"

From 2014.igem.org

Pfu cloning and biobricking project

    Reference: Heo and Kim 2013. African Journal of Microbiology Research. 7(9) pp 745-750.

    Primers ordered from Invitrogen and brought up in 100 microliters water, split into two aliquots one placed
    in iGEM box in lab freezer, remaining in storage freezer

    Primers: Pfu N- ATGATTTTAGATGTGGATTACATAACTG   concentration=208 microMolar, Tm (50mM NaCl)= 58
             Pfu C- CTAGGATTTTTTAATGTTAAGCCAGG     Concentration=200 microMolar, Tm (50mM NaCl)= 60

             Pfu Nde   GGGAGCCATATGATTTTAGATGTGGATTACATA  concentration=240 microMolar, Tm (50mM NaCl)=68
             Pfu 1001R CCATAAAGGTTGTCCAACTAATCTTG         concentration=172 microMolar, Tm (50mM NaCl)=61
             Pfu 911R  CCTTGAGAGAGTTGCCAAATACTCG          concentration=188 microMolar, Tm (50mM NaCl)=65
             Pfu Xho   TCTATCGCTCGAGTAGGATTTTTTAATGTTAAGCCA concentration=204 microMolar, Tm (50mM NaCl)=71

 First PCR conditions: Template 2.5 microliter Pfu enzyme mix
                       Pfu-N    1.2 microliter of 1:10 dilution
                       Pfu-C    1.2 microliter of 1:10 dilution
                       dNTP     1.0 microliter of 10mM
                       Buffer   5.0 microliter
                       Enzyme   none in rxn1, 1.0 microliter Pfusion in rxn 2
                       H2O      to 50 microliters

  Positive control    Used E. coli genomic DNA and 16S primers to check function of enzyme and reagents
  Negative control    Water in place of template DNA

                  PCR program
                    Step 1  95 - 5 min
                    Step 2  95 - 40 sec
                    Step 3  60 - 40 sec
                    Step 4  72 - 3 min  
                      Go To step 2 40X
                    Step 5  72 - 10 min 
                    Step 6  4 - forever

7_30_2014

Plasmid Isolation of possible Pfu clones using one-step plasmid isolation procedure from Lezin et al, PLoS One August 2011 | Volume 6 | Issue 8 | e23457

4 samples from Red pool (Nde I-EcoRI fragment) G,F, I, J

4 samples from Blue pool (NdeI-XbaI) 4A, B, E, F

Next step restriction digests

WELCOME TO iGEM 2014! Your team has been approved and you are ready to start the iGEM season! On this page you can document your project, introduce your team members, document your progress and share your iGEM experience with the rest of the world! Click here to edit this page!
Home Team Official Team Profile Project Parts Modeling Notebook Safety Attributions
Notebook
You should make use of the calendar feature on the wiki and start a lab notebook. This may be looked at by the judges to see how your work progressed throughout the summer. It is a very useful organizational tool as well.