lead to think that<i> Pseudovibrio denetifricans</i> own the all anaerobic phenol degradation pathway. Hence, we have found all coding sequences correlate to enzyme from phenol degradation. And the bacterium may rather the acetyl-coA pathway than succenyle-coA because of the promiscuity enzyme quantity.<br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<h4>REFERENCE</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
Article, R. (2010). Recent advances in the Biodegradation of Phenol: A review, 1(2), 219–234.<br />
<br><br><br />
Harwood, C. S., & Parales, R. E. (1996). THE β -KETOADIPATE PATHWAY AND THE BIOLOGY OF SELF-IDENTITY.<br />
<br><br><br />
Powell, L. M., Dryden, D. T. F., & Murray, N. E. (1998). Sequence-specific DNA Binding by Eco KI , a Type IA DNA Restriction Enzyme.<br />
<br><br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</html><br />
<br />
<br />
<br />
<br />
<br />
<br />
{{:Team:Evry/Template:HomeFooter}}</div>Chesne jhttp://2014.igem.org/Team:Evry/Biology/GenomeAssemblyTeam:Evry/Biology/GenomeAssembly2014-10-18T03:56:33Z<p>Chesne j: </p>
<hr />
<div>{{:Team:Evry/Template:HomeIncludes}}<br />
{{:Team:Evry/Template:Menu}}<br />
{{:Team:Evry/Template:genomeAssemblyTop}}<br />
<br />
<br />
<html><br />
<br />
<h1> De novo Genome assembly</h1><br />
<br><br><br />
<div align="justify"><br />
<p><br />
In order to perform the genome assembly of our bacterium, we choose to used the velvet software. It is an algorithm base on short read sequencing alignments. This reconstruction algorithm is based on the Brujin graphs which is in graph theory a directed graph which represents overlaps between sequences of symbols, in or case our short contis DNA. We choose 4 kmer size. For the first one at 31 we obtained 1493 contigs, for a kmer size of 65, 413 contigs are obtain. For the two last kmer tested, 97 and 113 we obtained 275 and 245 contigs.The prokka software is an automated tools for genome annotation. The run take less than ten minutes, as they was proposed on their articles.In order to control the quality of our DNA seq we choose to made first a Proteome comparisons with<i> Pseudovibrio FOBEG1</i> which is our reference strain. For that purpose we decided to look at our first genome version contains 275 contigs which was provide by the Velvet de novo assembly tools. For the 5456 proteins of<i> Pseudovibrio FO-BEG1</i>, 5132 proteins (which are our reference strain) are match with a prokka anotation CDS. 5002 with a unique alignment 4936, 4687 with an alignement > 90%, 4415 > 95% and 2525 > 99%. For that purpose, we are sure that we sequenced a strain related to the <i>Pseudovibrio</i> genus.<br />
<br />
After this proteome comparison, we tried to improved our genome assembly by improved the kmer size and we saw that the contigs numbers was reduced to 245. In order to analyse the annotation and the quality of our genome annotation, we looked at four main specific annotation types such as antibiotic resitance, restriction enzyme, metals (such as cadmium, copper and mercury), and other toxic compounds (such as phenol, nitrate, nitrite).<br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<br />
<br />
<h4>Antibiotic resistance </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
Concerning the antibiotics, we look at specific antibiotics such as kanamycin, erythromycin, tetracycline, ampicillin, and chloramphenicol and other type of resistance gene. For the kanamycin and erythromycin, we found not relevant annotation. However, for the other ones, tetracycline, ampicillin, and chloramphenicol, we found specific annotations.<br />
<br />
Regarding the tetracycline, we found that it possessed one Tetracycline repressor protein class H , two Tetracycline resistance protein, class C and nine Bacterial regulatory proteins, tetR family annotated genes. This result are coincident with our experiment where we found that <i>Pseudovibrio </i>is resistant to tetracycline.<br />
<br />
About the ampicillin, one Metallo-beta-lactamase superfamily protein, Beta-lactamase, Beta-lactamase type II precursor, two Beta-lactamase precursor, Beta-lactamase hydrolase-like protein HTH-type transcriptional activator AmpR and five Putative beta-lactamase HcpC precursor were predicted by the Prokka software. Also this result is coincident with our experiment.<br />
<br />
For the Chloramphenicol antibioctics, we predicted that the chloramphenicol phosphotransferase-like protein, Chloramphenicol 3-O phosphotransferase and Chloramphenicol acetyltransferase are present in our strain. The last one is used as a reporter gene in molecular biology. But in contrary to other antibiotics, the test does not reveal, that our strain is resistant to the Chloramphenicol.<br />
<br />
Finally we look at other antibiotic resistance and we see that other antibiotics such as the Bleomycin are predicted. Bleomycin is used as a chemotherapy agents for the Hodgkin's lymphoma. Also it possessed the Multidrug resistance protein, MdtA, MdtA precursor, MdtB, MdtK, MdtN, MdtH, MdtG, which are known to play an important role in antibiotic resistance.<br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<h4>Restriction enzyme</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
During the transformation tests of our strain, we supposed that <i>Pseudovibrio Denitrificans</i>, was able to degrade DNA. Indeed all our electroporation attempts failed. They could not keep the plasmid inside them. One relevant research led us to the discovery of a Type I Restriction enzyme EcoKI. This site specific DNA methylase is not very common but can be found in a wide range of Gammaproteobacteria and so potentially into PseudoVibrio Denitrificans. We blasted the sequence of EcoRI gene with our bacteria genome, and we found that <i>Pseudovibro</i> have the gene.<br />
EcoKI recognises the sequence 5’ AAC(N)6GTGC-3’ and acts depending on the methylation state of the DNA substrate. It can be a methyltransferase or an endonuclease. Psb1c3, first plasmid that we tried to transform ( E.Coli Ori) does not have the target sequence of EcoRI. Otherwise, in one plasmid sent by Dr Thomas Drepper from Heinrich-Heine-Universität Düsseldorf, Institute of Molecular Enzyme Technology, Group of Bacterial Photobiotechnology, which was from a bacterium very closed with <i>Pseudovibro</i> and which we tried as well to transform, there is the target sequence of the enzyme. <br />
At this moment, <i>Pseudovibro</i> was not sequenced, so we could not find the localisation of the EcoKI gene. In order to integrate our constructions just in time, we opted for a transposon strategy.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/98/DNA1EvRY.jpg" style="width:50%;height:50%"/><p><br />
<i>Figure 1: Sequence of the pRhokHi vector and the hightlight of the EcoKI target sequence </i></p><br />
</div><br />
<br />
<br><br><br />
</div><br />
<h4> Nitrate/nitrite</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
Concerninrg the nitrate and nitrite a potential gene transporter NarK Nitrate/and Nitrite was predicte. Also we discovered the protein NapE was predict in the genome of Pseudovibrio Denitrificans. This enzyme is known to reduce nitrate to nitrite. Other some other genes such as Respiratory nitrate reductase 1 alpha and game chaine and other which are involve in the nitrification process. It possessed also Required for formate-dependent nitrite reduction. Not required for the biosynthesis of any of the c-type cytochromes nor for the secretion of the periplasmic cytochromes. They are involve in the reduction of nitrite to amoniac<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br> <br />
</div><br />
<h4>Cadmium</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
Concerning one of our compound target the cadmium, we were really surprised about it’s resistance to hight concentration. We found that the annotation reaveal two potentials genes for cadmium resistance. The putative cadmium-transporting ATPase involved in cadmium/zinc transport and also the Cobalt-zinc-cadmium resistance protein CzcB. CzcB has been asociated with a Gene ontology terms for Biological Process metal ion tranport and Molecular function metal ion transmembrane transporter activity. Other experiment need to be performed in order to be sure that the bacterium is resistant. A simple Northern Blot of the CzcB, mRNA will give a simple way to analyse the data and provide information of this enzyme<br />
<br />
<br />
</p><br />
</div><br />
<br><br> <br />
<h4>Copper </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
Copper is an essential heavy metal; chemical element. It plays a role in vital oxidation and reduction processes. Multicopper oxidase are enzymes able to oxidize substrate and are involved in copper homeostasis. They play a part in iron transfer and enhanced oxidase activity. <br />
The role of copper homeostasis protein is still unknown, however some studies have established a link in intracellular trafficking of CuI. Copper-transporting P-type ATPase plays an essential role in copper balance as intestinal transport of copper in mammalian. Copper-sensing transcriptional repressor CsoR is involved in the cellular response in order to increase copper concentration inside bacterium. Copper resistance protein A precursor is a soluble protein which catalyzes oxidation of Cu and interact with membrane. Periplasmic copper-binding protein (NosD) is a periplasmic protein which can insert copper into reductase apoenzyme. Copper-exporting P-type ATPase A forms a homodimer at high copper concentration and export it in co-operation with copZ. <br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Mercuric</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
Concerning the Mercure, a gene named Mercuric reductase was found. It is known to catalyzes the two-electron reduction of mercuric ions to elemental mercury using NADPH as an electron donor . That shows that potentially our bacteria can in high mercury concentration be able to survive due to the creaction of NADPH which is an important metabolite. <br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Phenol </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
One of our project aim was to degrade phenol thank to <i>Pseudovivrio denitrificans</i>. However, many organisms are able to degrade phenol by their own, anaerobia or aerobe. (Khazi Mahammedilyas Basha, 2010) Before to transform our bacterium in this way we were looking for a biodegradation pathway.<br />
As <i> Pseudovibrio denitricans</i> is an anaerobic bacterium, we have focused on the anaerobic degradation pathway for phenol.<br />
<br />
<br />
</p><br><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/9e/Phenol4.png" style="width:20%;height:20%"/><br />
<p>Figure2 : <i>Anaerobic pathway degradation for phenol</i></p></div><p><br />
In order to determine if our bacterium degrade phenol we watched if it owns different enzymes in the phenol pathway degradation.<br />
For the first enzyme; 4-hydroxybenzoate decarboxylase we found 4 coding sequence with similarity; they have an enzymatic promiscuity. The second enzyme; p-hydroxy benzoate 3-monooxygenase from the phenol degradation pathway match perfectly with our bacterium.<br />
For Protocatechuate 3, 4 dioxygenase , we have found two coding sequences corresponding.<br />
The cycloisomerase coding sequence match perfectly in our bacterium. As the previous enzyme, enol - lactonase have matching too<br />
For the transferase enzyme, we have found two similar sequence leading to promiscuity enzymes. For the two last enzymes; they gave two different final product. One of them; thiolase have 4 similar sequences leading to promiscuity enzymes, though the second one; acyltransferase have 17 similar sequences leading to promiscuity enzymes.<br />
<br />
<br />
So, this analyze lead to think that<i> Pseudovibrio denetifricans</i> own the all anaerobic phenol degradation pathway. Hence, we have found all coding sequences correlate to enzyme from phenol degradation. And the bacterium may rather the acetyl-coA pathway than succenyle-coA because of the promiscuity enzyme quantity.<br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<h4>REFERENCE</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
Article, R. (2010). Recent advances in the Biodegradation of Phenol: A review, 1(2), 219–234.<br />
<br><br />
Harwood, C. S., & Parales, R. E. (1996). THE β -KETOADIPATE PATHWAY AND THE BIOLOGY OF SELF-IDENTITY.<br />
<br><br />
Powell, L. M., Dryden, D. T. F., & Murray, N. E. (1998). Sequence-specific DNA Binding by Eco KI , a Type IA DNA Restriction Enzyme.<br />
<br><br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</html><br />
<br />
<br />
<br />
<br />
<br />
<br />
{{:Team:Evry/Template:HomeFooter}}</div>Chesne jhttp://2014.igem.org/Team:Evry/Policy_and_Practices/PhilosophyTeam:Evry/Policy and Practices/Philosophy2014-10-18T03:46:05Z<p>Chesne j: </p>
<hr />
<div>{{:Team:Evry/Template:HomeIncludes}}<br />
{{:Team:Evry/Template:Menu}}<br />
{{:Team:Evry/Template:PhilosophyTop}}<br />
<br />
<font color="blue"> <br />
<h2>Design in Synthetic Biology: <br />
rationality versus kludge</h2></font><br />
<br />
<br><br />
<br><br />
<h4><font color="blue"> Introduction </font></h4><br />
<div align="justify"><br />
<br />
<br> The following philosophical reflexion originates from our observation that there is an important contrast between what synthetic biologists ambition to do — a rational, rigorous design with controlled and predicted results — and how they actually realize their biological systems — by trial and error, and tinkering. This method is not specific to synthetic biology, but is more visible and surprising in this field because many synthetic biologists precisely claim that synthetic biology is the engineering of biology.<br />
<br />
Though every part of the Registry is supposed to be well characterized and modular, and though the transformation protocols look rigorous and rational, we often didn't obtain the expected result when we assembled the parts into our biological system. Of course, the reason could have been that we made mistakes in our experimentations; but though we acknowledge our fallibility, we believe that in fact this problem is shared by all synthetic biologists : biological systems often don't behave according to our expectations and models.<br />
<br />
In order to have better results, we often used a method that was not the most rational nor elegant one, but which allowed us to solve or bypass the unpredictability of biological behaviors. And as we discovered by reading the literature, this method is thought to be very common amongst synthetic biologists by some authors, who called it "kludge".<br />
<br />
Even though it wasn't directly linked to our Sponge Patrol project, we decided to have this reflexion on the contrast between the ambitions and the actual practice of synthetic biology, because we believe that it is very important for those who want to be part of this new scientific field to step back from the lab and the computers for a moment, and to take a critical look at this field. <br />
<br />
<br />
<div align="center">https://static.igem.org/mediawiki/2014/c/c2/Kludge3.png</div><br />
<br />
<br />
<br />
Though scientists have many different definitions for what is synthetic biology, a recurrent element of these definitions is the analogy with engineering. This comparison is supported by the idea that synthetic biology allows to build standardized parts of living systems, whose functions and properties are know ; and that those parts can be assembled together in any system thanks to a rational and modular protocol. Synthetic biologists should also be able to make a model of the constructed organism and to predict its behavior. Eventually, building new living systems should become as easy for synthetic biologists as assembling non-biological parts in a machine is easy to engineers.<br />
<br />
<font color="blue"><br />
<div align="center"><br><blockquote><i>“Synthetic biology is the engineering of biology”</i><br />
<br><br><div align="right">Képès, 2010</div></blockquote><br />
</div></font><br />
<br />
However, living organisms are exceedingly complex, and at first sight it looks impossible to fully understand them ; and if we don't, how could we possibly have enough control over them to force them to behave like mechanical, predictable machines? This question is important, because it is precisely what we are trying to do in iGEM: to design and build a "Genetically Engineered Machine". We are, like most synthetic biologists, assuming (or at least hoping) that living systems can be designed to act in a calculated and useful way, like the machines of engineers do.<br />
However, in truth it is obviously not so. Everyday during our iGEM experience, we discovered how unpredictable living systems can be - and even though we sometimes managed to have the result we expected, the protocols to achieve such a result were hardly as rational as engineers protocols. In biology, we never fully understand the living systems we are working on, and as a consequence, the design process of our genetically engineered machine is more often a trial-and-error process than a fail-proof one.<br />
<br />
This observation has led us to wonder about the importance of kludging and tinkering in synthetic biology. The word "kludge" stands for "klumsy, lame, ugly, dumb but good enough", and seems to describe quite accurately what we are actually doing in synthetic biology, when we use inelegant but successful solutions to solve a problem when the rational design doesn't bear the expected results. In fact, we were led to notice that this not-always rational, but very efficient way of doing research is common in many scientific fields; but we thought that it was even more significant in synthetic biology, because the researchers of this field are precisely claiming that their design is rational and systematic. The contrast between what synthetic biology want to do and what they are actually doing is, as a result, even more apparent.<br />
<br />
<font color="blue"><blockquote><div align="center"><i><b>Kludge :</b> "<b>k</b>lumsy, <b>l</b>ame, <b>u</b>gly, <b>d</b>umb, but <b>g</b>ood <b>e</b>nough"<br />
<br>Inelegant but successful solution to a problem.</i></div></blockquote></font><br />
<br />
Thus, as we are synthetic biologists ourselves and are confronted everyday to the actual practice of the field in the lab, we thought that it was very important to take a step back and have an objective and reflexive look at design in synthetic biology. The questions we want to address in the following reflexion are the following:<br />
<br>- How can synthetic biologists pretend to achieve rational and predictable design of living systems?<br />
<br>- Is design in synthetic biology rational, of is it the result of kludging?<br />
<br>- Which method should be favored?<br />
<br />
<br><br />
<br><div align="center"><font color="blue"><h4><br />
How can synthetic biologists pretend to achieve rational and predictable design of living systems?</h4></font></div><br />
<br />
<br>In 2006, a European Commission that gathered many experts in synthetic biology offered the following definition of the new field:<br />
<br />
<font color="blue"><blockquote><div align="center"><i>“Synthetic biology is the engineering of biology: the synthesis of complex, biologically based (or inspired) systems which display functions that do not exist in nature. This engineering perspective may be applied at all levels of the hierarchy of biological structures – from individual molecules to whole cells, tissues and organisms. In essence, synthetic biology will enable the design of ‘biological systems’ in a rational and systematic way.”</i></div><br />
<br><div align="right">High-level Expert Group European Commission, 2006</div></blockquote></font><br />
<br />
We can notice here that synthetic biologists are confident that such designs can be rational and systematic, which means that like the machines or the computer programs of the engineers, the designed synthetic systems must be composed of parts that are fully understood and characterized. Thus the researchers should be able to assemble those parts and obtain the expected result.<br />
<br />
Let's take a quick look at the history of synthetic biology to better understand how such an ambition could arise in a field working on living systems, which are intrinsically complex and unpredictable.<br />
With the development of systemic biology in the last decades, it has been observed that there is an organized hierarchy in cellular networks, between functional modules. And from there, the idea appeared that some mechanisms in living organisms could be reduced to simple mechanisms such as those built by engineers in machines ; which meant that with the proper tools, we could modify and design cells in a rational way to obtain a predefined result.<br />
Then in 2004, the first international conference on synthetic biology, SB 1.0, organized by the MIT, brought together researchers specialized in fields as varied as biology, chemistry, physics, engineering and informatics. It is probably during this interdisciplinary meeting that the ambition to use the engineers' rational bottom-up approach in molecular biology and genetics took shape. <br />
<br />
In order to achieve a rational design of living systems, the priority was first given to the characterization of their functional parts, which is the main goal of the iGEM competition. These researchers had the intuition that it would then become possible to assemble these parts in different ways, that don't necessarily exist in nature, using rational and systematic protocols ; and to construct biological devices that would act exactly as they were intended to.<br />
<br />
<font color="blue"><blockquote><div align="center"><i>"As envisioned by SynBERC, synthetic biology is perhaps best defined by some of its hallmark characteristics: predictable, off-the-shelf parts and devices with standard connections, robust biological chassis (such as yeast and E. coli) that readily accept those parts and devices, standards for assembling components into increasingly sophisticated and functional systems and open-source availability and development of parts, devices, and chassis.”</i></div><br />
<br><div align="right">SynBERC</div></blockquote></font><br />
<br />
Nowadays, we are able to build or synthesize several components of a simple cell, like the lipid bilayer or several enzymes. But the the element we use the most in synthetic biology, and in particular in iGEM, is the DNA (or the RNA). The reason for that is evident: most of the properties of living beings are encoded in their genome, so it is by modifying the genomes that we can effectively build organisms with new functions. <br />
But the ambition of synthetic biology is not just to synthesize existing genomes, nor even to just modify them ; its ambition is to fully characterize and standardize some genome sequences that code for a specific function. That is why at iGEM, we try to design plasmids called Biobricks, that contain a part which function is known, as well as specific sequences that allow the part to be cut and moved from the plasmid with simple protocols.<br />
<br />
<div align="center">https://static.igem.org/mediawiki/2014/f/f1/Biobrick.jpg</div><br />
<br />
The genes we design in synthetic biology are often simplified compared to the average complexity of genes in living systems. Only four main elements are taken into account, because most of the time they are enough to express a gene in an organism: a promotor, a ribosome-binding sequence, a coding sequence and a terminator. And this choice also makes the designed constructions modular, which is a very important property in synthetic biology. A modular promotor for example is a promotor that can be moved from one gene to another, and keep the same properties in both constructions. Each gene can in fact be cut into small modular pieces ; or can be build out of small pieces of DNA - usually in plasmids, that are also modular and can replicate independently of the host genome, whatever the host species.<br />
<br />
The sequences of all the Biobricks are stored in the Registry of Standard biological parts, and everyone can have access to them. This Registry is meant to be a catalogue of parts of the living machines: people can pick the parts they need, buy them, and then assemble them in a simple and rational way to build the devices of their choice - just like engineers can buy electronic components from catalogues and then assemble them to build machines.<br />
<br />
<br />
<br />
The other main reason that is supposed to make design in synthetic biology rational and predictable, is the use of the engineers' methodology for the design and construction of biological devices: conception and modeling, construction, implementation and validation. In the first step, synthetic biologists use mathematics and informatics tools to make a model of the system and simulate its behavior in silico. The parts of the system are then build or synthesized, before being implemented into a machine or a living organism. The researchers then test whether the constructed biological system behave as predicted — and if it doesn't, they change the model and try again.<br />
By using this method, synthetic biologists hope to bring more rigor to the field.<br />
<br />
But not all synthetic biologists admit that the field is – or should be – as rational and predictable as it ambitions to be. The behavior of biological systems are so complex, so variable, that it rather seems impossible ; and during our iGEM experience, we found many times that even with standardized parts and rigorous protocols, the biological systems often don't behave as expected. To overcome this, we often had to change our protocols in ways that we couldn't really explain, except by saying "it works better". And we do not think that this is specific to our team, nor to the iGEM competition. We believe that the whole field of synthetic biology as it is now truly cannot be compared to engineering in terms of rational and predictable design.<br />
<br />
<font color="red"> Transition!!!</font><br />
<br />
<br />
<br><div align="center"><font color="blue"><h4>Is design in synthetic biology rational, <br> or is it the result of kludging?</h4></font></div><br />
<br />
In truth, synthetic biology is rarely as rational as it claims to be. The attempts to control biological systems continuously clash with the unpredictable behavior of living organisms. In the iGEM competition for example, we very often discover that a part from the Registry doesn't have the expected function when added to our biological device: its expression change depending on the chassis in which it is introduced, on its interaction with other components present in the cell, and on the media in which the cell grows. The problem with the so-called modular parts of the Registry is that it is always characterized in particular conditions; but its behavior can never be exactly the same in different conditions. In biological systems, the slightest modification of the environment can result in considerable changes in genetic expression. This is why the uniformity and exact reproducibility of a function coded by a genetic part in several conditions are still out of reach - and may be forever impossible - even if the part was correctly characterized in particular conditions.<br />
<br />
<font color="blue"><blockquote><div align="center"><i>"The behavior of [small] modules is affected in a large extent by the rest of the network in which they are embedded"</i></div><br />
<div align="right">Isalan et al., 2008</div></blockquote></font><br />
<br />
When we work with the parts of the Registry, we must also face the fact that many parts have not been well characterized. Out of the 5000 parts that we can buy from the Registry, only about 2000 have been verified by researchers others than those who have built them. Since an important number of the parts of the Registry have been designed by students, who only had a limited time to build and characterize them for the iGEM competition, many of these parts are ill-assembled or do not have the function described on the Registry.<br />
<br />
Moreover, even if the function of several parts is well-known, they may not behave as expected when we assemble them together in the same plasmid or in the same organism. Unpredicted emergent properties can arise in such systems. In 2005, Church claimed that by combining biological parts together, we would be able to overcome the indeterminate and non modular aspect of living organisms, and to build biological systems with steady behaviors. But now, more and more biologists agree that if we combine together several well characterized parts, the new system may not only have the addition of the functions of each part: new properties and unpredicted behaviors can very well arise. Which is an obstacle to rational design.<br />
The more complex the system, the more likely it is that the obtained result will differ from the expected one. As a result, synthetic biology is more often a long process of trial and errors, than a rational and functional design.<br />
<br />
As design often leads to unexpected results, it's in fact a more pragmatic approach that is often taken by synthetic biologists, especially at iGEM where we have to deal with the necessity to produce results in a very short amount of time: the method with the best results is a posteriori chosen over the method that looked a priori more rational.<br />
For Oliver Müller, the scientific design is often idealized by biologists, who claim to know exactly how to obtain a certain result, when in fact biological systems are very complex and beyond their control. The uncertainty and the unexpected, in experimental design, are often left untold in synthetic biology as well as in other scientific fields. The reason is that scientists need to frequently publish and show positive results. Negative results, in most cases, are not published.<br />
Moreover, research in biology is a competitive field, where scientists are often tempted to show that their results are the outcome of a rational, well-planned design, even when the results were not those predicted at all. In fact, we think that in iGEM for example, students often change their initial objectives when they present their project, to make them match the results they actually got ; this way, it looks like the project worked just as planned, when in fact it is the result of unexpected results and tinkering.<br />
<br />
For those reasons, O'Malley and other authors have portrayed design in synthetic biology as a pragmatic tinkering, where researchers use parts without knowing if they will assemble correctly, nor what will be the final result. If in theory the synthetic biologist should be able to understand and explain each step of the design and the behavior of the system, in fact the priority is given to results and not to rational design, in order to be able to publish, or to have more funds, or in our case to win the iGEM competition. This method has been called "kludge" by those authors, which is a term that comes from computer science:<br />
<br />
<font color="blue"><blockquote><div align="center"><i>"Unlike other engineering disciplines, synthetic biology has not developed to the point where there are scalable and reliable approaches to finding solutions. Instead, the emerging applications are most often kludges that work, but as individual special cases. They are solutions selected for being fast and cheap and, as a result, they are only somewhat in control."</i></div><br />
<div align="right">Arkin and Fletcher, 2006</div></blockquote></font><br />
<br />
Synthetic biologists are often tempted to use kludges, because they work where rational design fail for unexplainable reasons. For example, if they observe that it's easier to transform a bacteria by electroporation than by conjugation, they will chose to use the former, even if their knowledge led them to believe that conjugation was more likely to work. If they notice that two parts put together give an unpredicted function to an organism and if this function is useful, they will probably continue to combine these two parts to produce the emergent function even if they can't explain why it appears. And if they don't have the result they want while following the rational protocol that should lead to this result, they often try again with different parameters and methods until it works, and then adapt their protocol and model accordingly.<br />
<br />
But if synthetic biologists really do behave like this, as depicted by O'Malley in "Making knowledge in synthetic biology. Designs meets kludge" (2009), then it would mean that they are doing the exact opposite of what they ambition and claim to do. Instead of a rational assembly of well defined and modular parts, synthetic biology would be made of kludgy designs.<br />
<br />
Does that mean that this method is wrong? For some authors like Andrianantoandro, who admit that synthetic biology so far has been rather kludgy, the irrational aspect of synthetic biologists' methods and results can be, and has to be overcome. They think it will become possible to achieve rational, engineer-like design in the future, thanks to the increasing standardization of the field. But other authors like O'Malley think on the contrary that not only kludges are unavoidable in biology, but also they are, actually, a better, more efficient method to produce results and knowledge, than the too rigorous method of the engineers.<br />
<br />
<br />
<br><div align="center"><font color="blue"><h4>Which method should be favored?</h4></font></div><br />
<br />
Synthetic biologists have always been aware that the complexity of living organisms would be an important obstacle to the construction of new parts and biological systems, and to the modification of existent systems. Among the properties of biological systems that interfere the most with mathematical predictions, we can for example mention the transcriptional noise, since there is an irreducible variability in gene expression, or mutations, which can appear spontaneously and randomly in any living organism. In fact, one of the most essential properties of life is the unpredictability of its behavior: for two exact same stimuli, in the same environment, a living organism's reactions can be significantly different.<br />
<br />
But it is in full awareness of this essential unpredictability of biological organisms, and in spite of it, that synthetic biologists claim to be able to predict the behavior of simple biological systems, and to become the engineers of biology. This confidence comes from the fact that the development of systems biology has considerably increased our comprehension of the living systems as a whole, in all their complexity. System biologists use models and mathematical tools to describe and quantify the behavior of biological systems. They showed that complex behaviors in cells, that previously seemed emergent or random, could in fact be described by a set of several differential equations. This was taken by many biologists as proof that at least part of the biological systems could be explained in a logical and predictable ways, and hence that rational designs, equivalent to those used by engineers in mechanics, electronics, aeronautics, etc., could also be applied in biology. And even though the methods used until now may not have been as rational as synthetic biologists had hoped, many believe that the field can become more rational. <br />
<br />
Andrianantoandro, for example, thinks that the noise due to the variability of cells behaviors can be overcome if instead of engineering single cells, we engineered cell populations. Thanks to cell-cell communication, the behavior of each cell would be synchronized, and the population would then become a reliable module with little noise. Other similar solutions keep arising in the field to overcome various unpredictable behaviors.<br />
<br />
Some recent progress in synthetic biology are another reason to hope that the practice of the field could become more rigorous in the near future. The number of standardized parts in the Registry increased considerably in the last years. Some important and complex realizations have been achieved, like the synthesis of a precursor of the artemisinin by a yeast. And overall, the knowledge of how to build parts and how to assemble them has greatly improved in the last ten years, thanks to the experience synthetic biologists are accumulating, and thanks to the fact that all the results and parts are share in open source.<br />
<br />
These are strong arguments in favor of the idea that synthetic biology can overcome kludges. For Serrano, it is essentially because the field is very young that so far, most of the circuits designed by synthetic biologists were made without standardized parts, and with a lot of tinkering. But with the increased standardization of parts and protocols, synthetic biology could maybe indeed become more like engineering in the future.<br />
<br />
<br />
However, it is not certain that kludge in synthetic biology should be overcome.<br />
Some authors believe, on the contrary, that this method provides efficient solutions, and allows unpredicted discoveries, and as such should be kept as a good method to produce both results and knowledge in synthetic biology.<br />
<br />
<font color="blue"><blockquote><div align="center"><i>"Kludging should not be interpreted as a failure of synthetic biology, but as a highly creative and effective process."</i></div><br />
<div align="right">O'Malley, 2010</div></blockquote></font><br />
<br />
It is indeed easy to illustrate the fact that by tinkering, we can find solutions that may not have arisen with a too rigorous method. When a scientist makes models, they expect the biological system to behave as described mathematically. But when they discover that the experimental result significantly differs from the prediction, they try another model, then another, until the model can effectively describe the experimentally observed behavior of the system. This method could be qualified as trial and error. And the interesting point is that what eventually makes the scientist say that one model is better than the others, cannot be explained a priori. The main, and sometimes only argument in favor of choosing one model over the others, is that the scientist saw a posteriori that it worked.<br />
It is common to find papers where the researchers propose a model, and give the values of a set of parameters for which the model works. But there is no explanation of how they found those values. Indeed, they didn't choose them for rational, explainable reasons, but by trial and error, they eventually found this set of values for which the system worked. <br />
This justification could be seen as not sufficient to be scientific, because it only relies on experimental observations, and not on a theory that can be made and supported rationally independently from the experience. But in fact, whether this method meets the criteria for being a good and scientific method or not, it allows to effectively find the parameters for which the model works. Without trial and error, the researchers may never be able to find those parameters, so in a way it could be seen as a productive method.<br />
<br />
A problem could arise, though. If the model only works with parameters that were determined experimentally without any other justification, it may be that the model is actually false, and that it was only by chance that a certain set of parameters made it looked like it accurately described the biological system. Because of this, it is important to try to find a rational explanation for the data that were only found by trial and error, in order to ascertain the accuracy of both the system and the data.<br />
<br />
Using such inelegant and efficient methods can thus be very productive: it allows to test different hypothesis, to find new parameters, and to determine certain values. This is what Max Delbrück has described as being flexible and responsive to the variability of the system of study, in order not to prevent new discoveries. Whereas in comparison, a too rigorous approach can only produce expected results, without any room for novel insights.<br />
<br />
Moreover, with a method where the result is not necessarily predictable nor stable over time, it it possible to build biological systems that evolve. Evolution in synthetic systems is something the scientists often try to avoid, because it would allow the system to lose its implemented function, and thus its utility. And it would also permit the system to gain via evolution new functions that would be detrimental for any reason. But if we leave the possibility for the systems to evolve and to not behave in different ways than those predicted, then they could potentially gain new interesting new functions. These functions could for example be profitable in an industrial point of view. Or we could gain, from the evolution of our engineered devices, a better understanding of the mechanisms of evolution.<br />
<br />
In her paper, O'Malley takes into account all these advantages that derive from kludges, and concludes that this inelegant method should, in fact, not be avoided at all cost in synthetic biology. Even though being able to rationally control and build biological systems as engineers of biology is an enticing ambition, kludges should also be kept to produce efficient results and new knowledge.<br />
<br />
<br />
<div align="center"><h4><font color="blue"> Conclusion </font></h4></div><br />
<br />
<br />
This study allowed us to confront one of the main ambition of synthetic biology to its actual practice. Most researchers in the field think that the construction of synthetic biological systems that would be controlled by human will is possible, if they can standardize the different constituents of living organisms and find rigorous methods to assemble them. Thanks to the contribution of systemic biology, and to the methods borrowed to engineering, synthetic biologists claim to be able to master in the future the irregular and unpredictable behavior of simple living organisms. They want to design biological systems that would follow a precise quantitative model, in a foreseeable and stable way.<br />
<br />
However, if there are indeed more and more biological parts that are standardized and characterized, their behavior is not always the expected one, and often cannot be rationally explained. As a result, the way synthetic biology is currently practiced is not as rigorous as scientists would like it to be. This apparent failure is counterbalanced though by the fact that synthetic biologists still manage to build systems that work with kludge, and thus that a trial and error method should probably kept as a useful tool in the field, even if synthetic biologists were ever to truly become engineers of biology.<br />
<br />
But since the complex interactions that occur in living organisms are increasingly well understood, and that the techniques to build them are more and more efficient, we can still believe that synthetic biology will indeed become more rational in the future. There has in fact already been some interesting results in the field, which lead us to keep hoping it will bring biological systems under our rational understanding and designing abilities.<br />
<br />
<br />
<br />
<div align="center"><h4><font color="blue"> Bibliography </font></h4></div><br />
<br />
ANDRIANANTOANDRO, E., BASU, et als., "Synthetic biology: new engineering rules for an emerging discipline". <i>Molecular Systems Biology</i>, 2006, 2, 2006.0028.<br />
<br />
ARKIN, A. P., FLETCHER, D. A., "Fast, cheap and somewhat in control", <i>Genome Biol.</i>, 2006, 7(8):114.<br />
<br />
CAMERON, D. E., Bashor, C. J., & Collins, J. J., "A brief history of synthetic biology". <i>Nat Rev Micro</i>, 2014, 12(5), 381–390.<br />
<br />
CHURCH G., "From systems biology to synthetic biology", <i>Molecular Systems Biology</i>, Volume 1, Issue 1, 2005.<br />
<br />
EUROPEAN COMMISSION 6TH FRAMEWORK PROGRAMME, "Synbiology: An Analysis of Synthetic Biology Research in Europe and North America. Final Report on Analysis of Synthetic Biology Sector", Septembre 2006.<br />
<br />
HEINEMANN M., PANKE S., "Synthetic biology -‐ putting engineering into biology." Bioinformatics 2006, 22:2790-‐2799.<br />
<br />
ISALAN, M., LEMERLE, C., et als., "Evolvability and hierarchy in rewired bacterial gene networks." Nature, 2008, 452(7189), 840–845.<br />
<br />
KEPES, F., La biologie de synthèse: développements, potentialités et défis. <i>Réalités industrielles</i>, 2010, no 1, p. 8-14.<br />
<br />
O'MALLEY M., "Making knowledge in synthetic biology. Designs meets kludge", <i>Biological Theory</i>, vol. 4, n°4, 2009, p. 378-389.<br />
<br />
SERRANO, L., "Synthetic biology: promises and challenges". <i>Molecular Systems Biology</i>, 2007.<br />
<br />
<br />
<!-- inserer texte de la page ici --><br />
<br />
</div><br />
<br />
<br />
<br />
{{:Team:Evry/Template:HomeFooter}}</div>Chesne jhttp://2014.igem.org/Team:Evry/Biology/GenomeAssemblyTeam:Evry/Biology/GenomeAssembly2014-10-18T03:40:25Z<p>Chesne j: </p>
<hr />
<div>{{:Team:Evry/Template:HomeIncludes}}<br />
{{:Team:Evry/Template:Menu}}<br />
{{:Team:Evry/Template:genomeAssemblyTop}}<br />
<br />
<br />
<html><br />
<br />
<h1> De novo Genome assembly</h1><br />
<br><br><br />
<div align="justify"><br />
<p><br />
In order to perform the genome assembly of our bacterium, we choose to used the velvet software. It is an algorithm base on short read sequencing alignments. This reconstruction algorithm is based on the Brujin graphs which is in graph theory a directed graph which represents overlaps between sequences of symbols, in or case our short contis DNA. We choose 4 kmer size. For the first one at 31 we obtained 1493 contigs, for a kmer size of 65, 413 contigs are obtain. For the two last kmer tested, 97 and 113 we obtained 275 and 245 contigs.The prokka software is an automated tools for genome annotation. The run take less than ten minutes, as they was proposed on their articles.In order to control the quality of our DNA seq we choose to made first a Proteome comparisons with<i> Pseudovibrio FOBEG1</i> which is our reference strain. For that purpose we decided to look at our first genome version contains 275 contigs which was provide by the Velvet de novo assembly tools. For the 5456 proteins of<i> Pseudovibrio FO-BEG1</i>, 5132 proteins (which are our reference strain) are match with a prokka anotation CDS. 5002 with a unique alignment 4936, 4687 with an alignement > 90%, 4415 > 95% and 2525 > 99%. For that purpose, we are sure that we sequenced a strain related to the <i>Pseudovibrio</i> genus.<br />
<br />
After this proteome comparison, we tried to improved our genome assembly by improved the kmer size and we saw that the contigs numbers was reduced to 245. In order to analyse the annotation and the quality of our genome annotation, we looked at four main specific annotation types such as antibiotic resitance, restriction enzyme, metals (such as cadmium, copper and mercury), and other toxic compounds (such as phenol, nitrate, nitrite).<br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<br />
<br />
<h4>Antibiotic resistance </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
Concerning the antibiotics, we look at specific antibiotics such as kanamycin, erythromycin, tetracycline, ampicillin, and chloramphenicol and other type of resistance gene. For the kanamycin and erythromycin, we found not relevant annotation. However, for the other ones, tetracycline, ampicillin, and chloramphenicol, we found specific annotations.<br />
<br />
Regarding the tetracycline, we found that it possessed one Tetracycline repressor protein class H , two Tetracycline resistance protein, class C and nine Bacterial regulatory proteins, tetR family annotated genes. This result are coincident with our experiment where we found that <i>Pseudovibrio </i>is resistant to tetracycline.<br />
<br />
About the ampicillin, one Metallo-beta-lactamase superfamily protein, Beta-lactamase, Beta-lactamase type II precursor, two Beta-lactamase precursor, Beta-lactamase hydrolase-like protein HTH-type transcriptional activator AmpR and five Putative beta-lactamase HcpC precursor were predicted by the Prokka software. Also this result is coincident with our experiment.<br />
<br />
For the Chloramphenicol antibioctics, we predicted that the chloramphenicol phosphotransferase-like protein, Chloramphenicol 3-O phosphotransferase and Chloramphenicol acetyltransferase are present in our strain. The last one is used as a reporter gene in molecular biology. But in contrary to other antibiotics, the test does not reveal, that our strain is resistant to the Chloramphenicol.<br />
<br />
Finally we look at other antibiotic resistance and we see that other antibiotics such as the Bleomycin are predicted. Bleomycin is used as a chemotherapy agents for the Hodgkin's lymphoma. Also it possessed the Multidrug resistance protein, MdtA, MdtA precursor, MdtB, MdtK, MdtN, MdtH, MdtG, which are known to play an important role in antibiotic resistance.<br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<h4>Restriction enzyme</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
During the transformation tests of our strain, we supposed that <i>Pseudovibrio Denitrificans</i>, was able to degrade DNA. Indeed all our electroporation attempts failed. They could not keep the plasmid inside them. One relevant research led us to the discovery of a Type I Restriction enzyme EcoKI. This site specific DNA methylase is not very common but can be found in a wide range of Gammaproteobacteria and so potentially into PseudoVibrio Denitrificans. We blasted the sequence of EcoRI gene with our bacteria genome, and we found that <i>Pseudovibro</i> have the gene.<br />
EcoKI recognises the sequence 5’ AAC(N)6GTGC-3’ and acts depending on the methylation state of the DNA substrate. It can be a methyltransferase or an endonuclease. Psb1c3, first plasmid that we tried to transform ( E.Coli Ori) does not have the target sequence of EcoRI. Otherwise, in one plasmid sent by Dr Thomas Drepper from Heinrich-Heine-Universität Düsseldorf, Institute of Molecular Enzyme Technology, Group of Bacterial Photobiotechnology, which was from a bacterium very closed with <i>Pseudovibro</i> and which we tried as well to transform, there is the target sequence of the enzyme. <br />
At this moment, <i>Pseudovibro</i> was not sequenced, so we could not find the localisation of the EcoKI gene. In order to integrate our constructions just in time, we opted for a transposon strategy.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/98/DNA1EvRY.jpg" style="width:50%;height:50%"/><p><br />
<i>Figure 1: Sequence of the pRhokHi vector and the hightlight of the EcoKI target sequence </i></p><br />
</div><br />
<br />
<br><br><br />
</div><br />
<h4> Nitrate/nitrite</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
Concerninrg the nitrate and nitrite a potential gene transporter NarK Nitrate/and Nitrite was predicte. Also we discovered the protein NapE was predict in the genome of Pseudovibrio Denitrificans. This enzyme is known to reduce nitrate to nitrite. Other some other genes such as Respiratory nitrate reductase 1 alpha and game chaine and other which are involve in the nitrification process. It possessed also Required for formate-dependent nitrite reduction. Not required for the biosynthesis of any of the c-type cytochromes nor for the secretion of the periplasmic cytochromes. They are involve in the reduction of nitrite to amoniac<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br> <br />
</div><br />
<h4>Cadmium</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
Concerning one of our compound target the cadmium, we were really surprised about it’s resistance to hight concentration. We found that the annotation reaveal two potentials genes for cadmium resistance. The putative cadmium-transporting ATPase involved in cadmium/zinc transport and also the Cobalt-zinc-cadmium resistance protein CzcB. CzcB has been asociated with a Gene ontology terms for Biological Process metal ion tranport and Molecular function metal ion transmembrane transporter activity. Other experiment need to be performed in order to be sure that the bacterium is resistant. A simple Northern Blot of the CzcB, mRNA will give a simple way to analyse the data and provide information of this enzyme<br />
<br />
<br />
</p><br />
</div><br />
<br><br> <br />
<h4>Copper </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
Copper is an essential heavy metal; chemical element. It plays a role in vital oxidation and reduction processes. Multicopper oxidase are enzymes able to oxidize substrate and are involved in copper homeostasis. They play a part in iron transfer and enhanced oxidase activity. <br />
The role of copper homeostasis protein is still unknown, however some studies have established a link in intracellular trafficking of CuI. Copper-transporting P-type ATPase plays an essential role in copper balance as intestinal transport of copper in mammalian. Copper-sensing transcriptional repressor CsoR is involved in the cellular response in order to increase copper concentration inside bacterium. Copper resistance protein A precursor is a soluble protein which catalyzes oxidation of Cu and interact with membrane. Periplasmic copper-binding protein (NosD) is a periplasmic protein which can insert copper into reductase apoenzyme. Copper-exporting P-type ATPase A forms a homodimer at high copper concentration and export it in co-operation with copZ. <br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Mercuric</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
Concerning the Mercure, a gene named Mercuric reductase was found. It is known to catalyzes the two-electron reduction of mercuric ions to elemental mercury using NADPH as an electron donor . That shows that potentially our bacteria can in high mercury concentration be able to survive due to the creaction of NADPH which is an important metabolite. <br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Phenol </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
One of our project aim was to degrade phenol thank to <i>Pseudovivrio denitrificans</i>. However, many organisms are able to degrade phenol by their own, anaerobia or aerobe. (Khazi Mahammedilyas Basha, 2010) Before to transform our bacterium in this way we were looking for a biodegradation pathway.<br />
As <i> Pseudovibrio denitricans</i> is an anaerobic bacterium, we have focused on the anaerobic degradation pathway for phenol.<br />
<br />
<br />
</p><br><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/9e/Phenol4.png" style="width:20%;height:20%"/><br />
<p>Figure2 : <i>Anaerobic pathway degradation for phenol</i></p></div><p><br />
In order to determine if our bacterium degrade phenol we watched if it owns different enzymes in the phenol pathway degradation.<br />
For the first enzyme; 4-hydroxybenzoate decarboxylase we found 4 coding sequence with similarity; they have an enzymatic promiscuity. The second enzyme; p-hydroxy benzoate 3-monooxygenase from the phenol degradation pathway match perfectly with our bacterium.<br />
For Protocatechuate 3, 4 dioxygenase , we have found two coding sequences corresponding.<br />
The cycloisomerase coding sequence match perfectly in our bacterium. As the previous enzyme, enol - lactonase have matching too<br />
For the transferase enzyme, we have found two similar sequence leading to promiscuity enzymes. For the two last enzymes; they gave two different final product. One of them; thiolase have 4 similar sequences leading to promiscuity enzymes, though the second one; acyltransferase have 17 similar sequences leading to promiscuity enzymes.<br />
<br />
<br />
So, this analyze lead to think that<i> Pseudovibrio denetifricans</i> own the all anaerobic phenol degradation pathway. Hence, we have found all coding sequences correlate to enzyme from phenol degradation. And the bacterium may rather the acetyl-coA pathway than succenyle-coA because of the promiscuity enzyme quantity.<br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<h4>REFERENCE</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</html><br />
<br />
<br />
<br />
<br />
<br />
<br />
{{:Team:Evry/Template:HomeFooter}}</div>Chesne jhttp://2014.igem.org/Team:Evry/Biology/GenomeAssemblyTeam:Evry/Biology/GenomeAssembly2014-10-18T03:37:53Z<p>Chesne j: </p>
<hr />
<div>{{:Team:Evry/Template:HomeIncludes}}<br />
{{:Team:Evry/Template:Menu}}<br />
{{:Team:Evry/Template:genomeAssemblyTop}}<br />
<br />
<br />
<html><br />
<br />
<h1> De novo Genome assembly</h1><br />
<br><br><br />
<div align="justify"><br />
<p><br />
In order to perform the genome assembly of our bacteria, we choose to used the velvet software. It is an algorithm base on short read sequencing alignments. This reconstruction algorithm is based on the Brujin graphs which is in graph theory a directed graph which represents overlaps between sequences of symbols, in or case our short contis DNA. We choose 4 kmer size. For the first one at 31 we obtained 1493 contigs, for a kmer size of 65, 413 contigs are obtain. For the two last kmer tested, 97 and 113 we obtained 275 and 245 contigs.The prokka software is an automated tools for genome annotation. The run take less than ten minutes, as they was proposed on their articles.In order to control the quality of our DNA seq we choose to made first a Proteome comparisons with Pseudovibrio FOBEG1 which is our reference strain. For that purpose we decided to look at our first genome version contains 275 contigs which was provide by the Velvet de novo assembly tools. For the 5456 proteins of Pseudovibrio FO-BEG1, 5132 proteins (which are our reference strain) are match with a prokka anotation CDS. 5002 with a unique alignment 4936, 4687 with an alignement > 90%, 4415 > 95% and 2525 > 99%. For that purpose, we are sure that we sequenced a strain related to the Pseudovibrio genus.<br />
<br />
After this proteome comparison, we tried to improved our genome assembly by improved the kmer size and we saw that the contigs numbers was reduced to 245. In order to analyse the annotation and the quality of our genome annotation, we looked at four main specific annotation types such as antibiotic resitance, restriction enzyme, metals (such as cadmium, copper and mercury), and other toxic compounds (such as phenol, nitrate, nitrite).<br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<br />
<br />
<h4>Antibiotic resistance </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
Concerning the antibiotics, we look at specific antibiotics such as kanamycin, erythromycin, tetracycline, ampicillin, and chloramphenicol and other type of resistance gene. For the kanamycin and erythromycin, we found not relevant annotation. However, for the other ones, tetracycline, ampicillin, and chloramphenicol, we found specific annotations.<br />
<br />
Regarding the tetracycline, we found that it possessed one Tetracycline repressor protein class H , two Tetracycline resistance protein, class C and nine Bacterial regulatory proteins, tetR family annotated genes. This result are coincident with our experiment where we found that Pseudovibrio is resistant to tetracycline.<br />
<br />
About the ampicillin, one Metallo-beta-lactamase superfamily protein, Beta-lactamase, Beta-lactamase type II precursor, two Beta-lactamase precursor, Beta-lactamase hydrolase-like protein HTH-type transcriptional activator AmpR and five Putative beta-lactamase HcpC precursor were predicted by the Prokka software. Also this result is coincident with our experiment.<br />
<br />
For the Chloramphenicol antibioctics, we predicted that the chloramphenicol phosphotransferase-like protein, Chloramphenicol 3-O phosphotransferase and Chloramphenicol acetyltransferase are present in our strain. The last one is used as a reporter gene in molecular biology. But in contrary to other antibiotics, the test does not reveal, that our strain is resistant to the Chloramphenicol.<br />
<br />
Finally we look at other antibiotic resistance and we see that other antibiotics such as the Bleomycin are predicted. Bleomycin is used as a chemotherapy agents for the Hodgkin's lymphoma. Also it possessed the Multidrug resistance protein, MdtA, MdtA precursor, MdtB, MdtK, MdtN, MdtH, MdtG, which are known to play an important role in antibiotic resistance.<br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<h4>Restriction enzyme</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
During the transformation tests of our strain, we supposed that Pseudovibrio Denitrificans, was able to degrade DNA. Indeed all our electroporation attempts failed. They could not keep the plasmid inside them. One relevant research led us to the discovery of a Type I Restriction enzyme EcoKI. This site specific DNA methylase is not very common but can be found in a wide range of Gammaproteobacteria and so potentially into PseudoVibrio Denitrificans. We blasted the sequence of EcoRI gene with our bacteria genome, and we found that Pseudovibro have the gene.<br />
EcoKI recognises the sequence 5’ AAC(N)6GTGC-3’ and acts depending on the methylation state of the DNA substrate. It can be a methyltransferase or an endonuclease. Psb1c3, first plasmid that we tried to transform ( E.Coli Ori) does not have the target sequence of EcoRI. Otherwise, in one plasmid sent by Dr Thomas Drepper from Heinrich-Heine-Universität Düsseldorf, Institute of Molecular Enzyme Technology, Group of Bacterial Photobiotechnology, which was from a bacterium very closed with Pseudovibro and which we tried as well to transform, there is the target sequence of the enzyme. <br />
At this moment, Pseudovibro was not sequenced, so we could not find the localisation of the EcoKI gene. In order to integrate our constructions just in time, we opted for a transposon strategy.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/98/DNA1EvRY.jpg" style="width:50%;height:50%"/><p><br />
<i>Figure 1: Sequence of the pRhokHi vector and the hightlight of the EcoKI target sequence </i></p><br />
</div><br />
<br />
<br><br><br />
</div><br />
<h4> Nitrate/nitrite</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
Concerninrg the nitrate and nitrite a potential gene transporter NarK Nitrate/and Nitrite was predicte. Also we discovered the protein NapE was predict in the genome of Pseudovibrio Denitrificans. This enzyme is known to reduce nitrate to nitrite. Other some other genes such as Respiratory nitrate reductase 1 alpha and game chaine and other which are involve in the nitrification process. It possessed also Required for formate-dependent nitrite reduction. Not required for the biosynthesis of any of the c-type cytochromes nor for the secretion of the periplasmic cytochromes. They are involve in the reduction of nitrite to amoniac<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br> <br />
</div><br />
<h4>Cadmium</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
Concerning one of our compound target the cadmium, we were really surprised about it’s resistance to hight concentration. We found that the annotation reaveal two potentials genes for cadmium resistance. The putative cadmium-transporting ATPase involved in cadmium/zinc transport and also the Cobalt-zinc-cadmium resistance protein CzcB. CzcB has been asociated with a Gene ontology terms for Biological Process metal ion tranport and Molecular function metal ion transmembrane transporter activity. Other experiment need to be performed in order to be sure that the bacterium is resistant. A simple Northern Blot of the CzcB, mRNA will give a simple way to analyse the data and provide information of this enzyme<br />
<br />
<br />
</p><br />
</div><br />
<br><br> <br />
<h4>Copper </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
Copper is an essential heavy metal; chemical element. It plays a role in vital oxidation and reduction processes. Multicopper oxidase are enzymes able to oxidize substrate and are involved in copper homeostasis. They play a part in iron transfer and enhanced oxidase activity. <br />
The role of copper homeostasis protein is still unknown, however some studies have established a link in intracellular trafficking of CuI. Copper-transporting P-type ATPase plays an essential role in copper balance as intestinal transport of copper in mammalian. Copper-sensing transcriptional repressor CsoR is involved in the cellular response in order to increase copper concentration inside bacterium. Copper resistance protein A precursor is a soluble protein which catalyzes oxidation of Cu and interact with membrane. Periplasmic copper-binding protein (NosD) is a periplasmic protein which can insert copper into reductase apoenzyme. Copper-exporting P-type ATPase A forms a homodimer at high copper concentration and export it in co-operation with copZ. <br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Mercuric</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
Concerning the Mercure, a gene named Mercuric reductase was found. It is known to catalyzes the two-electron reduction of mercuric ions to elemental mercury using NADPH as an electron donor . That shows that potentially our bacteria can in high mercury concentration be able to survive due to the creaction of NADPH which is an important metabolite. <br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Phenol </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
One of our project aim was to degrade phenol thank to <i>Pseudovivrio denitrificans</i>. However, many organisms are able to degrade phenol by their own, anaerobia or aerobe. (Khazi Mahammedilyas Basha, 2010) Before to transform our bacterium in this way we were looking for a biodegradation pathway.<br />
As <i> Pseudovibrio denitricans</i> is an anaerobic bacterium, we have focused on the anaerobic degradation pathway for phenol.<br />
<br />
<br />
</p><br><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/9e/Phenol4.png" style="width:20%;height:20%"/><br />
<p>Figure2 : <i>Anaerobic pathway degradation for phenol</i></p></div><p><br />
In order to determine if our bacterium degrade phenol we watched if it owns different enzymes in the phenol pathway degradation.<br />
For the first enzyme; 4-hydroxybenzoate decarboxylase we found 4 coding sequence with similarity; they have an enzymatic promiscuity. The second enzyme; p-hydroxy benzoate 3-monooxygenase from the phenol degradation pathway match perfectly with our bacterium.<br />
For Protocatechuate 3, 4 dioxygenase , we have found two coding sequences corresponding.<br />
The cycloisomerase coding sequence match perfectly in our bacterium. As the previous enzyme, enol - lactonase have matching too<br />
For the transferase enzyme, we have found two similar sequence leading to promiscuity enzymes. For the two last enzymes; they gave two different final product. One of them; thiolase have 4 similar sequences leading to promiscuity enzymes, though the second one; acyltransferase have 17 similar sequences leading to promiscuity enzymes.<br />
<br />
<br />
So, this analyze lead to think that<i> Pseudovibrio denetifricans</i> own the all anaerobic phenol degradation pathway. Hence, we have found all coding sequences correlate to enzyme from phenol degradation. And the bacterium may rather the acetyl-coA pathway than succenyle-coA because of the promiscuity enzyme quantity.<br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<h4>REFERENCE</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</html><br />
<br />
<br />
<br />
<br />
<br />
<br />
{{:Team:Evry/Template:HomeFooter}}</div>Chesne jhttp://2014.igem.org/Team:Evry/Biology/GenomeAssemblyTeam:Evry/Biology/GenomeAssembly2014-10-18T03:36:53Z<p>Chesne j: </p>
<hr />
<div>{{:Team:Evry/Template:HomeIncludes}}<br />
{{:Team:Evry/Template:Menu}}<br />
{{:Team:Evry/Template:genomeAssemblyTop}}<br />
<br />
<br />
<html><br />
<br />
<h1> De novo Genome assembly</h1><br />
<br><br><br />
<div align="justify"><br />
<p><br />
In order to perform the genome assembly of our bacteria, we choose to used the velvet software. It is an algorithm base on short read sequencing alignments. This reconstruction algorithm is based on the Brujin graphs which is in graph theory a directed graph which represents overlaps between sequences of symbols, in or case our short contis DNA. We choose 4 kmer size. For the first one at 31 we obtained 1493 contigs, for a kmer size of 65, 413 contigs are obtain. For the two last kmer tested, 97 and 113 we obtained 275 and 245 contigs.The prokka software is an automated tools for genome annotation. The run take less than ten minutes, as they was proposed on their articles.In order to control the quality of our DNA seq we choose to made first a Proteome comparisons with Pseudovibrio FOBEG1 which is our reference strain. For that purpose we decided to look at our first genome version contains 275 contigs which was provide by the Velvet de novo assembly tools. For the 5456 proteins of Pseudovibrio FO-BEG1, 5132 proteins (which are our reference strain) are match with a prokka anotation CDS. 5002 with a unique alignment 4936, 4687 with an alignement > 90%, 4415 > 95% and 2525 > 99%. For that purpose, we are sure that we sequenced a strain related to the Pseudovibrio genus.<br />
<br />
After this proteome comparison, we tried to improved our genome assembly by improved the kmer size and we saw that the contigs numbers was reduced to 245. In order to analyse the annotation and the quality of our genome annotation, we looked at four main specific annotation types such as antibiotic resitance, restriction enzyme, metals (such as cadmium, copper and mercury), and other toxic compounds (such as phenol, nitrate, nitrite).<br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<br />
<br />
<h4>Antibiotic resistance </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
Concerning the antibiotics, we look at specific antibiotics such as kanamycin, erythromycin, tetracycline, ampicillin, and chloramphenicol and other type of resistance gene. For the kanamycin and erythromycin, we found not relevant annotation. However, for the other ones, tetracycline, ampicillin, and chloramphenicol, we found specific annotations.<br />
<br><br />
Regarding the tetracycline, we found that it possessed one Tetracycline repressor protein class H , two Tetracycline resistance protein, class C and nine Bacterial regulatory proteins, tetR family annotated genes. This result are coincident with our experiment where we found that Pseudovibrio is resistant to tetracycline.<br />
<br><br />
About the ampicillin, one Metallo-beta-lactamase superfamily protein, Beta-lactamase, Beta-lactamase type II precursor, two Beta-lactamase precursor, Beta-lactamase hydrolase-like protein HTH-type transcriptional activator AmpR and five Putative beta-lactamase HcpC precursor were predicted by the Prokka software. Also this result is coincident with our experiment.<br />
<br />
<br><br />
For the Chloramphenicol antibioctics, we predicted that the chloramphenicol phosphotransferase-like protein, Chloramphenicol 3-O phosphotransferase and Chloramphenicol acetyltransferase are present in our strain. The last one is used as a reporter gene in molecular biology. But in contrary to other antibiotics, the test does not reveal, that our strain is resistant to the Chloramphenicol.<br />
<br><br />
Finally we look at other antibiotic resistance and we see that other antibiotics such as the Bleomycin are predicted. Bleomycin is used as a chemotherapy agents for the Hodgkin's lymphoma. Also it possessed the Multidrug resistance protein, MdtA, MdtA precursor, MdtB, MdtK, MdtN, MdtH, MdtG, which are known to play an important role in antibiotic resistance.<br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<h4>Restriction enzyme</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
During the transformation tests of our strain, we supposed that Pseudovibrio Denitrificans, was able to degrade DNA. Indeed all our electroporation attempts failed. They could not keep the plasmid inside them. One relevant research led us to the discovery of a Type I Restriction enzyme EcoKI. This site specific DNA methylase is not very common but can be found in a wide range of Gammaproteobacteria and so potentially into PseudoVibrio Denitrificans. We blasted the sequence of EcoRI gene with our bacteria genome, and we found that Pseudovibro have the gene.<br />
EcoKI recognises the sequence 5’ AAC(N)6GTGC-3’ and acts depending on the methylation state of the DNA substrate. It can be a methyltransferase or an endonuclease. Psb1c3, first plasmid that we tried to transform ( E.Coli Ori) does not have the target sequence of EcoRI. Otherwise, in one plasmid sent by Dr Thomas Drepper from Heinrich-Heine-Universität Düsseldorf, Institute of Molecular Enzyme Technology, Group of Bacterial Photobiotechnology, which was from a bacterium very closed with Pseudovibro and which we tried as well to transform, there is the target sequence of the enzyme. <br />
At this moment, Pseudovibro was not sequenced, so we could not find the localisation of the EcoKI gene. In order to integrate our constructions just in time, we opted for a transposon strategy.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/98/DNA1EvRY.jpg" style="width:50%;height:50%"/><p><br />
<i>Figure 1: Sequence of the pRhokHi vector and the hightlight of the EcoKI target sequence </i></p><br />
</div><br />
<br />
<br><br><br />
</div><br />
<h4> Nitrate/nitrite</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
Concerninrg the nitrate and nitrite a potential gene transporter NarK Nitrate/and Nitrite was predicte. Also we discovered the protein NapE was predict in the genome of Pseudovibrio Denitrificans. This enzyme is known to reduce nitrate to nitrite. Other some other genes such as Respiratory nitrate reductase 1 alpha and game chaine and other which are involve in the nitrification process. It possessed also Required for formate-dependent nitrite reduction. Not required for the biosynthesis of any of the c-type cytochromes nor for the secretion of the periplasmic cytochromes. They are involve in the reduction of nitrite to amoniac<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br> <br />
</div><br />
<h4>Cadmium</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
Concerning one of our compound target the cadmium, we were really surprised about it’s resistance to hight concentration. We found that the annotation reaveal two potentials genes for cadmium resistance. The putative cadmium-transporting ATPase involved in cadmium/zinc transport and also the Cobalt-zinc-cadmium resistance protein CzcB. CzcB has been asociated with a Gene ontology terms for Biological Process metal ion tranport and Molecular function metal ion transmembrane transporter activity. Other experiment need to be performed in order to be sure that the bacterium is resistant. A simple Northern Blot of the CzcB, mRNA will give a simple way to analyse the data and provide information of this enzyme<br />
<br />
<br />
</p><br />
</div><br />
<br><br> <br />
<h4>Copper </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
Copper is an essential heavy metal; chemical element. It plays a role in vital oxidation and reduction processes. Multicopper oxidase are enzymes able to oxidize substrate and are involved in copper homeostasis. They play a part in iron transfer and enhanced oxidase activity. <br />
The role of copper homeostasis protein is still unknown, however some studies have established a link in intracellular trafficking of CuI. Copper-transporting P-type ATPase plays an essential role in copper balance as intestinal transport of copper in mammalian. Copper-sensing transcriptional repressor CsoR is involved in the cellular response in order to increase copper concentration inside bacterium. Copper resistance protein A precursor is a soluble protein which catalyzes oxidation of Cu and interact with membrane. Periplasmic copper-binding protein (NosD) is a periplasmic protein which can insert copper into reductase apoenzyme. Copper-exporting P-type ATPase A forms a homodimer at high copper concentration and export it in co-operation with copZ. <br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Mercuric</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
Concerning the Mercure, a gene named Mercuric reductase was found. It is known to catalyzes the two-electron reduction of mercuric ions to elemental mercury using NADPH as an electron donor . That shows that potentially our bacteria can in high mercury concentration be able to survive due to the creaction of NADPH which is an important metabolite. <br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Phenol </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
One of our project aim was to degrade phenol thank to <i>Pseudovivrio denitrificans</i>. However, many organisms are able to degrade phenol by their own, anaerobia or aerobe. (Khazi Mahammedilyas Basha, 2010) Before to transform our bacterium in this way we were looking for a biodegradation pathway.<br />
As <i> Pseudovibrio denitricans</i> is an anaerobic bacterium, we have focused on the anaerobic degradation pathway for phenol.<br />
<br />
<br />
</p><br><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/9e/Phenol4.png" style="width:25%;height:25%"/><br />
<p>Figure2 : <i>Anaerobic pathway degradation for phenol</i></p></div><p><br />
In order to determine if our bacterium degrade phenol we watched if it owns different enzymes in the phenol pathway degradation.<br />
For the first enzyme; 4-hydroxybenzoate decarboxylase we found 4 coding sequence with similarity; they have an enzymatic promiscuity. The second enzyme; p-hydroxy benzoate 3-monooxygenase from the phenol degradation pathway match perfectly with our bacterium.<br />
For Protocatechuate 3, 4 dioxygenase , we have found two coding sequences corresponding.<br />
The cycloisomerase coding sequence match perfectly in our bacterium. As the previous enzyme, enol - lactonase have matching too<br />
For the transferase enzyme, we have found two similar sequence leading to promiscuity enzymes. For the two last enzymes; they gave two different final product. One of them; thiolase have 4 similar sequences leading to promiscuity enzymes, though the second one; acyltransferase have 17 similar sequences leading to promiscuity enzymes.<br />
<br />
<br />
So, this analyze lead to think that<i> Pseudovibrio denetifricans</i> own the all anaerobic phenol degradation pathway. Hence, we have found all coding sequences correlate to enzyme from phenol degradation. And the bacterium may rather the acetyl-coA pathway than succenyle-coA because of the promiscuity enzyme quantity.<br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<h4>REFERENCE</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</html><br />
<br />
<br />
<br />
<br />
<br />
<br />
{{:Team:Evry/Template:HomeFooter}}</div>Chesne jhttp://2014.igem.org/Team:Evry/Biology/GenomeAssemblyTeam:Evry/Biology/GenomeAssembly2014-10-18T03:35:58Z<p>Chesne j: </p>
<hr />
<div>{{:Team:Evry/Template:HomeIncludes}}<br />
{{:Team:Evry/Template:Menu}}<br />
{{:Team:Evry/Template:genomeAssemblyTop}}<br />
<br />
<br />
<html><br />
<br />
<h1> De novo Genome assembly</h1><br />
<br><br><br />
<div align="justify"><br />
<p><br />
In order to perform the genome assembly of our bacteria, we choose to used the velvet software. It is an algorithm base on short read sequencing alignments. This reconstruction algorithm is based on the Brujin graphs which is in graph theory a directed graph which represents overlaps between sequences of symbols, in or case our short contis DNA. We choose 4 kmer size. For the first one at 31 we obtained 1493 contigs, for a kmer size of 65, 413 contigs are obtain. For the two last kmer tested, 97 and 113 we obtained 275 and 245 contigs.The prokka software is an automated tools for genome annotation. The run take less than ten minutes, as they was proposed on their articles.In order to control the quality of our DNA seq we choose to made first a Proteome comparisons with Pseudovibrio FOBEG1 which is our reference strain. For that purpose we decided to look at our first genome version contains 275 contigs which was provide by the Velvet de novo assembly tools. For the 5456 proteins of Pseudovibrio FO-BEG1, 5132 proteins (which are our reference strain) are match with a prokka anotation CDS. 5002 with a unique alignment 4936, 4687 with an alignement > 90%, 4415 > 95% and 2525 > 99%. For that purpose, we are sure that we sequenced a strain related to the Pseudovibrio genus.<br />
<br />
After this proteome comparison, we tried to improved our genome assembly by improved the kmer size and we saw that the contigs numbers was reduced to 245. In order to analyse the annotation and the quality of our genome annotation, we looked at four main specific annotation types such as antibiotic resitance, restriction enzyme, metals (such as cadmium, copper and mercury), and other toxic compounds (such as phenol, nitrate, nitrite).<br />
<br />
</p><br />
</div><br />
<br><br><br />
<br />
<br />
<h4>Antibiotic resistance </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
Concerning the antibiotics, we look at specific antibiotics such as kanamycin, erythromycin, tetracycline, ampicillin, and chloramphenicol and other type of resistance gene. For the kanamycin and erythromycin, we found not relevant annotation. However, for the other ones, tetracycline, ampicillin, and chloramphenicol, we found specific annotations.<br />
<br><br />
Regarding the tetracycline, we found that it possessed one Tetracycline repressor protein class H , two Tetracycline resistance protein, class C and nine Bacterial regulatory proteins, tetR family annotated genes. This result are coincident with our experiment where we found that Pseudovibrio is resistant to tetracycline.<br />
<br><br />
About the ampicillin, one Metallo-beta-lactamase superfamily protein, Beta-lactamase, Beta-lactamase type II precursor, two Beta-lactamase precursor, Beta-lactamase hydrolase-like protein HTH-type transcriptional activator AmpR and five Putative beta-lactamase HcpC precursor were predicted by the Prokka software. Also this result is coincident with our experiment.<br />
<br />
<br><br />
For the Chloramphenicol antibioctics, we predicted that the chloramphenicol phosphotransferase-like protein, Chloramphenicol 3-O phosphotransferase and Chloramphenicol acetyltransferase are present in our strain. The last one is used as a reporter gene in molecular biology. But in contrary to other antibiotics, the test does not reveal, that our strain is resistant to the Chloramphenicol.<br />
<br><br />
Finally we look at other antibiotic resistance and we see that other antibiotics such as the Bleomycin are predicted. Bleomycin is used as a chemotherapy agents for the Hodgkin's lymphoma. Also it possessed the Multidrug resistance protein, MdtA, MdtA precursor, MdtB, MdtK, MdtN, MdtH, MdtG, which are known to play an important role in antibiotic resistance.<br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<h4>Restriction enzyme</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
During the transformation tests of our strain, we supposed that Pseudovibrio Denitrificans, was able to degrade DNA. Indeed all our electroporation attempts failed. They could not keep the plasmid inside them. One relevant research led us to the discovery of a Type I Restriction enzyme EcoKI. This site specific DNA methylase is not very common but can be found in a wide range of Gammaproteobacteria and so potentially into PseudoVibrio Denitrificans. We blasted the sequence of EcoRI gene with our bacteria genome, and we found that Pseudovibro have the gene.<br />
EcoKI recognises the sequence 5’ AAC(N)6GTGC-3’ and acts depending on the methylation state of the DNA substrate. It can be a methyltransferase or an endonuclease. Psb1c3, first plasmid that we tried to transform ( E.Coli Ori) does not have the target sequence of EcoRI. Otherwise, in one plasmid sent by Dr Thomas Drepper from Heinrich-Heine-Universität Düsseldorf, Institute of Molecular Enzyme Technology, Group of Bacterial Photobiotechnology, which was from a bacterium very closed with Pseudovibro and which we tried as well to transform, there is the target sequence of the enzyme. <br />
At this moment, Pseudovibro was not sequenced, so we could not find the localisation of the EcoKI gene. In order to integrate our constructions just in time, we opted for a transposon strategy.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/98/DNA1EvRY.jpg" style="width:50%;height:50%"/><p><br />
<i>Figure 1: Sequence of the pRhokHi vector and the hightlight of the EcoKI target sequence </i></p><br />
</div><br />
<br />
<br><br><br />
</div><br />
<h4> Nitrate/nitrite</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
Concerninrg the nitrate and nitrite a potential gene transporter NarK Nitrate/and Nitrite was predicte. Also we discovered the protein NapE was predict in the genome of Pseudovibrio Denitrificans. This enzyme is known to reduce nitrate to nitrite. Other some other genes such as Respiratory nitrate reductase 1 alpha and game chaine and other which are involve in the nitrification process. It possessed also Required for formate-dependent nitrite reduction. Not required for the biosynthesis of any of the c-type cytochromes nor for the secretion of the periplasmic cytochromes. They are involve in the reduction of nitrite to amoniac<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br> <br />
</div><br />
<h4>Cadmium</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
Concerning one of our compound target the cadmium, we were really surprised about it’s resistance to hight concentration. We found that the annotation reaveal two potentials genes for cadmium resistance. The putative cadmium-transporting ATPase involved in cadmium/zinc transport and also the Cobalt-zinc-cadmium resistance protein CzcB. CzcB has been asociated with a Gene ontology terms for Biological Process metal ion tranport and Molecular function metal ion transmembrane transporter activity. Other experiment need to be performed in order to be sure that the bacterium is resistant. A simple Northern Blot of the CzcB, mRNA will give a simple way to analyse the data and provide information of this enzyme<br />
<br />
<br />
</p><br />
</div><br />
<br><br> <br />
<h4>Copper </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
Copper is an essential heavy metal; chemical element. It plays a role in vital oxidation and reduction processes. Multicopper oxidase are enzymes able to oxidize substrate and are involved in copper homeostasis. They play a part in iron transfer and enhanced oxidase activity. <br />
The role of copper homeostasis protein is still unknown, however some studies have established a link in intracellular trafficking of CuI. Copper-transporting P-type ATPase plays an essential role in copper balance as intestinal transport of copper in mammalian. Copper-sensing transcriptional repressor CsoR is involved in the cellular response in order to increase copper concentration inside bacterium. Copper resistance protein A precursor is a soluble protein which catalyzes oxidation of Cu and interact with membrane. Periplasmic copper-binding protein (NosD) is a periplasmic protein which can insert copper into reductase apoenzyme. Copper-exporting P-type ATPase A forms a homodimer at high copper concentration and export it in co-operation with copZ. <br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Mercuric</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
Concerning the Mercure, a gene named Mercuric reductase was found. It is known to catalyzes the two-electron reduction of mercuric ions to elemental mercury using NADPH as an electron donor . That shows that potentially our bacteria can in high mercury concentration be able to survive due to the creaction of NADPH which is an important metabolite. <br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Phenol </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
One of our project aim was to degrade phenol thank to <i>Pseudovivrio denitrificans</i>. However, many organisms are able to degrade phenol by their own, anaerobia or aerobe. (Khazi Mahammedilyas Basha, 2010) Before to transform our bacterium in this way we were looking for a biodegradation pathway.<br />
As <i> Pseudovibrio denitricans</i> is an anaerobic bacterium, we have focused on the anaerobic degradation pathway for phenol.<br />
<br />
<br />
</p><br><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/9e/Phenol4.png" style="width:25%;height:25%"/><br />
<p>Figure2 : <i>Anaerobic pathway degradation for phenol</i></p></div><p><br />
In order to determine if our bacterium degrade phenol we watched if it owns different enzymes in the phenol pathway degradation.<br />
For the first enzyme; 4-hydroxybenzoate decarboxylase we found 4 coding sequence with similarity; they have an enzymatic promiscuity. The second enzyme; p-hydroxy benzoate 3-monooxygenase from the phenol degradation pathway match perfectly with our bacterium.<br />
For Protocatechuate 3, 4 dioxygenase , we have found two coding sequences corresponding.<br />
The cycloisomerase coding sequence match perfectly in our bacterium. As the previous enzyme, enol - lactonase have matching too<br />
For the transferase enzyme, we have found two similar sequence leading to promiscuity enzymes. For the two last enzymes; they gave two different final product. One of them; thiolase have 4 similar sequences leading to promiscuity enzymes, though the second one; acyltransferase have 17 similar sequences leading to promiscuity enzymes.<br />
<br />
<br />
So, this analyze lead to think that<i> Pseudovibrio denetifricans</i> own the all anaerobic phenol degradation pathway. Hence, we have found all coding sequences correlate to enzyme from phenol degradation. And the bacterium may rather the acetyl-coA pathway than succenyle-coA because of the promiscuity enzyme quantity.<br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<h4>REFERENCE</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</html><br />
<br />
<br />
<br />
<br />
<br />
<br />
{{:Team:Evry/Template:HomeFooter}}</div>Chesne jhttp://2014.igem.org/Team:Evry/Biology/GenomeAssemblyTeam:Evry/Biology/GenomeAssembly2014-10-18T03:34:51Z<p>Chesne j: </p>
<hr />
<div>{{:Team:Evry/Template:HomeIncludes}}<br />
{{:Team:Evry/Template:Menu}}<br />
{{:Team:Evry/Template:genomeAssemblyTop}}<br />
<br />
<br />
<html><br />
<br />
<h1> De novo Genome assembly</h1><br />
<br><br><br />
<div align="justify"><br />
<p><br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<br />
<br />
<h4>Antibiotic resistance </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
Concerning the antibiotics, we look at specific antibiotics such as kanamycin, erythromycin, tetracycline, ampicillin, and chloramphenicol and other type of resistance gene. For the kanamycin and erythromycin, we found not relevant annotation. However, for the other ones, tetracycline, ampicillin, and chloramphenicol, we found specific annotations.<br />
<br><br />
Regarding the tetracycline, we found that it possessed one Tetracycline repressor protein class H , two Tetracycline resistance protein, class C and nine Bacterial regulatory proteins, tetR family annotated genes. This result are coincident with our experiment where we found that Pseudovibrio is resistant to tetracycline.<br />
<br><br />
About the ampicillin, one Metallo-beta-lactamase superfamily protein, Beta-lactamase, Beta-lactamase type II precursor, two Beta-lactamase precursor, Beta-lactamase hydrolase-like protein HTH-type transcriptional activator AmpR and five Putative beta-lactamase HcpC precursor were predicted by the Prokka software. Also this result is coincident with our experiment.<br />
<br />
<br><br />
For the Chloramphenicol antibioctics, we predicted that the chloramphenicol phosphotransferase-like protein, Chloramphenicol 3-O phosphotransferase and Chloramphenicol acetyltransferase are present in our strain. The last one is used as a reporter gene in molecular biology. But in contrary to other antibiotics, the test does not reveal, that our strain is resistant to the Chloramphenicol.<br />
<br><br />
Finally we look at other antibiotic resistance and we see that other antibiotics such as the Bleomycin are predicted. Bleomycin is used as a chemotherapy agents for the Hodgkin's lymphoma. Also it possessed the Multidrug resistance protein, MdtA, MdtA precursor, MdtB, MdtK, MdtN, MdtH, MdtG, which are known to play an important role in antibiotic resistance.<br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<h4>Restriction enzyme</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
During the transformation tests of our strain, we supposed that Pseudovibrio Denitrificans, was able to degrade DNA. Indeed all our electroporation attempts failed. They could not keep the plasmid inside them. One relevant research led us to the discovery of a Type I Restriction enzyme EcoKI. This site specific DNA methylase is not very common but can be found in a wide range of Gammaproteobacteria and so potentially into PseudoVibrio Denitrificans. We blasted the sequence of EcoRI gene with our bacteria genome, and we found that Pseudovibro have the gene.<br />
EcoKI recognises the sequence 5’ AAC(N)6GTGC-3’ and acts depending on the methylation state of the DNA substrate. It can be a methyltransferase or an endonuclease. Psb1c3, first plasmid that we tried to transform ( E.Coli Ori) does not have the target sequence of EcoRI. Otherwise, in one plasmid sent by Dr Thomas Drepper from Heinrich-Heine-Universität Düsseldorf, Institute of Molecular Enzyme Technology, Group of Bacterial Photobiotechnology, which was from a bacterium very closed with Pseudovibro and which we tried as well to transform, there is the target sequence of the enzyme. <br />
At this moment, Pseudovibro was not sequenced, so we could not find the localisation of the EcoKI gene. In order to integrate our constructions just in time, we opted for a transposon strategy.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/98/DNA1EvRY.jpg" style="width:50%;height:50%"/><p><br />
<i>Figure 1: Sequence of the pRhokHi vector and the hightlight of the EcoKI target sequence </i></p><br />
</div><br />
<br />
<br><br><br />
</div><br />
<h4> Nitrate/nitrite</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
Concerninrg the nitrate and nitrite a potential gene transporter NarK Nitrate/and Nitrite was predicte. Also we discovered the protein NapE was predict in the genome of Pseudovibrio Denitrificans. This enzyme is known to reduce nitrate to nitrite. Other some other genes such as Respiratory nitrate reductase 1 alpha and game chaine and other which are involve in the nitrification process. It possessed also Required for formate-dependent nitrite reduction. Not required for the biosynthesis of any of the c-type cytochromes nor for the secretion of the periplasmic cytochromes. They are involve in the reduction of nitrite to amoniac<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br> <br />
</div><br />
<h4>Cadmium</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
Concerning one of our compound target the cadmium, we were really surprised about it’s resistance to hight concentration. We found that the annotation reaveal two potentials genes for cadmium resistance. The putative cadmium-transporting ATPase involved in cadmium/zinc transport and also the Cobalt-zinc-cadmium resistance protein CzcB. CzcB has been asociated with a Gene ontology terms for Biological Process metal ion tranport and Molecular function metal ion transmembrane transporter activity. Other experiment need to be performed in order to be sure that the bacterium is resistant. A simple Northern Blot of the CzcB, mRNA will give a simple way to analyse the data and provide information of this enzyme<br />
<br />
<br />
</p><br />
</div><br />
<br><br> <br />
<h4>Copper </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
Copper is an essential heavy metal; chemical element. It plays a role in vital oxidation and reduction processes. Multicopper oxidase are enzymes able to oxidize substrate and are involved in copper homeostasis. They play a part in iron transfer and enhanced oxidase activity. <br />
The role of copper homeostasis protein is still unknown, however some studies have established a link in intracellular trafficking of CuI. Copper-transporting P-type ATPase plays an essential role in copper balance as intestinal transport of copper in mammalian. Copper-sensing transcriptional repressor CsoR is involved in the cellular response in order to increase copper concentration inside bacterium. Copper resistance protein A precursor is a soluble protein which catalyzes oxidation of Cu and interact with membrane. Periplasmic copper-binding protein (NosD) is a periplasmic protein which can insert copper into reductase apoenzyme. Copper-exporting P-type ATPase A forms a homodimer at high copper concentration and export it in co-operation with copZ. <br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Mercuric</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
Concerning the Mercure, a gene named Mercuric reductase was found. It is known to catalyzes the two-electron reduction of mercuric ions to elemental mercury using NADPH as an electron donor . That shows that potentially our bacteria can in high mercury concentration be able to survive due to the creaction of NADPH which is an important metabolite. <br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Phenol </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
One of our project aim was to degrade phenol thank to <i>Pseudovivrio denitrificans</i>. However, many organisms are able to degrade phenol by their own, anaerobia or aerobe. (Khazi Mahammedilyas Basha, 2010) Before to transform our bacterium in this way we were looking for a biodegradation pathway.<br />
As <i> Pseudovibrio denitricans</i> is an anaerobic bacterium, we have focused on the anaerobic degradation pathway for phenol.<br />
<br />
<br />
</p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/9e/Phenol4.png" style="width:30%;height:30%"/><br />
<p>Figure2 : <i>Anaerobic pathway degradation for phenol</i></p></div><p><br />
In order to determine if our bacterium degrade phenol we watched if it owns different enzymes in the phenol pathway degradation.<br />
For the first enzyme; 4-hydroxybenzoate decarboxylase we found 4 coding sequence with similarity; they have an enzymatic promiscuity. The second enzyme; p-hydroxy benzoate 3-monooxygenase from the phenol degradation pathway match perfectly with our bacterium.<br />
For Protocatechuate 3, 4 dioxygenase , we have found two coding sequences corresponding.<br />
The cycloisomerase coding sequence match perfectly in our bacterium. As the previous enzyme, enol - lactonase have matching too<br />
For the transferase enzyme, we have found two similar sequence leading to promiscuity enzymes. For the two last enzymes; they gave two different final product. One of them; thiolase have 4 similar sequences leading to promiscuity enzymes, though the second one; acyltransferase have 17 similar sequences leading to promiscuity enzymes.<br />
<br />
<br />
So, this analyze lead to think that<i> Pseudovibrio denetifricans</i> own the all anaerobic phenol degradation pathway. Hence, we have found all coding sequences correlate to enzyme from phenol degradation. And the bacterium may rather the acetyl-coA pathway than succenyle-coA because of the promiscuity enzyme quantity.<br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<h4>REFERENCE</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</html><br />
<br />
<br />
<br />
<br />
<br />
<br />
{{:Team:Evry/Template:HomeFooter}}</div>Chesne jhttp://2014.igem.org/Team:Evry/Biology/GenomeAssemblyTeam:Evry/Biology/GenomeAssembly2014-10-18T03:33:51Z<p>Chesne j: </p>
<hr />
<div>{{:Team:Evry/Template:HomeIncludes}}<br />
{{:Team:Evry/Template:Menu}}<br />
{{:Team:Evry/Template:genomeAssemblyTop}}<br />
<br />
<br />
<html><br />
<br />
<h1> De novo Genome assembly</h1><br />
<br><br><br />
<div align="justify"><br />
<p><br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<br />
<br />
<h4>Antibiotic resistance </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
Concerning the antibiotics, we look at specific antibiotics such as kanamycin, erythromycin, tetracycline, ampicillin, and chloramphenicol and other type of resistance gene. For the kanamycin and erythromycin, we found not relevant annotation. However, for the other ones, tetracycline, ampicillin, and chloramphenicol, we found specific annotations.<br />
<br><br />
Regarding the tetracycline, we found that it possessed one Tetracycline repressor protein class H , two Tetracycline resistance protein, class C and nine Bacterial regulatory proteins, tetR family annotated genes. This result are coincident with our experiment where we found that Pseudovibrio is resistant to tetracycline.<br />
<br><br />
About the ampicillin, one Metallo-beta-lactamase superfamily protein, Beta-lactamase, Beta-lactamase type II precursor, two Beta-lactamase precursor, Beta-lactamase hydrolase-like protein HTH-type transcriptional activator AmpR and five Putative beta-lactamase HcpC precursor were predicted by the Prokka software. Also this result is coincident with our experiment.<br />
<br />
<br><br />
For the Chloramphenicol antibioctics, we predicted that the chloramphenicol phosphotransferase-like protein, Chloramphenicol 3-O phosphotransferase and Chloramphenicol acetyltransferase are present in our strain. The last one is used as a reporter gene in molecular biology. But in contrary to other antibiotics, the test does not reveal, that our strain is resistant to the Chloramphenicol.<br />
<br><br />
Finally we look at other antibiotic resistance and we see that other antibiotics such as the Bleomycin are predicted. Bleomycin is used as a chemotherapy agents for the Hodgkin's lymphoma. Also it possessed the Multidrug resistance protein, MdtA, MdtA precursor, MdtB, MdtK, MdtN, MdtH, MdtG, which are known to play an important role in antibiotic resistance.<br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<h4>Restriction enzyme</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
During the transformation tests of our strain, we supposed that Pseudovibrio Denitrificans, was able to degrade DNA. Indeed all our electroporation attempts failed. They could not keep the plasmid inside them. One relevant research led us to the discovery of a Type I Restriction enzyme EcoKI. This site specific DNA methylase is not very common but can be found in a wide range of Gammaproteobacteria and so potentially into PseudoVibrio Denitrificans. We blasted the sequence of EcoRI gene with our bacteria genome, and we found that Pseudovibro have the gene.<br />
EcoKI recognises the sequence 5’ AAC(N)6GTGC-3’ and acts depending on the methylation state of the DNA substrate. It can be a methyltransferase or an endonuclease. Psb1c3, first plasmid that we tried to transform ( E.Coli Ori) does not have the target sequence of EcoRI. Otherwise, in one plasmid sent by Dr Thomas Drepper from Heinrich-Heine-Universität Düsseldorf, Institute of Molecular Enzyme Technology, Group of Bacterial Photobiotechnology, which was from a bacterium very closed with Pseudovibro and which we tried as well to transform, there is the target sequence of the enzyme. <br />
At this moment, Pseudovibro was not sequenced, so we could not find the localisation of the EcoKI gene. In order to integrate our constructions just in time, we opted for a transposon strategy.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/98/DNA1EvRY.jpg" style="width:50%;height:50%"/><p><br />
<i>Figure 1: Sequence of the pRhokHi vector and the hightlight of the EcoKI target sequence </i></p><br />
</div><br />
<br />
<br><br><br />
</div><br />
<h4> Nitrate/nitrite</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
Concerninrg the nitrate and nitrite a potential gene transporter NarK Nitrate/and Nitrite was predicte. Also we discovered the protein NapE was predict in the genome of Pseudovibrio Denitrificans. This enzyme is known to reduce nitrate to nitrite. Other some other genes such as Respiratory nitrate reductase 1 alpha and game chaine and other which are involve in the nitrification process. It possessed also Required for formate-dependent nitrite reduction. Not required for the biosynthesis of any of the c-type cytochromes nor for the secretion of the periplasmic cytochromes. They are involve in the reduction of nitrite to amoniac<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br> <br />
</div><br />
<h4>Cadmium</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
Concerning one of our compound target the cadmium, we were really surprised about it’s resistance to hight concentration. We found that the annotation reaveal two potentials genes for cadmium resistance. The putative cadmium-transporting ATPase involved in cadmium/zinc transport and also the Cobalt-zinc-cadmium resistance protein CzcB. CzcB has been asociated with a Gene ontology terms for Biological Process metal ion tranport and Molecular function metal ion transmembrane transporter activity. Other experiment need to be performed in order to be sure that the bacterium is resistant. A simple Northern Blot of the CzcB, mRNA will give a simple way to analyse the data and provide information of this enzyme<br />
<br />
<br />
</p><br />
</div><br />
<br><br> <br />
<h4>Copper </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
Copper is an essential heavy metal; chemical element. It plays a role in vital oxidation and reduction processes. Multicopper oxidase are enzymes able to oxidize substrate and are involved in copper homeostasis. They play a part in iron transfer and enhanced oxidase activity. <br />
The role of copper homeostasis protein is still unknown, however some studies have established a link in intracellular trafficking of CuI. Copper-transporting P-type ATPase plays an essential role in copper balance as intestinal transport of copper in mammalian. Copper-sensing transcriptional repressor CsoR is involved in the cellular response in order to increase copper concentration inside bacterium. Copper resistance protein A precursor is a soluble protein which catalyzes oxidation of Cu and interact with membrane. Periplasmic copper-binding protein (NosD) is a periplasmic protein which can insert copper into reductase apoenzyme. Copper-exporting P-type ATPase A forms a homodimer at high copper concentration and export it in co-operation with copZ. <br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Mercuric</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
Concerning the Mercure, a gene named Mercuric reductase was found. It is known to catalyzes the two-electron reduction of mercuric ions to elemental mercury using NADPH as an electron donor . That shows that potentially our bacteria can in high mercury concentration be able to survive due to the creaction of NADPH which is an important metabolite. <br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Phenol </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/9e/Phenol4.png" style="width:30%;height:30%"/><br />
<p>Figure2 : <i>Anaerobic pathway degradation for phenol</i></p></div><p><br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<h4>REFERENCE</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</html><br />
<br />
<br />
<br />
<br />
<br />
<br />
{{:Team:Evry/Template:HomeFooter}}</div>Chesne jhttp://2014.igem.org/Team:Evry/Biology/GenomeAssemblyTeam:Evry/Biology/GenomeAssembly2014-10-18T03:33:28Z<p>Chesne j: </p>
<hr />
<div>{{:Team:Evry/Template:HomeIncludes}}<br />
{{:Team:Evry/Template:Menu}}<br />
{{:Team:Evry/Template:genomeAssemblyTop}}<br />
<br />
<br />
<html><br />
<br />
<h1> De novo Genome assembly</h1><br />
<br><br><br />
<div align="justify"><br />
<p><br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<br />
<br />
<h4>Antibiotic resistance </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
Concerning the antibiotics, we look at specific antibiotics such as kanamycin, erythromycin, tetracycline, ampicillin, and chloramphenicol and other type of resistance gene. For the kanamycin and erythromycin, we found not relevant annotation. However, for the other ones, tetracycline, ampicillin, and chloramphenicol, we found specific annotations.<br />
<br><br />
Regarding the tetracycline, we found that it possessed one Tetracycline repressor protein class H , two Tetracycline resistance protein, class C and nine Bacterial regulatory proteins, tetR family annotated genes. This result are coincident with our experiment where we found that Pseudovibrio is resistant to tetracycline.<br />
<br><br />
About the ampicillin, one Metallo-beta-lactamase superfamily protein, Beta-lactamase, Beta-lactamase type II precursor, two Beta-lactamase precursor, Beta-lactamase hydrolase-like protein HTH-type transcriptional activator AmpR and five Putative beta-lactamase HcpC precursor were predicted by the Prokka software. Also this result is coincident with our experiment.<br />
<br />
<br><br />
For the Chloramphenicol antibioctics, we predicted that the chloramphenicol phosphotransferase-like protein, Chloramphenicol 3-O phosphotransferase and Chloramphenicol acetyltransferase are present in our strain. The last one is used as a reporter gene in molecular biology. But in contrary to other antibiotics, the test does not reveal, that our strain is resistant to the Chloramphenicol.<br />
<br><br />
Finally we look at other antibiotic resistance and we see that other antibiotics such as the Bleomycin are predicted. Bleomycin is used as a chemotherapy agents for the Hodgkin's lymphoma. Also it possessed the Multidrug resistance protein, MdtA, MdtA precursor, MdtB, MdtK, MdtN, MdtH, MdtG, which are known to play an important role in antibiotic resistance.<br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<h4>Restriction enzyme</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
During the transformation tests of our strain, we supposed that Pseudovibrio Denitrificans, was able to degrade DNA. Indeed all our electroporation attempts failed. They could not keep the plasmid inside them. One relevant research led us to the discovery of a Type I Restriction enzyme EcoKI. This site specific DNA methylase is not very common but can be found in a wide range of Gammaproteobacteria and so potentially into PseudoVibrio Denitrificans. We blasted the sequence of EcoRI gene with our bacteria genome, and we found that Pseudovibro have the gene.<br />
EcoKI recognises the sequence 5’ AAC(N)6GTGC-3’ and acts depending on the methylation state of the DNA substrate. It can be a methyltransferase or an endonuclease. Psb1c3, first plasmid that we tried to transform ( E.Coli Ori) does not have the target sequence of EcoRI. Otherwise, in one plasmid sent by Dr Thomas Drepper from Heinrich-Heine-Universität Düsseldorf, Institute of Molecular Enzyme Technology, Group of Bacterial Photobiotechnology, which was from a bacterium very closed with Pseudovibro and which we tried as well to transform, there is the target sequence of the enzyme. <br />
At this moment, Pseudovibro was not sequenced, so we could not find the localisation of the EcoKI gene. In order to integrate our constructions just in time, we opted for a transposon strategy.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/98/DNA1EvRY.jpg" style="width:50%;height:50%"/><p><br />
<i>Figure 1: Sequence of the pRhokHi vector and the hightlight of the EcoKI target sequence </i></p><br />
</div><br />
<br />
<br><br><br />
</div><br />
<h4> Nitrate/nitrite</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
Concerninrg the nitrate and nitrite a potential gene transporter NarK Nitrate/and Nitrite was predicte. Also we discovered the protein NapE was predict in the genome of Pseudovibrio Denitrificans. This enzyme is known to reduce nitrate to nitrite. Other some other genes such as Respiratory nitrate reductase 1 alpha and game chaine and other which are involve in the nitrification process. It possessed also Required for formate-dependent nitrite reduction. Not required for the biosynthesis of any of the c-type cytochromes nor for the secretion of the periplasmic cytochromes. They are involve in the reduction of nitrite to amoniac<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br> <br />
</div><br />
<h4>Cadmium</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
Concerning one of our compound target the cadmium, we were really surprised about it’s resistance to hight concentration. We found that the annotation reaveal two potentials genes for cadmium resistance. The putative cadmium-transporting ATPase involved in cadmium/zinc transport and also the Cobalt-zinc-cadmium resistance protein CzcB. CzcB has been asociated with a Gene ontology terms for Biological Process metal ion tranport and Molecular function metal ion transmembrane transporter activity. Other experiment need to be performed in order to be sure that the bacterium is resistant. A simple Northern Blot of the CzcB, mRNA will give a simple way to analyse the data and provide information of this enzyme<br />
<br />
<br />
</p><br />
</div><br />
<br><br> <br />
<h4>Copper </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
Copper is an essential heavy metal; chemical element. It plays a role in vital oxidation and reduction processes. Multicopper oxidase are enzymes able to oxidize substrate and are involved in copper homeostasis. They play a part in iron transfer and enhanced oxidase activity. <br />
The role of copper homeostasis protein is still unknown, however some studies have established a link in intracellular trafficking of CuI. Copper-transporting P-type ATPase plays an essential role in copper balance as intestinal transport of copper in mammalian. Copper-sensing transcriptional repressor CsoR is involved in the cellular response in order to increase copper concentration inside bacterium. Copper resistance protein A precursor is a soluble protein which catalyzes oxidation of Cu and interact with membrane. Periplasmic copper-binding protein (NosD) is a periplasmic protein which can insert copper into reductase apoenzyme. Copper-exporting P-type ATPase A forms a homodimer at high copper concentration and export it in co-operation with copZ. <br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Mercuric</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Phenol </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/9e/Phenol4.png" style="width:30%;height:30%"/><br />
<p>Figure2 : <i>Anaerobic pathway degradation for phenol</i></p></div><p><br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<h4>REFERENCE</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</html><br />
<br />
<br />
<br />
<br />
<br />
<br />
{{:Team:Evry/Template:HomeFooter}}</div>Chesne jhttp://2014.igem.org/Team:Evry/Biology/GenomeAssemblyTeam:Evry/Biology/GenomeAssembly2014-10-18T03:33:02Z<p>Chesne j: </p>
<hr />
<div>{{:Team:Evry/Template:HomeIncludes}}<br />
{{:Team:Evry/Template:Menu}}<br />
{{:Team:Evry/Template:genomeAssemblyTop}}<br />
<br />
<br />
<html><br />
<br />
<h1> De novo Genome assembly</h1><br />
<br><br><br />
<div align="justify"><br />
<p><br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<br />
<br />
<h4>Antibiotic resistance </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
Concerning the antibiotics, we look at specific antibiotics such as kanamycin, erythromycin, tetracycline, ampicillin, and chloramphenicol and other type of resistance gene. For the kanamycin and erythromycin, we found not relevant annotation. However, for the other ones, tetracycline, ampicillin, and chloramphenicol, we found specific annotations.<br />
<br><br />
Regarding the tetracycline, we found that it possessed one Tetracycline repressor protein class H , two Tetracycline resistance protein, class C and nine Bacterial regulatory proteins, tetR family annotated genes. This result are coincident with our experiment where we found that Pseudovibrio is resistant to tetracycline.<br />
<br><br />
About the ampicillin, one Metallo-beta-lactamase superfamily protein, Beta-lactamase, Beta-lactamase type II precursor, two Beta-lactamase precursor, Beta-lactamase hydrolase-like protein HTH-type transcriptional activator AmpR and five Putative beta-lactamase HcpC precursor were predicted by the Prokka software. Also this result is coincident with our experiment.<br />
<br />
<br><br />
For the Chloramphenicol antibioctics, we predicted that the chloramphenicol phosphotransferase-like protein, Chloramphenicol 3-O phosphotransferase and Chloramphenicol acetyltransferase are present in our strain. The last one is used as a reporter gene in molecular biology. But in contrary to other antibiotics, the test does not reveal, that our strain is resistant to the Chloramphenicol.<br />
<br><br />
Finally we look at other antibiotic resistance and we see that other antibiotics such as the Bleomycin are predicted. Bleomycin is used as a chemotherapy agents for the Hodgkin's lymphoma. Also it possessed the Multidrug resistance protein, MdtA, MdtA precursor, MdtB, MdtK, MdtN, MdtH, MdtG, which are known to play an important role in antibiotic resistance.<br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<h4>Restriction enzyme</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
During the transformation tests of our strain, we supposed that Pseudovibrio Denitrificans, was able to degrade DNA. Indeed all our electroporation attempts failed. They could not keep the plasmid inside them. One relevant research led us to the discovery of a Type I Restriction enzyme EcoKI. This site specific DNA methylase is not very common but can be found in a wide range of Gammaproteobacteria and so potentially into PseudoVibrio Denitrificans. We blasted the sequence of EcoRI gene with our bacteria genome, and we found that Pseudovibro have the gene.<br />
EcoKI recognises the sequence 5’ AAC(N)6GTGC-3’ and acts depending on the methylation state of the DNA substrate. It can be a methyltransferase or an endonuclease. Psb1c3, first plasmid that we tried to transform ( E.Coli Ori) does not have the target sequence of EcoRI. Otherwise, in one plasmid sent by Dr Thomas Drepper from Heinrich-Heine-Universität Düsseldorf, Institute of Molecular Enzyme Technology, Group of Bacterial Photobiotechnology, which was from a bacterium very closed with Pseudovibro and which we tried as well to transform, there is the target sequence of the enzyme. <br />
At this moment, Pseudovibro was not sequenced, so we could not find the localisation of the EcoKI gene. In order to integrate our constructions just in time, we opted for a transposon strategy.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/98/DNA1EvRY.jpg" style="width:50%;height:50%"/><p><br />
<i>Figure 1: Sequence of the pRhokHi vector and the hightlight of the EcoKI target sequence </i></p><br />
</div><br />
<br />
<br><br><br />
</div><br />
<h4> Nitrate/nitrite</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
Concerninrg the nitrate and nitrite a potential gene transporter NarK Nitrate/and Nitrite was predicte. Also we discovered the protein NapE was predict in the genome of Pseudovibrio Denitrificans. This enzyme is known to reduce nitrate to nitrite. Other some other genes such as Respiratory nitrate reductase 1 alpha and game chaine and other which are involve in the nitrification process. It possessed also Required for formate-dependent nitrite reduction. Not required for the biosynthesis of any of the c-type cytochromes nor for the secretion of the periplasmic cytochromes. They are involve in the reduction of nitrite to amoniac<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br> <br />
</div><br />
<h4>Cadmium</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
Concerning one of our compound target the cadmium, we were really surprised about it’s resistance to hight concentration. We found that the annotation reaveal two potentials genes for cadmium resistance. The putative cadmium-transporting ATPase involved in cadmium/zinc transport and also the Cobalt-zinc-cadmium resistance protein CzcB. CzcB has been asociated with a Gene ontology terms for Biological Process metal ion tranport and Molecular function metal ion transmembrane transporter activity. Other experiment need to be performed in order to be sure that the bacterium is resistant. A simple Northern Blot of the CzcB, mRNA will give a simple way to analyse the data and provide information of this enzyme<br />
<br />
<br />
</p><br />
</div><br />
<br><br> <br />
<h4>Copper </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Mercuric</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Phenol </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/9e/Phenol4.png" style="width:30%;height:30%"/><br />
<p>Figure2 : <i>Anaerobic pathway degradation for phenol</i></p></div><p><br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<h4>REFERENCE</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</html><br />
<br />
<br />
<br />
<br />
<br />
<br />
{{:Team:Evry/Template:HomeFooter}}</div>Chesne jhttp://2014.igem.org/Team:Evry/Biology/GenomeAssemblyTeam:Evry/Biology/GenomeAssembly2014-10-18T03:32:43Z<p>Chesne j: </p>
<hr />
<div>{{:Team:Evry/Template:HomeIncludes}}<br />
{{:Team:Evry/Template:Menu}}<br />
{{:Team:Evry/Template:genomeAssemblyTop}}<br />
<br />
<br />
<html><br />
<br />
<h1> De novo Genome assembly</h1><br />
<br><br><br />
<div align="justify"><br />
<p><br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<br />
<br />
<h4>Antibiotic resistance </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
Concerning the antibiotics, we look at specific antibiotics such as kanamycin, erythromycin, tetracycline, ampicillin, and chloramphenicol and other type of resistance gene. For the kanamycin and erythromycin, we found not relevant annotation. However, for the other ones, tetracycline, ampicillin, and chloramphenicol, we found specific annotations.<br />
<br><br />
Regarding the tetracycline, we found that it possessed one Tetracycline repressor protein class H , two Tetracycline resistance protein, class C and nine Bacterial regulatory proteins, tetR family annotated genes. This result are coincident with our experiment where we found that Pseudovibrio is resistant to tetracycline.<br />
<br><br />
About the ampicillin, one Metallo-beta-lactamase superfamily protein, Beta-lactamase, Beta-lactamase type II precursor, two Beta-lactamase precursor, Beta-lactamase hydrolase-like protein HTH-type transcriptional activator AmpR and five Putative beta-lactamase HcpC precursor were predicted by the Prokka software. Also this result is coincident with our experiment.<br />
<br />
<br><br />
For the Chloramphenicol antibioctics, we predicted that the chloramphenicol phosphotransferase-like protein, Chloramphenicol 3-O phosphotransferase and Chloramphenicol acetyltransferase are present in our strain. The last one is used as a reporter gene in molecular biology. But in contrary to other antibiotics, the test does not reveal, that our strain is resistant to the Chloramphenicol.<br />
<br><br />
Finally we look at other antibiotic resistance and we see that other antibiotics such as the Bleomycin are predicted. Bleomycin is used as a chemotherapy agents for the Hodgkin's lymphoma. Also it possessed the Multidrug resistance protein, MdtA, MdtA precursor, MdtB, MdtK, MdtN, MdtH, MdtG, which are known to play an important role in antibiotic resistance.<br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<h4>Restriction enzyme</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
During the transformation tests of our strain, we supposed that Pseudovibrio Denitrificans, was able to degrade DNA. Indeed all our electroporation attempts failed. They could not keep the plasmid inside them. One relevant research led us to the discovery of a Type I Restriction enzyme EcoKI. This site specific DNA methylase is not very common but can be found in a wide range of Gammaproteobacteria and so potentially into PseudoVibrio Denitrificans. We blasted the sequence of EcoRI gene with our bacteria genome, and we found that Pseudovibro have the gene.<br />
EcoKI recognises the sequence 5’ AAC(N)6GTGC-3’ and acts depending on the methylation state of the DNA substrate. It can be a methyltransferase or an endonuclease. Psb1c3, first plasmid that we tried to transform ( E.Coli Ori) does not have the target sequence of EcoRI. Otherwise, in one plasmid sent by Dr Thomas Drepper from Heinrich-Heine-Universität Düsseldorf, Institute of Molecular Enzyme Technology, Group of Bacterial Photobiotechnology, which was from a bacterium very closed with Pseudovibro and which we tried as well to transform, there is the target sequence of the enzyme. <br />
At this moment, Pseudovibro was not sequenced, so we could not find the localisation of the EcoKI gene. In order to integrate our constructions just in time, we opted for a transposon strategy.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/98/DNA1EvRY.jpg" style="width:50%;height:50%"/><p><br />
<i>Figure 1: Sequence of the pRhokHi vector and the hightlight of the EcoKI target sequence </i></p><br />
</div><br />
<br />
<br><br><br />
</div><br />
<h4> Nitrate/nitrite</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
Concerninrg the nitrate and nitrite a potential gene transporter NarK Nitrate/and Nitrite was predicte. Also we discovered the protein NapE was predict in the genome of Pseudovibrio Denitrificans. This enzyme is known to reduce nitrate to nitrite. Other some other genes such as Respiratory nitrate reductase 1 alpha and game chaine and other which are involve in the nitrification process. It possessed also Required for formate-dependent nitrite reduction. Not required for the biosynthesis of any of the c-type cytochromes nor for the secretion of the periplasmic cytochromes. They are involve in the reduction of nitrite to amoniac<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br> <br />
</div><br />
<h4>Cadmium</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
</div><br />
<br><br> <br />
<h4>Copper </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Mercuric</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Phenol </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/9e/Phenol4.png" style="width:30%;height:30%"/><br />
<p>Figure2 : <i>Anaerobic pathway degradation for phenol</i></p></div><p><br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<h4>REFERENCE</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</html><br />
<br />
<br />
<br />
<br />
<br />
<br />
{{:Team:Evry/Template:HomeFooter}}</div>Chesne jhttp://2014.igem.org/Team:Evry/Biology/GenomeAssemblyTeam:Evry/Biology/GenomeAssembly2014-10-18T03:32:24Z<p>Chesne j: </p>
<hr />
<div>{{:Team:Evry/Template:HomeIncludes}}<br />
{{:Team:Evry/Template:Menu}}<br />
{{:Team:Evry/Template:genomeAssemblyTop}}<br />
<br />
<br />
<html><br />
<br />
<h1> De novo Genome assembly</h1><br />
<br><br><br />
<div align="justify"><br />
<p><br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<br />
<br />
<h4>Antibiotic resistance </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
Concerning the antibiotics, we look at specific antibiotics such as kanamycin, erythromycin, tetracycline, ampicillin, and chloramphenicol and other type of resistance gene. For the kanamycin and erythromycin, we found not relevant annotation. However, for the other ones, tetracycline, ampicillin, and chloramphenicol, we found specific annotations.<br />
<br><br />
Regarding the tetracycline, we found that it possessed one Tetracycline repressor protein class H , two Tetracycline resistance protein, class C and nine Bacterial regulatory proteins, tetR family annotated genes. This result are coincident with our experiment where we found that Pseudovibrio is resistant to tetracycline.<br />
<br><br />
About the ampicillin, one Metallo-beta-lactamase superfamily protein, Beta-lactamase, Beta-lactamase type II precursor, two Beta-lactamase precursor, Beta-lactamase hydrolase-like protein HTH-type transcriptional activator AmpR and five Putative beta-lactamase HcpC precursor were predicted by the Prokka software. Also this result is coincident with our experiment.<br />
<br />
<br><br />
For the Chloramphenicol antibioctics, we predicted that the chloramphenicol phosphotransferase-like protein, Chloramphenicol 3-O phosphotransferase and Chloramphenicol acetyltransferase are present in our strain. The last one is used as a reporter gene in molecular biology. But in contrary to other antibiotics, the test does not reveal, that our strain is resistant to the Chloramphenicol.<br />
<br><br />
Finally we look at other antibiotic resistance and we see that other antibiotics such as the Bleomycin are predicted. Bleomycin is used as a chemotherapy agents for the Hodgkin's lymphoma. Also it possessed the Multidrug resistance protein, MdtA, MdtA precursor, MdtB, MdtK, MdtN, MdtH, MdtG, which are known to play an important role in antibiotic resistance.<br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<h4>Restriction enzyme</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
During the transformation tests of our strain, we supposed that Pseudovibrio Denitrificans, was able to degrade DNA. Indeed all our electroporation attempts failed. They could not keep the plasmid inside them. One relevant research led us to the discovery of a Type I Restriction enzyme EcoKI. This site specific DNA methylase is not very common but can be found in a wide range of Gammaproteobacteria and so potentially into PseudoVibrio Denitrificans. We blasted the sequence of EcoRI gene with our bacteria genome, and we found that Pseudovibro have the gene.<br />
EcoKI recognises the sequence 5’ AAC(N)6GTGC-3’ and acts depending on the methylation state of the DNA substrate. It can be a methyltransferase or an endonuclease. Psb1c3, first plasmid that we tried to transform ( E.Coli Ori) does not have the target sequence of EcoRI. Otherwise, in one plasmid sent by Dr Thomas Drepper from Heinrich-Heine-Universität Düsseldorf, Institute of Molecular Enzyme Technology, Group of Bacterial Photobiotechnology, which was from a bacterium very closed with Pseudovibro and which we tried as well to transform, there is the target sequence of the enzyme. <br />
At this moment, Pseudovibro was not sequenced, so we could not find the localisation of the EcoKI gene. In order to integrate our constructions just in time, we opted for a transposon strategy.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/98/DNA1EvRY.jpg" style="width:50%;height:50%"/><p><br />
<i>Figure 1: Sequence of the pRhokHi vector and the hightlight of the EcoKI target sequence </i></p><br />
</div><br />
<br />
<br><br><br />
</div><br />
<h4> Nitrate/nitrite</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
</p><br />
<br><br> <br />
</div><br />
<h4>Cadmium</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
</div><br />
<br><br> <br />
<h4>Copper </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Mercuric</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Phenol </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/9e/Phenol4.png" style="width:30%;height:30%"/><br />
<p>Figure2 : <i>Anaerobic pathway degradation for phenol</i></p></div><p><br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<h4>REFERENCE</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</html><br />
<br />
<br />
<br />
<br />
<br />
<br />
{{:Team:Evry/Template:HomeFooter}}</div>Chesne jhttp://2014.igem.org/Team:Evry/Biology/GenomeAssemblyTeam:Evry/Biology/GenomeAssembly2014-10-18T03:31:35Z<p>Chesne j: </p>
<hr />
<div>{{:Team:Evry/Template:HomeIncludes}}<br />
{{:Team:Evry/Template:Menu}}<br />
{{:Team:Evry/Template:genomeAssemblyTop}}<br />
<br />
<br />
<html><br />
<br />
<h1> De novo Genome assembly</h1><br />
<br><br><br />
<div align="justify"><br />
<p><br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<br />
<br />
<h4>Antibiotic resistance </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
Concerning the antibiotics, we look at specific antibiotics such as kanamycin, erythromycin, tetracycline, ampicillin, and chloramphenicol and other type of resistance gene. For the kanamycin and erythromycin, we found not relevant annotation. However, for the other ones, tetracycline, ampicillin, and chloramphenicol, we found specific annotations.<br />
<br><br />
Regarding the tetracycline, we found that it possessed one Tetracycline repressor protein class H , two Tetracycline resistance protein, class C and nine Bacterial regulatory proteins, tetR family annotated genes. This result are coincident with our experiment where we found that Pseudovibrio is resistant to tetracycline.<br />
<br><br />
About the ampicillin, one Metallo-beta-lactamase superfamily protein, Beta-lactamase, Beta-lactamase type II precursor, two Beta-lactamase precursor, Beta-lactamase hydrolase-like protein HTH-type transcriptional activator AmpR and five Putative beta-lactamase HcpC precursor were predicted by the Prokka software. Also this result is coincident with our experiment.<br />
<br />
<br><br />
For the Chloramphenicol antibioctics, we predicted that the chloramphenicol phosphotransferase-like protein, Chloramphenicol 3-O phosphotransferase and Chloramphenicol acetyltransferase are present in our strain. The last one is used as a reporter gene in molecular biology. But in contrary to other antibiotics, the test does not reveal, that our strain is resistant to the Chloramphenicol.<br />
<br><br />
Finally we look at other antibiotic resistance and we see that other antibiotics such as the Bleomycin are predicted. Bleomycin is used as a chemotherapy agents for the Hodgkin's lymphoma. Also it possessed the Multidrug resistance protein, MdtA, MdtA precursor, MdtB, MdtK, MdtN, MdtH, MdtG, which are known to play an important role in antibiotic resistance.<br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<h4>Restriction enzyme</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/98/DNA1EvRY.jpg" style="width:50%;height:50%"/><p><br />
<i>Figure 1: Sequence of the pRhokHi vector and the hightlight of the EcoKI target sequence </i></p><br />
</div><br />
<br />
<br><br><br />
</div><br />
<h4> Nitrate/nitrite</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
</p><br />
<br><br> <br />
</div><br />
<h4>Cadmium</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
</div><br />
<br><br> <br />
<h4>Copper </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Mercuric</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Phenol </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/9e/Phenol4.png" style="width:30%;height:30%"/><br />
<p>Figure2 : <i>Anaerobic pathway degradation for phenol</i></p></div><p><br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<h4>REFERENCE</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</html><br />
<br />
<br />
<br />
<br />
<br />
<br />
{{:Team:Evry/Template:HomeFooter}}</div>Chesne jhttp://2014.igem.org/Team:Evry/Biology/GenomeAssemblyTeam:Evry/Biology/GenomeAssembly2014-10-18T03:30:20Z<p>Chesne j: </p>
<hr />
<div>{{:Team:Evry/Template:HomeIncludes}}<br />
{{:Team:Evry/Template:Menu}}<br />
{{:Team:Evry/Template:genomeAssemblyTop}}<br />
<br />
<br />
<html><br />
<br />
<h1> De novo Genome assembly</h1><br />
<br><br><br />
<div align="justify"><br />
<p><br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<br />
<br />
<h4>Antibiotic resistance </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<h4>Restriction enzyme</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/98/DNA1EvRY.jpg" style="width:50%;height:50%"/><p><br />
<i>Figure 1: Sequence of the pRhokHi vector and the hightlight of the EcoKI target sequence </i></p><br />
</div><br />
<br />
<br><br><br />
</div><br />
<h4> Nitrate/nitrite</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
</p><br />
<br><br> <br />
</div><br />
<h4>Cadmium</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
</div><br />
<br><br> <br />
<h4>Copper </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Mercuric</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Phenol </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/9e/Phenol4.png" style="width:30%;height:30%"/><br />
<p>Figure2 : <i>Anaerobic pathway degradation for phenol</i></p></div><p><br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<h4>REFERENCE</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</html><br />
<br />
<br />
<br />
<br />
<br />
<br />
{{:Team:Evry/Template:HomeFooter}}</div>Chesne jhttp://2014.igem.org/Team:Evry/Biology/GenomeAssemblyTeam:Evry/Biology/GenomeAssembly2014-10-18T03:27:46Z<p>Chesne j: </p>
<hr />
<div>{{:Team:Evry/Template:HomeIncludes}}<br />
{{:Team:Evry/Template:Menu}}<br />
{{:Team:Evry/Template:genomeAssemblyTop}}<br />
<br />
<br />
<html><br />
<br />
<h1> De novo Genome assembly</h1><br />
<br><br><br />
<p><br />
<br />
<br />
</p><br />
<br />
<br><br><br />
<h3> Assembly Strategy</h3><br />
<br><br><br />
<div align="justify"><br />
<p><br />
In order to perform the genome assembly of our bacteria we choose to used the velvet software. We choose 4 kmer size. For the first one at 31 we obtained 1493 contigs. for a kmer size of 65, 413 contigs are obtain. For the two last kmer tested, 97 and 113 we obtained 275 and 245 contigs.The prokka software is an automated tools for genome annotation. The run take less than ten minutes, as they was proposed on their articles.In order to control the quality of our DNA seq we choose to made first a Proteome comparisons with Pseudovibrio FOBEG1 which is our reference strain. For that purpose we decided to look at our first genome version contains 275 contigs which was provide by the Velvet de novo assembly tools. For the 5456 proteins of Pseudovibrio FO-BEG1 5132 proteins (which are our reference strain) are match with a prokka anotation CDS.<br />
5002 with a unique alignment 4936, 4687 with an alignement > 90%, 4415 > 95% and 2525 > 99%. For that purpose we are sure that we sequence a strain related to the Pseudovibrio genus.<br />
<br />
After this proteome comparison, we try to improved our genome assembly by improved the kmer size and we see that the contigs numbers was reduced to 245. In order to analyse the annotation and the quality of our genome annotation we look at 4 main specific annotation type such as antibiotic resitance, restriction enzyme, metals such as cadmium, copper and mercury, and other toxic compound such as phenol, nitrate, nitrite.<br />
<br />
</p><br />
</div><br />
<br><br><br />
<br />
<h4>Antibiotic resistance </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<h4>Restriction enzyme</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/98/DNA1EvRY.jpg" style="width:50%;height:50%"/><p><br />
<i>Figure 1: Sequence of the pRhokHi vector and the hightlight of the EcoKI target sequence </i></p><br />
</div><br />
<br />
<br><br><br />
</div><br />
<h4> Nitrate/nitrite</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
</p><br />
<br><br> <br />
</div><br />
<h4>Cadmium</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
</div><br />
<br><br> <br />
<h4>Copper </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Mercuric</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Phenol </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/9e/Phenol4.png" style="width:30%;height:30%"/><br />
<p>Figure2 : <i>Anaerobic pathway degradation for phenol</i></p></div><p><br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<h4>REFERENCE</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</html><br />
<br />
<br />
<br />
<br />
<br />
<br />
{{:Team:Evry/Template:HomeFooter}}</div>Chesne jhttp://2014.igem.org/Team:Evry/Biology/GenomeAssemblyTeam:Evry/Biology/GenomeAssembly2014-10-18T03:27:06Z<p>Chesne j: </p>
<hr />
<div>{{:Team:Evry/Template:HomeIncludes}}<br />
{{:Team:Evry/Template:Menu}}<br />
{{:Team:Evry/Template:genomeAssemblyTop}}<br />
<br />
<br />
<html><br />
<br />
<h1> De novo Genome assembly</h1><br />
<br><br><br />
<p><br />
<br />
<br />
</p><br />
<br />
<br><br><br />
<h3> Assembly Strategy</h3><br />
<br><br><br />
<div align="justify"><br />
<p><br />
In order to perform the genome assembly of our bacteria we choose to used the velvet software. We choose 4 kmer size. For the first one at 31 we obtained 1493 contigs. for a kmer size of 65, 413 contigs are obtain. For the two last kmer tested, 97 and 113 we obtained 275 and 245 contigs.The prokka software is an automated tools for genome annotation. The run take less than ten minutes, as they was proposed on their articles.In order to control the quality of our DNA seq we choose to made first a Proteome comparisons with Pseudovibrio FOBEG1 which is our reference strain. For that purpose we decided to look at our first genome version contains 275 contigs which was provide by the Velvet de novo assembly tools. For the 5456 proteins of Pseudovibrio FO-BEG1 5132 proteins (which are our reference strain) are match with a prokka anotation CDS.<br />
5002 with a unique alignment 4936, 4687 with an alignement > 90%, 4415 > 95% and 2525 > 99%. For that purpose we are sure that we sequence a strain related to the Pseudovibrio genus.<br />
<br />
After this proteome comparison, we try to improved our genome assembly by improved the kmer size and we see that the contigs numbers was reduced to 245. In order to analyse the annotation and the quality of our genome annotation we look at 4 main specific annotation type such as antibiotic resitance, restriction enzyme, metals such as cadmium, copper and mercury, and other toxic compound such as phenol, nitrate, nitrite.<br />
<br />
</p><br />
</div><br />
<br><br><br />
<br />
<h4>Antibiotic resistance </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<h4>Restriction enzyme</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/98/DNA1EvRY.jpg"/><p><br />
<i>Figure 1: Sequence of the pRhokHi vector and the hightlight of the EcoKI target sequence </i></p><br />
</div><br />
<br />
<br><br><br />
</div><br />
<h4> Nitrate/nitrite</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
</p><br />
<br><br> <br />
</div><br />
<h4>Cadmium</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
</div><br />
<br><br> <br />
<h4>Copper </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Mercuric</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Phenol </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/9e/Phenol4.png" style="width:30%;height:30%"><br />
<p>Figure2 : <i>Anaerobic pathway degradation for phenol</i></p></div><p><br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<h4>REFERENCE</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</html><br />
<br />
<br />
<br />
<br />
<br />
<br />
{{:Team:Evry/Template:HomeFooter}}</div>Chesne jhttp://2014.igem.org/Team:Evry/Biology/GenomeAssemblyTeam:Evry/Biology/GenomeAssembly2014-10-18T03:26:15Z<p>Chesne j: </p>
<hr />
<div>{{:Team:Evry/Template:HomeIncludes}}<br />
{{:Team:Evry/Template:Menu}}<br />
{{:Team:Evry/Template:genomeAssemblyTop}}<br />
<br />
<br />
<html><br />
<br />
<h1> De novo Genome assembly</h1><br />
<br><br><br />
<p><br />
<br />
<br />
</p><br />
<br />
<br><br><br />
<h3> Assembly Strategy</h3><br />
<br><br><br />
<div align="justify"><br />
<p><br />
In order to perform the genome assembly of our bacteria we choose to used the velvet software. We choose 4 kmer size. For the first one at 31 we obtained 1493 contigs. for a kmer size of 65, 413 contigs are obtain. For the two last kmer tested, 97 and 113 we obtained 275 and 245 contigs.The prokka software is an automated tools for genome annotation. The run take less than ten minutes, as they was proposed on their articles.In order to control the quality of our DNA seq we choose to made first a Proteome comparisons with Pseudovibrio FOBEG1 which is our reference strain. For that purpose we decided to look at our first genome version contains 275 contigs which was provide by the Velvet de novo assembly tools. For the 5456 proteins of Pseudovibrio FO-BEG1 5132 proteins (which are our reference strain) are match with a prokka anotation CDS.<br />
5002 with a unique alignment 4936, 4687 with an alignement > 90%, 4415 > 95% and 2525 > 99%. For that purpose we are sure that we sequence a strain related to the Pseudovibrio genus.<br />
<br />
After this proteome comparison, we try to improved our genome assembly by improved the kmer size and we see that the contigs numbers was reduced to 245. In order to analyse the annotation and the quality of our genome annotation we look at 4 main specific annotation type such as antibiotic resitance, restriction enzyme, metals such as cadmium, copper and mercury, and other toxic compound such as phenol, nitrate, nitrite.<br />
<br />
</p><br />
</div><br />
<br><br><br />
<br />
<h4>Antibiotic resistance </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<h4>Restriction enzyme</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<div align="center"><img src=”https://static.igem.org/mediawiki/2014/9/98/DNA1EvRY.jpg”><p><br />
<i>Figure 1: Sequence of the pRhokHi vector and the hightlight of the EcoKI target sequence </i></p><br />
</div><br />
<br />
<br><br><br />
</div><br />
<h4> Nitrate/nitrite</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
</p><br />
<br><br> <br />
</div><br />
<h4>Cadmium</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
</div><br />
<br><br> <br />
<h4>Copper </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Mercuric</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Phenol </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/9e/Phenol4.png" style="width:30%;height:30%"><br />
<p>Figure2 : <i>Anaerobic pathway degradation for phenol</i></p></div><p><br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<h4>REFERENCE</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</html><br />
<br />
<br />
<br />
<br />
<br />
<br />
{{:Team:Evry/Template:HomeFooter}}</div>Chesne jhttp://2014.igem.org/Team:Evry/Biology/GenomeAssemblyTeam:Evry/Biology/GenomeAssembly2014-10-18T03:25:07Z<p>Chesne j: </p>
<hr />
<div>{{:Team:Evry/Template:HomeIncludes}}<br />
{{:Team:Evry/Template:Menu}}<br />
{{:Team:Evry/Template:genomeAssemblyTop}}<br />
<br />
<br />
<html><br />
<br />
<h1> De novo Genome assembly</h1><br />
<br><br><br />
<p><br />
<br />
<br />
</p><br />
<br />
<br><br><br />
<h3> Assembly Strategy</h3><br />
<br><br><br />
<div align="justify"><br />
<p><br />
In order to perform the genome assembly of our bacteria we choose to used the velvet software. We choose 4 kmer size. For the first one at 31 we obtained 1493 contigs. for a kmer size of 65, 413 contigs are obtain. For the two last kmer tested, 97 and 113 we obtained 275 and 245 contigs.The prokka software is an automated tools for genome annotation. The run take less than ten minutes, as they was proposed on their articles.In order to control the quality of our DNA seq we choose to made first a Proteome comparisons with Pseudovibrio FOBEG1 which is our reference strain. For that purpose we decided to look at our first genome version contains 275 contigs which was provide by the Velvet de novo assembly tools. For the 5456 proteins of Pseudovibrio FO-BEG1 5132 proteins (which are our reference strain) are match with a prokka anotation CDS.<br />
5002 with a unique alignment 4936, 4687 with an alignement > 90%, 4415 > 95% and 2525 > 99%. For that purpose we are sure that we sequence a strain related to the Pseudovibrio genus.<br />
<br />
After this proteome comparison, we try to improved our genome assembly by improved the kmer size and we see that the contigs numbers was reduced to 245. In order to analyse the annotation and the quality of our genome annotation we look at 4 main specific annotation type such as antibiotic resitance, restriction enzyme, metals such as cadmium, copper and mercury, and other toxic compound such as phenol, nitrate, nitrite.<br />
<br />
</p><br />
</div><br />
<br><br><br />
<br />
<h4>Antibiotic resistance </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<h4>Restriction enzyme</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<div align="center"><img src=” https://static.igem.org/mediawiki/2014/9/98/DNA1EvRY.jpg”><p><br />
<i>Figure 1: Sequence of the pRhokHi vector and the hightlight of the EcoKI target sequence </i></p><br />
</div><br />
<br />
<br><br><br />
</div><br />
<h4> Nitrate/nitrite</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
</p><br />
<br><br> <br />
</div><br />
<h4>Cadmium</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
</div><br />
<br><br> <br />
<h4>Copper </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Mercuric</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Phenol </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/9e/Phenol4.png" style="width:30%;height:30%"><br />
<p>Figure2 : <i>Anaerobic pathway degradation for phenol</i></p></div><p><br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<h4>REFERENCE</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</html><br />
<br />
<br />
<br />
<br />
<br />
<br />
{{:Team:Evry/Template:HomeFooter}}</div>Chesne jhttp://2014.igem.org/Team:Evry/Biology/GenomeAssemblyTeam:Evry/Biology/GenomeAssembly2014-10-18T03:22:35Z<p>Chesne j: </p>
<hr />
<div>{{:Team:Evry/Template:HomeIncludes}}<br />
{{:Team:Evry/Template:Menu}}<br />
{{:Team:Evry/Template:genomeAssemblyTop}}<br />
<br />
<br />
<html><br />
<br />
<h1> De novo Genome assembly</h1><br />
<br><br><br />
<p><br />
<br />
<br />
</p><br />
<br />
<br><br><br />
<h3> Assembly Strategy</h3><br />
<br><br><br />
<div align="justify"><br />
<p><br />
In order to perform the genome assembly of our bacteria we choose to used the velvet software. We choose 4 kmer size. For the first one at 31 we obtained 1493 contigs. for a kmer size of 65, 413 contigs are obtain. For the two last kmer tested, 97 and 113 we obtained 275 and 245 contigs.The prokka software is an automated tools for genome annotation. The run take less than ten minutes, as they was proposed on their articles.In order to control the quality of our DNA seq we choose to made first a Proteome comparisons with Pseudovibrio FOBEG1 which is our reference strain. For that purpose we decided to look at our first genome version contains 275 contigs which was provide by the Velvet de novo assembly tools. For the 5456 proteins of Pseudovibrio FO-BEG1 5132 proteins (which are our reference strain) are match with a prokka anotation CDS.<br />
5002 with a unique alignment 4936, 4687 with an alignement > 90%, 4415 > 95% and 2525 > 99%. For that purpose we are sure that we sequence a strain related to the Pseudovibrio genus.<br />
<br />
After this proteome comparison, we try to improved our genome assembly by improved the kmer size and we see that the contigs numbers was reduced to 245. In order to analyse the annotation and the quality of our genome annotation we look at 4 main specific annotation type such as antibiotic resitance, restriction enzyme, metals such as cadmium, copper and mercury, and other toxic compound such as phenol, nitrate, nitrite.<br />
<br />
</p><br />
</div><br />
<br><br><br />
<br />
<h4>Antibiotic resistance </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<h4>Restriction enzyme</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4> Nitrate/nitrite</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
</p><br />
<br><br> <br />
</div><br />
<h4>Cadmium</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
</div><br />
<br><br> <br />
<h4>Copper </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Mercuric</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Phenol </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/9e/Phenol4.png" style="width:30%;height:30%"><br />
<p>Figure : Anaerobic pathway degradation for phenol</p></div><p><br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<h4>REFERENCE</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</html><br />
<br />
<br />
<br />
<br />
<br />
<br />
{{:Team:Evry/Template:HomeFooter}}</div>Chesne jhttp://2014.igem.org/Team:Evry/Biology/GenomeAssemblyTeam:Evry/Biology/GenomeAssembly2014-10-18T03:20:58Z<p>Chesne j: </p>
<hr />
<div>{{:Team:Evry/Template:HomeIncludes}}<br />
{{:Team:Evry/Template:Menu}}<br />
{{:Team:Evry/Template:genomeAssemblyTop}}<br />
<br />
<br />
<html><br />
<br />
<h1> De novo Genome assembly</h1><br />
<br><br><br />
<p><br />
<br />
<br />
</p><br />
<br />
<br><br><br />
<h4> Assembly Strategy</h4><br />
<br><br><br />
<div align="justify"><br />
<p><br />
In order to perform the genome assembly of our bacteria we choose to used the velvet software. We choose 4 kmer size. For the first one at 31 we obtained 1493 contigs. for a kmer size of 65, 413 contigs are obtain. For the two last kmer tested, 97 and 113 we obtained 275 and 245 contigs.The prokka software is an automated tools for genome annotation. The run take less than ten minutes, as they was proposed on their articles.In order to control the quality of our DNA seq we choose to made first a Proteome comparisons with Pseudovibrio FOBEG1 which is our reference strain. For that purpose we decided to look at our first genome version contains 275 contigs which was provide by the Velvet de novo assembly tools. For the 5456 proteins of Pseudovibrio FO-BEG1 5132 proteins (which are our reference strain) are match with a prokka anotation CDS.<br />
5002 with a unique alignment 4936, 4687 with an alignement > 90%, 4415 > 95% and 2525 > 99%. For that purpose we are sure that we sequence a strain related to the Pseudovibrio genus.<br />
<br />
After this proteome comparison, we try to improved our genome assembly by improved the kmer size and we see that the contigs numbers was reduced to 245. In order to analyse the annotation and the quality of our genome annotation we look at 4 main specific annotation type such as antibiotic resitance, restriction enzyme, metals such as cadmium, copper and mercury, and other toxic compound such as phenol, nitrate, nitrite.<br />
<br />
</p><br />
</div><br />
<br><br><br />
<h4>Proteome Comparisons with FOBEG1<h4><br />
<div align="justify"><br />
<p><br />
<br />
<br />
</p><br />
<br />
<br><br><br />
</div><br />
<h4>Antibiotic resistance </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<h4>Restriction enzyme</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4> Nitrate/nitrite</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
</p><br />
<br><br> <br />
</div><br />
<h4>Cadmium</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
</div><br />
<br><br> <br />
<h4>Copper </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Mercuric</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Phenol </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/9e/Phenol4.png" style="width:30%;height:30%"><br />
<p>Figure : Anaerobic pathway degradation for phenol</p></div><p><br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<h4>REFERENCE</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</html><br />
<br />
<br />
<br />
<br />
<br />
<br />
{{:Team:Evry/Template:HomeFooter}}</div>Chesne jhttp://2014.igem.org/Team:Evry/Biology/GenomeAssemblyTeam:Evry/Biology/GenomeAssembly2014-10-18T03:20:15Z<p>Chesne j: </p>
<hr />
<div>{{:Team:Evry/Template:HomeIncludes}}<br />
{{:Team:Evry/Template:Menu}}<br />
{{:Team:Evry/Template:genomeAssemblyTop}}<br />
<br />
<br />
<html><br />
<div class="content-wrapper"><br />
<div class="col-lg-10 col-lg-offset-1"><br />
<h1> De novo Genome assembly</h1><br />
<br><br><br />
<p><br />
<br />
<br />
</p><br />
<br />
<br><br><br />
<h4> Assembly Strategy</h4><br />
<br><br><br />
<div align="justify"><br />
<p><br />
In order to perform the genome assembly of our bacteria we choose to used the velvet software. We choose 4 kmer size. For the first one at 31 we obtained 1493 contigs. for a kmer size of 65, 413 contigs are obtain. For the two last kmer tested, 97 and 113 we obtained 275 and 245 contigs.The prokka software is an automated tools for genome annotation. The run take less than ten minutes, as they was proposed on their articles.In order to control the quality of our DNA seq we choose to made first a Proteome comparisons with Pseudovibrio FOBEG1 which is our reference strain. For that purpose we decided to look at our first genome version contains 275 contigs which was provide by the Velvet de novo assembly tools. For the 5456 proteins of Pseudovibrio FO-BEG1 5132 proteins (which are our reference strain) are match with a prokka anotation CDS.<br />
5002 with a unique alignment 4936, 4687 with an alignement > 90%, 4415 > 95% and 2525 > 99%. For that purpose we are sure that we sequence a strain related to the Pseudovibrio genus.<br />
<br />
After this proteome comparison, we try to improved our genome assembly by improved the kmer size and we see that the contigs numbers was reduced to 245. In order to analyse the annotation and the quality of our genome annotation we look at 4 main specific annotation type such as antibiotic resitance, restriction enzyme, metals such as cadmium, copper and mercury, and other toxic compound such as phenol, nitrate, nitrite.<br />
<br />
</p><br />
</div><br />
<br><br><br />
<h4>Proteome Comparisons with FOBEG1<h4><br />
<div align="justify"><br />
<p><br />
<br />
<br />
</p><br />
<br />
<br><br><br />
</div><br />
<h4>Antibiotic resistance </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<h4>Restriction enzyme</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4> Nitrate/nitrite</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
</p><br />
<br><br> <br />
</div><br />
<h4>Cadmium</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
</div><br />
<br><br> <br />
<h4>Copper </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Mercuric</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Phenol </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/9e/Phenol4.png" style="width:30%;height:30%"><br />
<p>Figure : Anaerobic pathway degradation for phenol</p></div><p><br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<h4>REFERENCE</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</html><br />
<br />
<br />
<br />
<br />
<br />
<br />
{{:Team:Evry/Template:HomeFooter}}</div>Chesne jhttp://2014.igem.org/File:DNA1EvRY.jpgFile:DNA1EvRY.jpg2014-10-18T03:16:01Z<p>Chesne j: </p>
<hr />
<div></div>Chesne jhttp://2014.igem.org/Team:Evry/Biology/GenomeAssemblyTeam:Evry/Biology/GenomeAssembly2014-10-18T03:13:52Z<p>Chesne j: </p>
<hr />
<div>{{:Team:Evry/Template:HomeIncludes}}<br />
{{:Team:Evry/Template:Menu}}<br />
{{:Team:Evry/Template:genomeAssemblyTop}}<br />
<br />
<br />
<html><br />
<div class="content-wrapper"><br />
<div class="col-lg-10 col-lg-offset-1"><br />
<h1> De novo Genome assembly</h1><br />
<br><br />
<h4> Assembly Strategy</h4><br />
<br><br><br />
<div align="justify"><br />
<p><br />
Our DNA was sequenced by the Genoscope and the quality of the data analysed by the fastqc softvare, provide the link of the data<br />
<br />
Our stategy was to used the velvet software whi is a de novo assembler<br />
for that purpose I chose to to perform my analyse with the velvet software which is known to have good reference<br />
</p><br />
</div><br />
<br><br><br />
<h4>Proteome Comparisons with FOBEG1<h4><br />
<div align="justify"><br />
<p><br />
<br />
<br />
</p><br />
<br />
<br><br><br />
</div><br />
<h4>Antibiotic resistance </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<h4>Restriction enzyme</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4> Nitrate/nitrite</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
</p><br />
<br><br> <br />
</div><br />
<h4>Cadmium</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
</div><br />
<br><br> <br />
<h4>Copper </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Mercuric</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Phenol </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/9e/Phenol4.png" style="width:30%;height:30%"><br />
<p>Figure : Anaerobic pathway degradation for phenol</p></div><p><br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<h4>REFERENCE</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</html><br />
<br />
<br />
<br />
<br />
<br />
<br />
{{:Team:Evry/Template:HomeFooter}}</div>Chesne jhttp://2014.igem.org/Team:Evry/Biology/GenomeAssemblyTeam:Evry/Biology/GenomeAssembly2014-10-18T03:13:15Z<p>Chesne j: </p>
<hr />
<div>{{:Team:Evry/Template:HomeIncludes}}<br />
{{:Team:Evry/Template:Menu}}<br />
{{:Team:Evry/Template:genomeAssemblyTop}}<br />
<br />
<br />
<html><br />
<div class="content-wrapper"><br />
<div class="col-lg-10 col-lg-offset-1"><br />
<h1> De novo Genome assembly</h1><br />
<br><br />
<h4> Assembly Strategy</h4><br />
<br><br><br />
<div align="justify"><br />
<p><br />
Our DNA was sequenced by the Genoscope and the quality of the data analysed by the fastqc softvare, provide the link of the data<br />
<br />
Our stategy was to used the velvet software whi is a de novo assembler<br />
for that purpose I chose to to perform my analyse with the velvet software which is known to have good reference<br />
</p><br />
</div><br />
<br><br><br />
<h4>Proteome Comparisons with FOBEG1<h4><br />
<div align="justify"><br />
<p><br />
<br />
<br />
</p><br />
<br />
<br><br><br />
</div><br />
<h4>Antibiotic resistance </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<h4>Restriction enzyme</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4> Nitrate/nitrite</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
</p><br />
<br><br> <br />
</div><br />
<h4>Cadmium</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
</div><br />
<br><br> <br />
<h4>Copper </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Mercuric</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Phenol </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/9e/Phenol4.png" style="width:20%;height:20%"><br />
<p>Figure : Anaerobic pathway degradation for phenol</p></div><p><br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<h4>REFERENCE</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</html><br />
<br />
<br />
<br />
<br />
<br />
<br />
{{:Team:Evry/Template:HomeFooter}}</div>Chesne jhttp://2014.igem.org/Team:Evry/Biology/GenomeAssemblyTeam:Evry/Biology/GenomeAssembly2014-10-18T03:12:36Z<p>Chesne j: </p>
<hr />
<div>{{:Team:Evry/Template:HomeIncludes}}<br />
{{:Team:Evry/Template:Menu}}<br />
{{:Team:Evry/Template:genomeAssemblyTop}}<br />
<br />
<br />
<html><br />
<div class="content-wrapper"><br />
<div class="col-lg-10 col-lg-offset-1"><br />
<h1> De novo Genome assembly</h1><br />
<br><br />
<h4> Assembly Strategy</h4><br />
<br><br><br />
<div align="justify"><br />
<p><br />
Our DNA was sequenced by the Genoscope and the quality of the data analysed by the fastqc softvare, provide the link of the data<br />
<br />
Our stategy was to used the velvet software whi is a de novo assembler<br />
for that purpose I chose to to perform my analyse with the velvet software which is known to have good reference<br />
</p><br />
</div><br />
<br><br><br />
<h4>Proteome Comparisons with FOBEG1<h4><br />
<div align="justify"><br />
<p><br />
<br />
<br />
</p><br />
<br />
<br><br><br />
</div><br />
<h4>Antibiotic resistance </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<h4>Restriction enzyme</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4> Nitrate/nitrite</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
</p><br />
<br><br> <br />
</div><br />
<h4>Cadmium</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
</div><br />
<br><br> <br />
<h4>Copper </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Mercuric</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Phenol </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/9e/Phenol4.png" style="width:60%;height:60%"><br />
<p>Figure : Anaerobic pathway degradation for phenol</p></div><p><br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<h4>REFERENCE</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</html><br />
<br />
<br />
<br />
<br />
<br />
<br />
{{:Team:Evry/Template:HomeFooter}}</div>Chesne jhttp://2014.igem.org/Team:Evry/Biology/GenomeAssemblyTeam:Evry/Biology/GenomeAssembly2014-10-18T03:12:03Z<p>Chesne j: </p>
<hr />
<div>{{:Team:Evry/Template:HomeIncludes}}<br />
{{:Team:Evry/Template:Menu}}<br />
{{:Team:Evry/Template:genomeAssemblyTop}}<br />
<br />
<br />
<html><br />
<div class="content-wrapper"><br />
<div class="col-lg-10 col-lg-offset-1"><br />
<h1> De novo Genome assembly</h1><br />
<br><br />
<h4> Assembly Strategy</h4><br />
<br><br><br />
<div align="justify"><br />
<p><br />
Our DNA was sequenced by the Genoscope and the quality of the data analysed by the fastqc softvare, provide the link of the data<br />
<br />
Our stategy was to used the velvet software whi is a de novo assembler<br />
for that purpose I chose to to perform my analyse with the velvet software which is known to have good reference<br />
</p><br />
</div><br />
<br><br><br />
<h4>Proteome Comparisons with FOBEG1<h4><br />
<div align="justify"><br />
<p><br />
<br />
<br />
</p><br />
<br />
<br><br><br />
</div><br />
<h4>Antibiotic resistance </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<h4>Restriction enzyme</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4> Nitrate/nitrite</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
</p><br />
<br><br> <br />
</div><br />
<h4>Cadmium</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
</div><br />
<br><br> <br />
<h4>Copper </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Mercuric</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Phenol </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/9/9e/Phenol4.png" style="widht:60%;heigth:60%"><br />
<p>Figure : Anaerobic pathway degradation for phenol</p></div><p><br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<h4>REFERENCE</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</html><br />
<br />
<br />
<br />
<br />
<br />
<br />
{{:Team:Evry/Template:HomeFooter}}</div>Chesne jhttp://2014.igem.org/Team:Evry/Biology/GenomeAssemblyTeam:Evry/Biology/GenomeAssembly2014-10-18T03:10:30Z<p>Chesne j: </p>
<hr />
<div>{{:Team:Evry/Template:HomeIncludes}}<br />
{{:Team:Evry/Template:Menu}}<br />
{{:Team:Evry/Template:genomeAssemblyTop}}<br />
<br />
<br />
<html><br />
<div class="content-wrapper"><br />
<div class="col-lg-10 col-lg-offset-1"><br />
<h1> De novo Genome assembly</h1><br />
<br><br />
<h4> Assembly Strategy</h4><br />
<br><br><br />
<div align="justify"><br />
<p><br />
Our DNA was sequenced by the Genoscope and the quality of the data analysed by the fastqc softvare, provide the link of the data<br />
<br />
Our stategy was to used the velvet software whi is a de novo assembler<br />
for that purpose I chose to to perform my analyse with the velvet software which is known to have good reference<br />
</p><br />
</div><br />
<br><br><br />
<h4>Proteome Comparisons with FOBEG1<h4><br />
<div align="justify"><br />
<p><br />
<br />
<br />
</p><br />
<br />
<br><br><br />
</div><br />
<h4>Antibiotic resistance </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<h4>Restriction enzyme</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4> Nitrate/nitrite</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
</p><br />
<br><br> <br />
</div><br />
<h4>Cadmium</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
</div><br />
<br><br> <br />
<h4>Copper </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Mercuric</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<h4>Phenol </h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<div align="center"><img src=https://static.igem.org/mediawiki/2014/9/9e/Phenol4.png></div><br />
<p>Figure : Anaerobic pathway degradation for phenol<br />
<br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<h4>REFERENCE</h4><br />
<div align="justify"><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</html><br />
<br />
<br />
<br />
<br />
<br />
<br />
{{:Team:Evry/Template:HomeFooter}}</div>Chesne jhttp://2014.igem.org/Team:Evry/Biology/GenomeAssemblyTeam:Evry/Biology/GenomeAssembly2014-10-18T03:02:49Z<p>Chesne j: </p>
<hr />
<div>{{:Team:Evry/Template:HomeIncludes}}<br />
{{:Team:Evry/Template:Menu}}<br />
{{:Team:Evry/Template:genomeAssemblyTop}}<br />
<br />
<br />
<br />
<html><br />
<div class="content-wrapper"><br />
<div class="col-lg-10 col-lg-offset-1"><br />
<h1> De novo Genome assembly</h1><br />
<br><br />
<h5> Assembly Strategy</h5><br />
<br><br><br />
<p><br />
Our DNA was sequenced by the Genoscope and the quality of the data analysed by the fastqc softvare, provide the link of the data<br />
<br />
Our stategy was to used the velvet software whi is a de novo assembler<br />
for that purpose I chose to to perform my analyse with the velvet software which is known to have good reference<br />
</p><br />
<br><br><br />
<h5>Proteome Comparisons with FOBEG1<h5><br />
<p><br />
<br />
<br />
</p><br />
<br />
<br><br><br />
<h5>Antibiotic resistance </h5><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br><br />
<br />
<h5>Restriction enzyme</h5><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br><br><br />
<h5> Nitrate/nitrite</h5><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
<br />
</p><br />
<br><br> <br />
<h5>Cadmium</h5><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br> <br />
<h5>Copper </h5><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
<h5>Mercuric</h5><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
<h5>Phenol </h5><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
<h5>REFERENCE</h5><br />
<br><br><br />
<p><br />
<br />
<br />
<br />
</p><br />
<br><br><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</html><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
{{:Team:Evry/Template:HomeFooter}}</div>Chesne jhttp://2014.igem.org/File:Phenol4.pngFile:Phenol4.png2014-10-18T00:32:20Z<p>Chesne j: </p>
<hr />
<div></div>Chesne jhttp://2014.igem.org/Team:Evry/Template:StatisticsTeam:Evry/Template:Statistics2014-10-17T23:34:05Z<p>Chesne j: </p>
<hr />
<div><html><br />
<section id="statistic" class="parallax" style="background-image: url(https://static.igem.org/mediawiki/2014/4/45/Under-water-wallpaper-hd-104.jpg);"><br />
<div class="overlay"></div><br />
<div class="content-wrapper"><br />
<div class="col-lg-10 col-lg-offset-1"><br />
<div class="col-md-3 col-sm-3 col-xs-6"><br />
<div class="counter animated hiding" data-animation="fadeInDown" data-delay="0"><br />
<div class="stat"><span class="timer" data-from="0" data-to="17">17</span></div><br />
<div class="stat-info">Team members</div><br />
</div><br />
</div><br />
<div class="col-md-3 col-sm-3 col-xs-6"><br />
<div class="counter animated hiding" data-animation="fadeInDown" data-delay="500"><br />
<div class="stat"><span class="timer" data-from="0" data-to="8">2</span><br />
</div><br />
<div class="stat-info">Biobricks</div><br />
</div><br />
</div><br />
<div class="col-md-3 col-sm-3 col-xs-6"><br />
<div class="counter animated hiding" data-animation="fadeInDown" data-delay="1000"><br />
<div class="stat"><span class="timer" data-from="0" data-to="3">3</span></div><br />
<div class="stat-info">Collaborations</div><br />
</div><br />
</div><br />
<div class="col-md-3 col-sm-3 col-xs-6"><br />
<div class="counter animated hiding" data-animation="fadeInDown" data-delay="1500"><br />
<div class="stat"><span class="timer" data-from="0" data-to="239">239</span>+<br />
</div><br />
<div class="stat-info">All-nighters</div><br />
</div><br />
</div><br />
</div><br />
</div><br />
</section><br />
</html></div>Chesne jhttp://2014.igem.org/Team:Evry/Template:StatisticsTeam:Evry/Template:Statistics2014-10-17T23:32:41Z<p>Chesne j: </p>
<hr />
<div><html><br />
<section id="statistic" class="parallax" style="background-image: url(https://static.igem.org/mediawiki/2014/4/45/Under-water-wallpaper-hd-104.jpg);"><br />
<div class="overlay"></div><br />
<div class="content-wrapper"><br />
<div class="col-lg-10 col-lg-offset-1"><br />
<div class="col-md-3 col-sm-3 col-xs-6"><br />
<div class="counter animated hiding" data-animation="fadeInDown" data-delay="0"><br />
<div class="stat"><span class="timer" data-from="0" data-to="17">17</span></div><br />
<div class="stat-info">Team members</div><br />
</div><br />
</div><br />
<div class="col-md-3 col-sm-3 col-xs-6"><br />
<div class="counter animated hiding" data-animation="fadeInDown" data-delay="500"><br />
<div class="stat"><span class="timer" data-from="0" data-to="8">2</span><br />
</div><br />
<div class="stat-info">Biobricks</div><br />
</div><br />
</div><br />
<div class="col-md-3 col-sm-3 col-xs-6"><br />
<div class="counter animated hiding" data-animation="fadeInDown" data-delay="1000"><br />
<div class="stat"><span class="timer" data-from="0" data-to="1">3</span></div><br />
<div class="stat-info">Collaborations</div><br />
</div><br />
</div><br />
<div class="col-md-3 col-sm-3 col-xs-6"><br />
<div class="counter animated hiding" data-animation="fadeInDown" data-delay="1500"><br />
<div class="stat"><span class="timer" data-from="0" data-to="239">239</span>+<br />
</div><br />
<div class="stat-info">All-nighters</div><br />
</div><br />
</div><br />
</div><br />
</div><br />
</section><br />
</html></div>Chesne jhttp://2014.igem.org/Team:Evry/Notebook/Protocols/M9Team:Evry/Notebook/Protocols/M92014-10-17T23:21:10Z<p>Chesne j: </p>
<hr />
<div><html><br />
<br />
<div align="center"><br />
<FONT COLOR="blue"><br />
<h4>M9 - CASA +3%NaCl</h4><br />
</FONT> <br />
</div><br />
<br />
<div align="left"><br />
<br><br><br />
<p>Composition of the medium: <br></p><br />
<div align="left"><br />
<img src="https://static.igem.org/mediawiki/2014/5/50/M9%282%29.jpg" alt="text to print if image not found" /><br />
</div><br />
<br><p><br />
After add correspondant quantity of the different compounds in the wished volume of water, filtrate the entiere volume obtained.<br><br />
NB: This medium can't be autoclaved contain glucose and amino acids. <br></p><br />
</div><br />
</htlm></div>Chesne jhttp://2014.igem.org/Team:Evry/Notebook/Protocols/M9Team:Evry/Notebook/Protocols/M92014-10-17T23:20:55Z<p>Chesne j: </p>
<hr />
<div><html><br />
<br />
<div align="center"><br />
<FONT COLOR="blue"><br />
<h4>M9 - CASA +3%NaCl</h4><br />
</FONT> <br />
</div><br />
<br />
<div align="left"><br />
<br><br><br />
Composition of the medium: <br><br />
<div align="left"><br />
<img src="https://static.igem.org/mediawiki/2014/5/50/M9%282%29.jpg" alt="text to print if image not found" /><br />
</div><br />
<br><p><br />
After add correspondant quantity of the different compounds in the wished volume of water, filtrate the entiere volume obtained.<br><br />
NB: This medium can't be autoclaved contain glucose and amino acids. <br></p><br />
</div><br />
</htlm></div>Chesne jhttp://2014.igem.org/Team:Evry/Notebook/Protocols/MBTeam:Evry/Notebook/Protocols/MB2014-10-17T23:17:21Z<p>Chesne j: </p>
<hr />
<div><html><br />
<br />
<div align="center"><br />
<FONT COLOR="blue"><br />
<h4>Marine broth</h4><br />
</FONT> <br />
</div><br />
<br />
<br><br><br />
<div align="left"><br />
<p>Composition of the medium: <br></p><br />
<div align="left"><br />
<img src="https://static.igem.org/mediawiki/2014/7/70/MB.jpg" alt="text to print if image not found" /><br />
</div><br />
<br><p><br />
After having put the wished volume of water, put 40.2g/L of the medium powder.<br><br />
Dissolve sediments by warming the mixture. <br><br />
Boil during one entiere minute<br><br />
Autoclave the medium during 15min at 250°F.<br></p><br />
</div><br />
<br> <br />
</htlm></div>Chesne jhttp://2014.igem.org/Team:Evry/Notebook/Sensing/Phenol/08-20-2014Team:Evry/Notebook/Sensing/Phenol/08-20-20142014-10-17T23:09:57Z<p>Chesne j: </p>
<hr />
<div><html><br />
<div class="cd-timeline-block"><br />
</html><br />
{{:Team:Evry/Notebook/Sensing/Phenol/TopImage}}<br />
<html><br />
<div class="cd-timeline-content"><br />
<p align="justify"><br />
<br />
<u>PCR using VF2 and VR primer</u><br><br />
Q5 polymerase <br><br />
Expected bands :<br><br />
DmpR: 2038 bp <br><br />
GFP B0031: 1331 bp <br><br />
GFP B0032: 1330 bp <br><br />
<u>Digestion</u> <br><br />
From newly extracted DNA<br><br />
DmpR: SpeI&PstI<br><br />
GFP B0031/32: XbaI&PstI<br><br><br />
<div align="center"><br />
<img src="https://static.igem.org/mediawiki/2014/2/23/EVRY_Dmpr_GFP_GEL_20-08_PNG.PNG"><br><br></div><br />
<u>Analysis</u><br><br />
VF2/VR PCR products are still in agreement with the expected size either for DmpR and GFP B0031/32.<br><br />
GFP 31/32 digestion products were in agreement with the expected size.<br><br />
DmpR digestion by SP is still displaying 2 close bands profile.<br><br><br />
</p><br />
<br />
<br />
<span class="cd-date">Aug 20</span><br />
</div><br />
</div><br />
</html></div>Chesne jhttp://2014.igem.org/Team:Evry/Notebook/Sensing/PCBs/08-20-2014Team:Evry/Notebook/Sensing/PCBs/08-20-20142014-10-17T23:08:12Z<p>Chesne j: </p>
<hr />
<div><html><br />
<div class="cd-timeline-block"><br />
</html><br />
{{:Team:Evry/Notebook/Sensing/PCBs/TopImage}}<br />
<html><br />
<div class="cd-timeline-content"><br />
<p align="justify"><br />
<u>Sensor construction bphR2/PbphR1</u><br />
<br>We received sequencing reads: that match perfectly to the registry sequence.<br />
<br>26DJ54<br />
<br>AATAGGCGTTATCACGAGGCAGAANTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGATGTCCCTGG<br />
GTGACATGCGTGATTTGGCCGCCACGCGGATCGCGCTCGAGAGCGAAGCGTTACGCCAAAGCGTGCTGAATGGTGACGCTGAATGGGAGGCGCGGATCGTCAGTTC<br />
GTTTCACCGACTGTCATTGATTGAAGAGCCCACGATGCGGGATCCGGCTCGCTGGTTTAATGAGTGGGAGCCAGTCAACCGCGGTTTTCACGAAGCTCTTATCTCT<br />
GCCTGTTCGTCCGTCTGGATCCGGCGGTTCCTGTCCATCCTGTATGTGCATATGGAGCGCTACCGCCGATTGACTGCTTACTAGTAGCGGCCGCTGCAGTCCGGCA<br />
AAAAAGGGCAAGGTGTCACCACCCTGCCCTTTTTCTTTAAAACCGAAAAGATTACTTCGCGTTATGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTC<br />
GGCTGCGGCGAGCGGTATCA<br />
GCTCACTCAGGG<br />
<br><br />
<br>26DJ55<br />
<br>CGAGTCAGTGAGCGAGGAAGCCTGCATAACGCGAAGTAATCTTTTCGGTTTTAAAGAAAAAGGGCAGGGTGGTGACACCTTGCCCTTTTTTGCCGGACTGC<br />
AGCGGCCGCTACTAGTAAGCAGTCAATCGGCGGTAGCGCTCCATATGCACATACAGGATGGACAGGAACCGCCGGATCCAGACGGACGAACAGGCAGAGATAAGAG<br />
CTTCGTGAAAACCGCGGTTGACTGGCTCCCACTCATTAAACCAGCGAGCCGGATCCCGCATCGTGGGCTCTTCAATCAATGACAGTCGGTGAAACGAACTGACGAT<br />
CCGCGCCTCCCATTCAGCGTCACCATTCAGCACGCTTTGGCGTAACGCTTCGCTCTCGAGCGCGATCCGCGTGGCGGCCAAATCACGCATGTCACCCAGGGACATC<br />
TCTAGAAGCGGCCGCGAATTCCAGAAATCATCCTTAGCGAAAGCTAAGGATTTTTTTTATCTGAAATTCTGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCA<br />
TGATAATAATGGTTTCTTAGA<br />
<br/><br />
<br/><br />
<br/> Plasmid with bphR2 gene was purified with NucleoSpin Plamsid protocol (Macherey-Nagel) => we obtained 227,5ng/µL<br />
<br/>This plasmid was digested according this protocol:<br />
<ol><br />
<li>Add:<br />
<ul><br />
<li> sterilized water: qsp 20µL<br />
<li> template DNA : 500ng<br />
<li> buffer 2.1: 2µL<br />
<li> BSA: 0,2µL<br />
<li> EcoRI: 1µL<br />
<li> PstI: 1µL<br />
</ul><br />
<li>Reverse for mix<br />
<li>Incubate at 37°C during 45mn<br />
<li>Incubate at 80°C during 20mn<br />
<li> Ligation was not possible because pSB1C3 plasmid was not digested so the digested plasmid (bphR2 gene) was stored at -20°C<br />
</ol><br />
<br />
<br />
<br/><br />
<u>Survival test on E.coli BL21:</u><br />
<br/>Bacteria survive again for different concentrations but they were very concentrated<br />
<br/><br />
<br/> A dilution of the medium has been done for the positive control and the six different concentrations:<br/><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/3/3a/2nd_Survival_test_1st_day.jpg" alt="image not found" /></div><br />
</p><br />
<br />
<br />
<span class="cd-date">Aug 20</span> <br />
</div><br />
</div><br />
</html></div>Chesne jhttp://2014.igem.org/Team:Evry/Notebook/Sensing/PCBs/08-16-2014Team:Evry/Notebook/Sensing/PCBs/08-16-20142014-10-17T23:06:35Z<p>Chesne j: </p>
<hr />
<div><html><br />
<div class="cd-timeline-block"><br />
</html><br />
{{:Team:Evry/Notebook/Sensing/PCBs/TopImage}}<br />
<html><br />
<div class="cd-timeline-content"><br />
<p align="justify"><br />
<br />
<br/><br />
<b><u>Survival test on E.coli BL21:</u></b><br />
<br/> <br />
<br/>After the incubation of <a href="https://2014.igem.org/Team:Evry/Notebook/Sensing/PCBs/08-15-2014">15th July</a>, bacteria had grown:<br />
<br/><br />
<br/><div align="center"><br />
<img src="https://static.igem.org/mediawiki/2013/1/1e/Evry_2014_Survival_test_1st_day.JPG" alt="image not found", width="400" /></div><br />
</p><br />
<br />
<br />
<span class="cd-date">Aug 16</span> <br />
</div><br />
</div><br />
</html></div>Chesne jhttp://2014.igem.org/Team:Evry/EvryTeam/AttributionsTeam:Evry/EvryTeam/Attributions2014-10-17T23:04:15Z<p>Chesne j: </p>
<hr />
<div>{{:Team:Evry/Template:HomeIncludes}}<br />
{{:Team:Evry/Template:Menu}}<br />
{{:Team:Evry/Template:AttributionsTop}}<br />
<br />
<br />
<html><br />
<div class="content-wrapper"><br />
<div class="col-lg-10 col-lg-offset-1"><br />
<h5><FONT COLOR=#0099CC>The team</font></h5><br />
<br><br><br />
<div align="center"><br />
<p><br />
iGEM Evry team 2014 is composed of students from Licence 3 (3rd year after baccalaureate) to M2 (5th year after baccalaureate) from different universities and schools with various specialties as biology, computer science, biotechnology, ethics...<br />
We worked together from June to October in order to realize our project. Each member brought his own knowledge and his "savoir-faire" to share and build the <b>Sponge Patrol Project</b>.<br />
<br><br />
<font color=#993333><i>We have lived an amazing experience and adventure all together.</i></font><br />
</p><br />
<br />
</div><br />
<br><br><br />
<h5><FONT COLOR=#0099CC>Laboratory</font></h5><br />
<br><br><br />
<div align="center"><br />
<br />
<p><br />
Biologist team spent summer in <font color=#663366><a href="http://www.issb.genopole.fr/">Institute of Systems & Synthetic Biology</a></font> (ISSB), Evry working in the laboratory. The biologist team is composed of Cécile Jacry, Laura Matabishi, Nandjafot Mendy, Noémie Berenger-Curria, Julie Zaworski, Sophia Belkhelfa , Romain Bodinier, Matthieu Da Costa and Johanna Chesnel. Biologist supervisors: Tiffany Souterre and Tristan Cerisy were presents and supportive.<br />
<br> <br />
<font color=#993333><i> Any piece of the ISSB laboratory is mysterious today.</i></font><br />
<br />
<br />
<br />
</p><br />
</div><br />
<br><br><br />
<br />
<h5><FONT COLOR=#0099CC>Modelisation</font></h5><br />
<br><br><br />
<div align="center"><br />
<br />
<p> <br />
Bioinformatic team spent summer in <font color=#663366><a href="http://www.issb.genopole.fr/">Institute of Systems & Synthetic Biology</a></font> (ISSB), Evry working in partnership with biologist. The bioinformatic student team is composed of Bernard Jesop, Anaïs Louis and William Digan. Bioinformatic supervisors with Pierre Parutto and Adrien Basso-Blandin gave significant hand all along the project. <br />
<br><br />
<font color=#993333><i>One day biologist and bioinformatist will be one.</i></font><br />
</p><br />
</div><br />
<br><br><br />
<br />
<h5><FONT COLOR=#0099CC>Policy and Pratices</font></h5><br />
<br><br><br />
<div align="center"><br />
<p><br />
Sophie Gontier was our philosopher and spent summer in laboratory and shared room working about ethic questions and share with biologist and bioinformatist all along about her thoughts. <br />
<br><br />
<font color=#993333><i>We create only because we watch out for the world around.</i></font><br />
</p><br />
<br><br><br />
</div><br />
<h5><FONT COLOR=#0099CC>Project parts</font></h5><br />
<br><br><br />
<p> The Sponge Patrol Project was divided in several part :</p><br><br />
<div style="float:center"> <table style="width:80em; text-align:center;" border="1"><tr><p><br />
<th><font color=#CC3333></font><br></th><br />
<br />
<td><p> PCB </p></td><br />
<td> <p>Phenol</p></td><br />
<td> <p>RNAseq</p></td><br />
<td><p>Cell characterization</p></td><br />
<td><p>Inter-lab study</p></td><br />
<td><p>Transposons</p></td><br />
<td><p > Sponge</p> </td><br />
</tr><br />
<tr><br />
<th><font color=#CC3333>Biologist</font><br></th><br />
<br />
<td> Laura Matabishi</td><br />
<td> Nandjafot Mendy</td><br />
<td> Cécile Jacry</td><br />
<td>Noémie Berenger Currias, <br>Matthieu Da Costa, Johanna Chesnel</td><br />
<td>Cécilé Jacry, Laura Matabishi, <br>Noémie Berenger-Currias, <br>Julie Zaworski, Sophia Belkhelfa </td><br />
<td>Sophia Belkhelfa</td><br />
<td> - </td><br />
<br />
</tr><br />
<tr><br />
<th><font color=#CC3333>Bioinformatic</font><br></th><br />
<td> Bernard Jesop</td><br />
<td> William Digan,<br> Adrien Basso-Blandin </td><br />
<td> -</td><br />
<td>-</td><br />
<td>-</td><br />
<td>-</td><br />
<td> Pierre Parutto </td><br />
</p></tr><br />
<br />
</table><br />
</div> <br />
<br><br><br />
<h5><FONT COLOR=#0099CC>Wiki</font></h5><br />
<br><br><br />
<div align="center"> <br />
<p><br />
All members was concerned about fill in the wiki. Anais Louis and William Digan have managed it, and Matthieu Da Costa carry about schema and representations. <br />
</p><br />
<br />
</p><br />
</div><br />
<br><br> <br />
<br />
<br />
<br />
<br />
<br />
<h5><FONT COLOR=#0099CC>The Institute of Systems and Synthetic Biology (iSSB)</font></h5><br />
<br><br><br />
<p><br />
<a href="http://www.issb.genopole.fr/"><img src="https://static.igem.org/mediawiki/2012/b/bf/Photo_iSSB.jpeg" alt="logo issb" align="right" width="100" height="100"/></a><br />
Our team was received by the iSSB all along the year firstly for our Wednesday meeting then all the summer. The iSSB is a laboratory at the University of Evry and CNRS, supported by Genopole®.<br />
<br />
</p><br />
<br />
</div><br />
</div> <br />
</html><br />
<br />
{{:Team:Evry/Template:HomeFooter}}</div>Chesne jhttp://2014.igem.org/Team:Evry/Notebook/Transposons/15.10.14Team:Evry/Notebook/Transposons/15.10.142014-10-17T23:01:23Z<p>Chesne j: </p>
<hr />
<div><html><br />
<div class="cd-timeline-block"><br />
</html><br />
{{:Team:Evry/Notebook/CellCharacterization/Transformation/TopImage}}<br />
<html><br />
<div class="cd-timeline-content"><br />
<br />
<br />
<h4> 14.10.2014 ligation </h4><br />
<br><br><p><br />
it gave only one clone. <br />
<br><br><br />
Clone culture:<br />
<br>5 ml LB + 5 ul Kan (25 mg/ml) - 37 C°<br />
<br><br></p><br />
<br />
<h4> Transformation <i>Pseudovibrio denitrificans</i> & Dh5 alpha with mRFP in BBa_1413044 </h4><br />
<br><br><p><br />
electrocompetent cells:<br />
<br><br><br />
1 mm cuvette; 1800 V<br />
<br>recuperation media: MB for <i>Pseudovibrio denitrificans</i> , LB for DH5alpha<br />
<br><br><br />
plating:<br />
<br><br><br />
MB agar for <i>Pseudovibrio denitrificans</i><br />
<br>LB agar for LB for DH5alpha<br />
<br><br></p><br />
<h4> Transformation <i>Pseudovibrio denitrificans</i> & Dh5 alpha with BBa_1413001 in BBa_1413044 </h4><br />
<br><br><p><br />
electrocompetent cells:<br />
<br><br><br />
1 mm cuvette; 1800 V<br />
<br>recuperation media: MB for <i>Pseudovibrio denitrificans</i> , LB for DH5alpha<br />
<br><br><br />
<br>plating:<br />
<br><br><br />
MB agar for <i>Pseudovibrio denitrificans</i><br />
<br>LB agar for LB for DH5alpha<br />
<br><br></p><br />
<div align="center"><br />
<img src="" width="50%"/><br />
</div><br />
<br><br><br />
<h4> Verification testing of pnK2 in <i>Pseudovibrio denitrificans</i> </h4><br />
<br><br><p><br />
16 clones of <i>Pseudovibrio denitrificans</i> were grown in 3 ml MB, 30 C°, 24h<br />
<br><br><br />
DNA extraction:<br />
<br><br><br />
Invitrogen DNA extraction kit used with the Gram - protocol.<br />
<br>nanodrops gave value between 80 ng/ul & 130 ng/ul<br />
<br><br><br />
PCR for Kan gene insertion:<br />
<br>PCR: enzyme: Q5; template: 200 ng genomic preparation <i>Pseudovibrio denitrificans</i>; oligo: F 82/ R 83; Tm tested: 55; elongation time: 2m00s<br />
<br><br></p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/6/6c/Kan.JPG" width="50%"/></div><br />
<br><br><p><br />
PCR for <i>Pseudovibrio denitrificans</i> specific oligo:<br />
<br>PCR: enzyme: Q5; template: 200 ng genomic preparation <i>Pseudovibrio denitrificans</i>; oligo: F 72/ R 73; Tm tested: 55; elongation time: 2m00s<br />
<br><br></p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/e/e7/Evry_Pseudo_spe.JPG" width="50%"/></div><br />
<br><br><p><br />
As a control we tested the specificity of our oligo on the strain we work with:<br />
<br><div align="center"><img src="https://static.igem.org/mediawiki/2014/0/0b/Pseudo_spe.JPG"width="50%"/></div><br />
<br></p><br />
<br />
<span class="cd-date">Oct 15</span> <br />
</div><br />
</div><br />
</html></div>Chesne jhttp://2014.igem.org/Team:Evry/Notebook/Transposons/16.10.14Team:Evry/Notebook/Transposons/16.10.142014-10-17T22:56:54Z<p>Chesne j: </p>
<hr />
<div><html><br />
<div class="cd-timeline-block"><br />
</html><br />
{{:Team:Evry/Notebook/CellCharacterization/Transformation/TopImage}}<br />
<html><br />
<div class="cd-timeline-content"><br />
<br />
<br />
<br><br />
<h4> Show BBa_1413044 work even empty in DH5alpha </h4><br />
<br><br><p><br />
8 colonies of DH5alpha were transformed with BBa_1413044 and grown in 3 ml LB + 2 negative control<br />
<br><br><br />
<br />
Preparation for PCR colony: <br />
<br>Spin down 500 ul culture at 14000 g - 2 min, resuspend in 100 ul H20 MilliQ, put at 95 C° for 10 min then spin down at 14000 g - 2 min.<br />
<br><br><br />
PCR: enzyme: Q5; template: 3 ul of supernatent for the culture; oligo: F 100/ R 101; Tm tested: 55; elongation time: 1m00s<br />
<br><br></p><br />
<br />
<img src="https://static.igem.org/mediawiki/2014/b/b9/Evry_Is_ecoli.JPG" width="50%"/><br />
<br><br><br />
<h4> defining where the transposase integrate </h4><br />
<br><br><p><br />
find enzyme with a good cut numbers in the genome and not in our insert: HindIII<br />
<br />
Digestion of 8 <i>Pseudovibrio denitrificans</i> DNA preparation by HindIII<br />
<br>50ul final volume, 200 ng DNA preparation, 5 ul Neb 2.1 buffer, 38 ul H2O, 1 ul HindIII. 1h<br />
<br />
<br><br>Then religate:<br />
<br>Ligation: 20 ul final volume, 2 ul 10x T4 ligase buffer, 1 ul T4<br />
<br />
<br><br>then light digestion with XbaI<br />
<br>50ul final volume, 20 ul DNA religated preparation, 5 ul Neb 2.1 buffer, 38 ul H2O, 1 ul XbaI enzyme. 15 min<br />
<br>deactivation at 80 C° for 20 min<br />
<br />
<br><br>then PCR<br />
<br>PCR: enzyme: Q5; template: 3 ul of digestion by XbaI; oligo: F 105/ R 106; Tm tested: 55; elongation time: 4m00s<br />
</p><br />
<br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2014/a/af/Evry_Genome_cut_religated.JPG" width="50%"/><br />
<br><br><br />
<br />
<span class="cd-date">Oct 16</span> <br />
</div><br />
</div><br />
</html></div>Chesne jhttp://2014.igem.org/Team:Evry/Notebook/Transposons/16.10.14Team:Evry/Notebook/Transposons/16.10.142014-10-17T22:54:46Z<p>Chesne j: </p>
<hr />
<div><html><br />
<div class="cd-timeline-block"><br />
</html><br />
{{:Team:Evry/Notebook/CellCharacterization/Transformation/TopImage}}<br />
<html><br />
<div class="cd-timeline-content"><br />
<br />
<br />
<br><br />
<h4> Show BBa_1413044 work even empty in DH5alpha </h4><br />
<br><br><p><br />
8 colonies of DH5alpha were transformed with BBa_1413044 and grown in 3 ml LB + 2 negative control<br />
<br><br><br />
<br />
Preparation for PCR colony: <br />
<br>Spin down 500 ul culture at 14000 g - 2 min, resuspend in 100 ul H20 MilliQ, put at 95 C° for 10 min then spin down at 14000 g - 2 min.<br />
<br><br><br />
PCR: enzyme: Q5; template: 3 ul of supernatent for the culture; oligo: F 100/ R 101; Tm tested: 55; elongation time: 1m00s<br />
<br><br></p><br />
<br />
<img src="https://static.igem.org/mediawiki/2014/b/b9/Evry_Is_ecoli.JPG" width="50%"/><br />
<br><br><br />
<h4> defining where the transposase integrate </h4><br />
<br><br><p><br />
find enzyme with a good cut numbers in the genome and not in our insert: HindIII<br />
<br />
Digestion of 8 <i>Pseudovibrio denitrificans</i> DNA preparation by HindIII<br />
<br>50ul final volume, 200 ng DNA preparation, 5 ul Neb 2.1 buffer, 38 ul H2O, 1 ul HindIII. 1h<br />
<br />
<br><br>Then religate:<br />
<br>Ligation: 20 ul final volume, 2 ul 10x T4 ligase buffer, 1 ul T4<br />
<br />
<br><br>then light digestion with XbaI<br />
<br>50ul final volume, 20 ul DNA religated preparation, 5 ul Neb 2.1 buffer, 38 ul H2O, 1 ul XbaI enzyme. 15 min<br />
<br>deactivation at 80 C° for 20 min<br />
<br />
<br><br>then PCR<br />
<br>PCR: enzyme: Q5; template: 3 ul of digestion by XbaI; oligo: F 105/ R 106; Tm tested: 55; elongation time: 4m00s<br />
</p><br />
<br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2014/a/af/Evry_Genome_cut_religated.JPG" width="50%"/><br />
<br />
<br />
<span class="cd-date">Oct 16</span> <br />
</div><br />
</div><br />
</html></div>Chesne jhttp://2014.igem.org/Team:Evry/Notebook/Transposons/16.10.14Team:Evry/Notebook/Transposons/16.10.142014-10-17T22:53:15Z<p>Chesne j: </p>
<hr />
<div><html><br />
<div class="cd-timeline-block"><br />
</html><br />
{{:Team:Evry/Notebook/CellCharacterization/Transformation/TopImage}}<br />
<html><br />
<div class="cd-timeline-content"><br />
<br />
<br />
<br><br />
<h4> Show BBa_1413044 work even empty in DH5alpha </h4><br />
<br><br><p><br />
8 colonies of DH5alpha were transformed with BBa_1413044 and grown in 3 ml LB + 2 negative control<br />
<br><br><br />
<br />
Preparation for PCR colony: <br />
<br>Spin down 500 ul culture at 14000 g - 2 min, resuspend in 100 ul H20 MilliQ, put at 95 C° for 10 min then spin down at 14000 g - 2 min.<br />
<br><br><br />
PCR: enzyme: Q5; template: 3 ul of supernatent for the culture; oligo: F 100/ R 101; Tm tested: 55; elongation time: 1m00s<br />
<br><br></p><br />
<div align="center"><br />
<img src="https://static.igem.org/mediawiki/2014/b/b9/Evry_Is_ecoli.JPG" width="50%"/></div><br />
<br><br><br />
<h4> defining where the transposase integrate </h4><br />
<br><br><p><br />
find enzyme with a good cut numbers in the genome and not in our insert: HindIII<br />
<br />
Digestion of 8 <i>Pseudovibrio denitrificans</i> DNA preparation by HindIII<br />
<br>50ul final volume, 200 ng DNA preparation, 5 ul Neb 2.1 buffer, 38 ul H2O, 1 ul HindIII. 1h<br />
<br />
<br><br>Then religate:<br />
<br>Ligation: 20 ul final volume, 2 ul 10x T4 ligase buffer, 1 ul T4<br />
<br />
<br><br>then light digestion with XbaI<br />
<br>50ul final volume, 20 ul DNA religated preparation, 5 ul Neb 2.1 buffer, 38 ul H2O, 1 ul XbaI enzyme. 15 min<br />
<br>deactivation at 80 C° for 20 min<br />
<br />
<br><br>then PCR<br />
<br>PCR: enzyme: Q5; template: 3 ul of digestion by XbaI; oligo: F 105/ R 106; Tm tested: 55; elongation time: 4m00s<br />
</p><br />
<br><br><br />
<div align="center"><br />
<img src="https://static.igem.org/mediawiki/2014/a/af/Evry_Genome_cut_religated.JPG" width="50%"/></div><br />
<br />
<br />
<span class="cd-date">Oct 16</span> <br />
</div><br />
</div><br />
</html></div>Chesne jhttp://2014.igem.org/Team:Evry/Notebook/Transposons/16.10.14Team:Evry/Notebook/Transposons/16.10.142014-10-17T22:49:19Z<p>Chesne j: </p>
<hr />
<div><html><br />
<div class="cd-timeline-block"><br />
</html><br />
{{:Team:Evry/Notebook/CellCharacterization/Transformation/TopImage}}<br />
<html><br />
<div class="cd-timeline-content"><br />
<br />
<br />
<br><br />
<h4> Show BBa_1413044 work even empty in DH5alpha </h4><br />
<br><br><p><br />
8 colonies of DH5alpha were transformed with BBa_1413044 and grown in 3 ml LB + 2 negative control<br />
<br><br><br />
<br />
Preparation for PCR colony: <br />
<br>Spin down 500 ul culture at 14000 g - 2 min, resuspend in 100 ul H20 MilliQ, put at 95 C° for 10 min then spin down at 14000 g - 2 min.<br />
<br><br><br />
PCR: enzyme: Q5; template: 3 ul of supernatent for the culture; oligo: F 100/ R 101; Tm tested: 55; elongation time: 1m00s<br />
<br><br></p><br />
<div align="center"><br />
<img src="https://static.igem.org/mediawiki/2014/b/b9/Evry_Is_ecoli.JPG" width="50%"/></div><br />
<br><br><br />
<h4> defining where the transposase integrate </h4><br />
<br><br><p><br />
find enzyme with a good cut numbers in the genome and not in our insert: HindIII<br />
<br />
Digestion of 8 <i>Pseudovibrio denitrificans</i> DNA preparation by HindIII<br />
<br>50ul final volume, 200 ng DNA preparation, 5 ul Neb 2.1 buffer, 38 ul H2O, 1 ul HindIII. 1h<br />
<br />
<br><br>Then religate:<br />
<br>Ligation: 20 ul final volume, 2 ul 10x T4 ligase buffer, 1 ul T4<br />
<br />
<br><br>then light digestion with XbaI<br />
<br>50ul final volume, 20 ul DNA religated preparation, 5 ul Neb 2.1 buffer, 38 ul H2O, 1 ul XbaI enzyme. 15 min<br />
<br>deactivation at 80 C° for 20 min<br />
<br />
<br><br>then PCR<br />
<br>PCR: enzyme: Q5; template: 3 ul of digestion by XbaI; oligo: F 105/ R 106; Tm tested: 55; elongation time: 4m00s<br />
</p><br />
<br><br><br />
<div align="center"><br />
<img src="https://static.igem.org/mediawiki/2014/a/af/Evry_Genome_cut_religated.JPG" width="50%"/></div><br />
<br />
</p><br />
<span class="cd-date">Oct 16</span> <br />
</div><br />
</div><br />
</html></div>Chesne jhttp://2014.igem.org/Team:Evry/Notebook/Transposons/15.10.14Team:Evry/Notebook/Transposons/15.10.142014-10-17T22:47:32Z<p>Chesne j: </p>
<hr />
<div><html><br />
<div class="cd-timeline-block"><br />
</html><br />
{{:Team:Evry/Notebook/CellCharacterization/Transformation/TopImage}}<br />
<html><br />
<div class="cd-timeline-content"><br />
<br />
<br />
<h4> 14.10.2014 ligation </h4><br />
<br><br><p><br />
it gave only one clone. <br />
<br><br><br />
Clone culture:<br />
<br>5 ml LB + 5 ul Kan (25 mg/ml) - 37 C°<br />
<br><br></p><br />
<br />
<h4> Transformation <i>Pseudovibrio denitrificans</i> & Dh5 alpha with mRFP in BBa_1413044 </h4><br />
<br><br><p><br />
electrocompetent cells:<br />
<br><br><br />
1 mm cuvette; 1800 V<br />
<br>recuperation media: MB for <i>Pseudovibrio denitrificans</i> , LB for DH5alpha<br />
<br><br><br />
plating:<br />
<br><br><br />
MB agar for <i>Pseudovibrio denitrificans</i><br />
<br>LB agar for LB for DH5alpha<br />
<br><br></p><br />
<div align="center"><br />
<img src="" width="50%"/><br />
</div><br />
<br><br><br />
<h4> Transformation <i>Pseudovibrio denitrificans</i> & Dh5 alpha with BBa_1413001 in BBa_1413044 </h4><br />
<br><br><p><br />
electrocompetent cells:<br />
<br><br><br />
1 mm cuvette; 1800 V<br />
<br>recuperation media: MB for <i>Pseudovibrio denitrificans</i> , LB for DH5alpha<br />
<br><br><br />
<br>plating:<br />
<br><br><br />
MB agar for <i>Pseudovibrio denitrificans</i><br />
<br>LB agar for LB for DH5alpha<br />
<br><br></p><br />
<div align="center"><br />
<img src="" width="50%"/><br />
</div><br />
<br><br><br />
<h4> Verification testing of pnK2 in <i>Pseudovibrio denitrificans</i> </h4><br />
<br><br><p><br />
16 clones of <i>Pseudovibrio denitrificans</i> were grown in 3 ml MB, 30 C°, 24h<br />
<br><br><br />
DNA extraction:<br />
<br><br><br />
Invitrogen DNA extraction kit used with the Gram - protocol.<br />
<br>nanodrops gave value between 80 ng/ul & 130 ng/ul<br />
<br><br><br />
PCR for Kan gene insertion:<br />
<br>PCR: enzyme: Q5; template: 200 ng genomic preparation <i>Pseudovibrio denitrificans</i>; oligo: F 82/ R 83; Tm tested: 55; elongation time: 2m00s<br />
<br><br></p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/6/6c/Kan.JPG" width="50%"/></div><br />
<br><br><p><br />
PCR for <i>Pseudovibrio denitrificans</i> specific oligo:<br />
<br>PCR: enzyme: Q5; template: 200 ng genomic preparation <i>Pseudovibrio denitrificans</i>; oligo: F 72/ R 73; Tm tested: 55; elongation time: 2m00s<br />
<br><br></p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/e/e7/Evry_Pseudo_spe.JPG" width="50%"/></div><br />
<br><br><br />
<br />
<span class="cd-date">Oct 15</span> <br />
</div><br />
</div><br />
</html></div>Chesne jhttp://2014.igem.org/Team:Evry/Notebook/Transposons/15.10.14Team:Evry/Notebook/Transposons/15.10.142014-10-17T22:46:11Z<p>Chesne j: </p>
<hr />
<div><html><br />
<div class="cd-timeline-block"><br />
</html><br />
{{:Team:Evry/Notebook/CellCharacterization/Transformation/TopImage}}<br />
<html><br />
<div class="cd-timeline-content"><br />
<br />
<br />
<h4> 14.10.2014 ligation </h4><br />
<br><br><p><br />
it gave only one clone. <br />
<br><br><br />
Clone culture:<br />
<br>5 ml LB + 5 ul Kan (25 mg/ml) - 37 C°<br />
<br><br></p><br />
<br />
<h4> Transformation <i>Pseudovibrio denitrificans</i> & Dh5 alpha with mRFP in BBa_1413044 </h4><br />
<br><br><p><br />
electrocompetent cells:<br />
<br><br><br />
1 mm cuvette; 1800 V<br />
<br>recuperation media: MB for <i>Pseudovibrio denitrificans</i> , LB for DH5alpha<br />
<br><br><br />
plating:<br />
<br><br><br />
MB agar for <i>Pseudovibrio denitrificans</i><br />
<br>LB agar for LB for DH5alpha<br />
<br><br></p><br />
<img src="" width="50%"/><br />
<br />
<br><br><br />
<h4> Transformation <i>Pseudovibrio denitrificans</i> & Dh5 alpha with BBa_1413001 in BBa_1413044 </h4><br />
<br><br><p><br />
electrocompetent cells:<br />
<br><br><br />
1 mm cuvette; 1800 V<br />
<br>recuperation media: MB for <i>Pseudovibrio denitrificans</i> , LB for DH5alpha<br />
<br><br><br />
<br>plating:<br />
<br><br><br />
MB agar for <i>Pseudovibrio denitrificans</i><br />
<br>LB agar for LB for DH5alpha<br />
<br><br></p><br />
<img src="" width="50%"/><br />
<br><br><br />
<h4> Verification testing of pnK2 in <i>Pseudovibrio denitrificans</i> </h4><br />
<br><br><p><br />
16 clones of <i>Pseudovibrio denitrificans</i> were grown in 3 ml MB, 30 C°, 24h<br />
<br><br><br />
DNA extraction:<br />
<br><br><br />
Invitrogen DNA extraction kit used with the Gram - protocol.<br />
<br>nanodrops gave value between 80 ng/ul & 130 ng/ul<br />
<br><br><br />
PCR for Kan gene insertion:<br />
<br>PCR: enzyme: Q5; template: 200 ng genomic preparation <i>Pseudovibrio denitrificans</i>; oligo: F 82/ R 83; Tm tested: 55; elongation time: 2m00s<br />
<br><br></p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/6/6c/Kan.JPG" width="50%"/></div><br />
<br><br><p><br />
PCR for <i>Pseudovibrio denitrificans</i> specific oligo:<br />
<br>PCR: enzyme: Q5; template: 200 ng genomic preparation <i>Pseudovibrio denitrificans</i>; oligo: F 72/ R 73; Tm tested: 55; elongation time: 2m00s<br />
<br><br></p><br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/e/e7/Evry_Pseudo_spe.JPG" width="50%"/></div><br />
<br><br><br />
<br />
<span class="cd-date">Oct 15</span> <br />
</div><br />
</div><br />
</html></div>Chesne jhttp://2014.igem.org/Team:Evry/Notebook/Transposons/15.10.14Team:Evry/Notebook/Transposons/15.10.142014-10-17T22:44:10Z<p>Chesne j: </p>
<hr />
<div><html><br />
<div class="cd-timeline-block"><br />
</html><br />
{{:Team:Evry/Notebook/CellCharacterization/Transformation/TopImage}}<br />
<html><br />
<div class="cd-timeline-content"><br />
<br />
<br />
<h4> 14.10.2014 ligation </h4><br />
<br><br><p><br />
it gave only one clone. <br />
<br><br><br />
Clone culture:<br />
<br>5 ml LB + 5 ul Kan (25 mg/ml) - 37 C°<br />
<br><br><br />
<h4> Transformation <i>Pseudovibrio denitrificans</i> & Dh5 alpha with mRFP in BBa_1413044 </h4><br />
<br><br><br />
electrocompetent cells:<br />
<br><br><br />
1 mm cuvette; 1800 V<br />
<br>recuperation media: MB for <i>Pseudovibrio denitrificans</i> , LB for DH5alpha<br />
<br><br><br />
plating:<br />
<br><br><br />
MB agar for <i>Pseudovibrio denitrificans</i><br />
<br>LB agar for LB for DH5alpha<br />
<br><br></p><br />
<img src="" width="50%"/><br />
<br />
<br><br><p><br />
<h4> Transformation <i>Pseudovibrio denitrificans</i> & Dh5 alpha with BBa_1413001 in BBa_1413044 </h4><br />
<br><br><br />
electrocompetent cells:<br />
<br><br><br />
1 mm cuvette; 1800 V<br />
<br>recuperation media: MB for <i>Pseudovibrio denitrificans</i> , LB for DH5alpha<br />
<br><br><br />
<br>plating:<br />
<br><br><br />
MB agar for <i>Pseudovibrio denitrificans</i><br />
<br>LB agar for LB for DH5alpha<br />
<br><br><br />
<img src="" width="50%"/><br />
<br><br><br />
<h4> Verification testing of pnK2 in <i>Pseudovibrio denitrificans</i> </h4><br />
<br><br><br />
16 clones of <i>Pseudovibrio denitrificans</i> were grown in 3 ml MB, 30 C°, 24h<br />
<br><br><br />
DNA extraction:<br />
<br><br><br />
Invitrogen DNA extraction kit used with the Gram - protocol.<br />
<br>nanodrops gave value between 80 ng/ul & 130 ng/ul<br />
<br><br><br />
PCR for Kan gene insertion:<br />
<br>PCR: enzyme: Q5; template: 200 ng genomic preparation <i>Pseudovibrio denitrificans</i>; oligo: F 82/ R 83; Tm tested: 55; elongation time: 2m00s<br />
<br><br><br />
<img src="https://static.igem.org/mediawiki/2014/6/6c/Kan.JPG" width="50%"/><br />
<br><br><br />
PCR for <i>Pseudovibrio denitrificans</i> specific oligo:<br />
<br>PCR: enzyme: Q5; template: 200 ng genomic preparation <i>Pseudovibrio denitrificans</i>; oligo: F 72/ R 73; Tm tested: 55; elongation time: 2m00s<br />
<br><br><br />
<img src="https://static.igem.org/mediawiki/2014/e/e7/Evry_Pseudo_spe.JPG" width="50%"/><br />
<br><br><br />
</p><br />
<span class="cd-date">Oct 15</span> <br />
</div><br />
</div><br />
</html></div>Chesne jhttp://2014.igem.org/Team:Evry/Notebook/Transposons/14.10.14Team:Evry/Notebook/Transposons/14.10.142014-10-17T22:42:58Z<p>Chesne j: </p>
<hr />
<div><html><br />
<div class="cd-timeline-block"><br />
</html><br />
{{:Team:Evry/Notebook/CellCharacterization/Transformation/TopImage}}<br />
<html><br />
<div class="cd-timeline-content"><br />
<br />
<p align="justify"><br />
<br />
<h4> Ligation of BBa_K1413001 </h4><br />
<br><br />
<p><br />
strategy:</p><br />
<br><div align="center"><br />
<img src="https://static.igem.org/mediawiki/2014/9/95/Evry_Strat2.jpg" width="50%"/></div><br />
<br><br />
<p><br />
Digestion of BBa_K1413001 by E/S :<br />
<br>50 ul final volume, 5 ul Buffer NeB 3.1, 5 ul (35 ng/ul) BBa_1413001 in pSB1C3, 1 ul E/S, 39 ul H2O. 1h<br />
<br>Then Thermoscientific "PCR clean up" Kit in 30 ul final elution</p><br />
<br><br><br />
<p><br />
Digestion of Kan 82/83 by E/S & X/P:<br />
<br>50 ul final volume, 5 ul Buffer NeB 4.1, 5 ul (30 ng/ul) Kan 82/83 in pSB1C3, 1 ul E/S or X/P, 38ul H2O. 1h<br />
<br>Then Thermoscientific "PCR clean up" Kit in 30 ul final elution<br />
<br><br><br />
Ligation: <br />
<br>I° strategy:<br />
<br> 20 ul final volume, 5 ul Buffer T4 fermentas, 3 ul digestion product BBa_K1413001 by E/S + 3 ul Kan 82/83 + 5 BBa_1413044 transposon plasmid. 4 ul H2O. 1 ul T4 ligase. 1h<br />
<br><br><br />
II° Strategy:<br />
<br> 20 ul final volume, 5 ul Buffer T4 fermentas, 3 ul digestion product BBa_K1413001 by E/S + 5 BBa_1413044 transposon plasmid. 4 ul H2O.1 ul T4 ligase. 1h<br />
<br><br><br />
<br />
Clean up:<br />
<br>II° strategy:<br />
<br>Ligation product by Thermoscientific "PCR clean up" Kit in 30 ul final elution<br />
<br><br><br />
<br />
Digestion: II° strategy<br />
<br> 50 ul final volume, 5 ul Buffer NeB 4.1, 5 ul ligation product, 1 ul E/X, 39 ul H2O. 1h<br />
<br>Then Thermoscientific "PCR clean up" Kit in 30 ul final elution<br />
<br><br><br />
Ligation:<br />
<br><br />
II° Strategy:<br />
<br> 20 ul final volume, 5 ul Buffer T4 fermentas, 3 ul ligation product E/X + 5 ul Kan 82/83 E/S. 4 ul H2O. 1h<br />
<br><br><br />
Transformation: electrocompetent<br />
<br><br><br />
50ul electrocompetent cells<br />
2 ul Ligation product of I° strategy / II° strategy in <i>E.coli DH5alpha</i>.<br />
<br></p><br />
<br />
<br />
<br />
</p><br />
<span class="cd-date">Oct 14</span> <br />
</div><br />
</div><br />
</html></div>Chesne jhttp://2014.igem.org/Team:Evry/Notebook/Transposons/13.10.14Team:Evry/Notebook/Transposons/13.10.142014-10-17T22:41:16Z<p>Chesne j: </p>
<hr />
<div><html><br />
<div class="cd-timeline-block"><br />
</html><br />
{{:Team:Evry/Notebook/CellCharacterization/Transformation/TopImage}}<br />
<html><br />
<div class="cd-timeline-content"><br />
<br />
<br />
<br />
<h4> BBa_1413044 retrieval of the transposon plasmid </h4><br />
<br><p><br />
strategy:</p><br />
<div align="center"><br />
<br><img src="https://static.igem.org/mediawiki/2014/3/33/Evry_Strat1.jpg" width="75%"/></div><br />
<br><br />
<p><br />
Digestion of BBa_1413044 by BglII :<br />
<br>50 ul final volume, 5 ul Buffer NeB 3.1, 5 ul (20 ng/ul) BBa_1413044 in pSB1C3, 1 ul BglII, 39 ul H2O.<br />
<br><br />
Gel electrophoresis:<br />
<br><div align="center"><br />
<img src="https://static.igem.org/mediawiki/2014/3/31/Evry_Bba_transpo.JPG" width="25%"/></div><br />
<br><br />
Purification sur gel:<br />
<br><br />
Kit thermoscientific "Gel extraction". Elution final in 30 ul.<br />
<br></p><br />
<h4>Obtaining the Kan gene on pNK2</h4><br />
<br><p><br />
PCR: enzyme: Q5; template: 150 ng pNK2 first three well from new stock, next ones the old stock; oligo: F 82/ R 83; Tm tested: 55/60/65; elongation time: 1m30s<br />
<br></p><div align="center"><br />
<img src="https://static.igem.org/mediawiki/2014/9/90/Evry_Kan_extract.JPG" width="40%"/></div><br />
<br><p><br />
Purification sur gel:<br />
<br><br />
Kit thermoscientific "Gel extraction". Elution final in 30 ul.<br />
<br></p><br />
<br />
<br />
</p><br />
<span class="cd-date">Oct 13</span> <br />
</div><br />
</div><br />
</html></div>Chesne jhttp://2014.igem.org/Team:Evry/Notebook/Transposons/13.10.14Team:Evry/Notebook/Transposons/13.10.142014-10-17T22:40:37Z<p>Chesne j: </p>
<hr />
<div><html><br />
<div class="cd-timeline-block"><br />
</html><br />
{{:Team:Evry/Notebook/CellCharacterization/Transformation/TopImage}}<br />
<html><br />
<div class="cd-timeline-content"><br />
<br />
<br />
<br />
<h4> BBa_1413044 retrieval of the transposon plasmid </h4><br />
<br><p><br />
strategy:</p><br />
<br><img src="https://static.igem.org/mediawiki/2014/3/33/Evry_Strat1.jpg" width="75%"/><br />
<br><br />
<p><br />
Digestion of BBa_1413044 by BglII :<br />
<br>50 ul final volume, 5 ul Buffer NeB 3.1, 5 ul (20 ng/ul) BBa_1413044 in pSB1C3, 1 ul BglII, 39 ul H2O.<br />
<br><br />
Gel electrophoresis:<br />
<br><div align="center"><br />
<img src="https://static.igem.org/mediawiki/2014/3/31/Evry_Bba_transpo.JPG" width="25%"/></div><br />
<br><br />
Purification sur gel:<br />
<br><br />
Kit thermoscientific "Gel extraction". Elution final in 30 ul.<br />
<br></p><br />
<h4>Obtaining the Kan gene on pNK2</h4><br />
<br><p><br />
PCR: enzyme: Q5; template: 150 ng pNK2 first three well from new stock, next ones the old stock; oligo: F 82/ R 83; Tm tested: 55/60/65; elongation time: 1m30s<br />
<br></p><div algn="center"><br />
<img src="https://static.igem.org/mediawiki/2014/9/90/Evry_Kan_extract.JPG" width="40%"/></div><br />
<br><p><br />
Purification sur gel:<br />
<br><br />
Kit thermoscientific "Gel extraction". Elution final in 30 ul.<br />
<br></p><br />
<br />
<br />
</p><br />
<span class="cd-date">Oct 13</span> <br />
</div><br />
</div><br />
</html></div>Chesne jhttp://2014.igem.org/Team:Evry/Notebook/CellCharacterization/Antibiotic_test/08-19-2014Team:Evry/Notebook/CellCharacterization/Antibiotic test/08-19-20142014-10-17T22:34:37Z<p>Chesne j: </p>
<hr />
<div><html><br />
<div class="cd-timeline-block"><br />
</html><br />
{{:Team:Evry/Notebook/CellCharacterization/Antibiotic/TopImage}}<br />
<html><br />
<div class="cd-timeline-content"><br />
<p align="justify"<br />
<u><big><b><FONT COLOR=#003333>Antibiotics' tests in liquid M9 1X - Results Day1</font></b></big></u> <br><br />
<ul><br />
<li>Chloramphenicol<br />
<img src="https://static.igem.org/mediawiki/2014/2/29/Chloramphenicol.jpg" alt="GROSSE NAZE T'AS PAS REUSSI A METTRE L'IMAGE" style="wight:60%;height:60%" /><br />
<br />
<li>Kanamycin<br />
<img src="https://static.igem.org/mediawiki/2014/f/f9/Kanamycine_M9_J1.jpg" alt="GROSSE NAZE T'AS PAS REUSSI A METTRE L'IMAGE" style="wight:60%;height:60%" /><br />
Because of technical problems, the tests on E.Coli+KanR are launched with a gap of few days.<br />
<br />
<li>Ampicilin<br />
<img src="https://static.igem.org/mediawiki/2014/6/69/Ampiciline_M9_J1.jpg" alt="GROSSE NAZE T'AS PAS REUSSI A METTRE L'IMAGE" style="wight:60%;height:60%" /><br />
<br />
<li>Tetracyclin<br />
<img src="https://static.igem.org/mediawiki/2014/8/8c/Tetracycline_M9_J1.jpg" alt="GROSSE NAZE T'AS PAS REUSSI A METTRE L'IMAGE" style="wight:60%;height:60%" /><br />
<br />
<li>Erythromycin<br />
<img src="https://static.igem.org/mediawiki/2014/0/0c/Erythromycine_M9_J1.jpg" alt="GROSSE NAZE T'AS PAS REUSSI A METTRE L'IMAGE" style="wight:60%;height:60%" /><br />
<br />
<div align="center"><br />
<img src="https://static.igem.org/mediawiki/2014/4/4a/Graphe_J1%282%29.jpg" alt="GROSSE NAZE T'AS PAS REUSSI A METTRE L'IMAGE" style="wight:60%;height:60%" /><br />
</div><br />
<br />
<br />
</p><br />
<span class="cd-date">Aug 19</span> <br />
</div><br />
</div><br />
</html></div>Chesne j