Team:Paris Bettencourt/Notebook/TMAU

Revision as of 03:18, 18 October 2014 by Roussetfrancois (Talk | contribs)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

June

June 24th

oPB.010 received
oPB.010
tmm Fw for BioBrick vector
TATAGAATTCGCGGCCGCTTCTAGAGCTGACAGCTAGCTCAGTCCTAG

June 29th

Goal: to PCR ilvBN gene from MG1655

Procedure:
1. Picked 2 colonies from the plate MG1655 115+GFP
2. inoculate them each in 50 ul of NF H2O
3. Boiled for 3 mins at 98 degree
4. use the solution as DNA template
5. follow standard PCR protocol from this step on

Reagent Volume 1x
Nuclease-free water 63 ul
5x Phusion HF Buffer 20 ul
10 mM dNTPs 2 ul
Forward Primer (10 uM) 5 ul
Reverse Primer (10 uM) 5 ul
Genomic DNA template 1 ul
DMSO 3 ul
Phusion DNA Polymerase 1 ul
Total Volume 100 ul

Thermocycler protocol: NEB Phusion
Temp Time
Start 98 ° C 30 sec Melt

35 Cycles
Cycle 1 98 ° C 10 sec Melt
Cycle 2 52 ° C 30 sec Anneal
Cycle 3 72 ° C 2 minutes Extend

Finish 72 ° C 5 min Extend
Blind 10 ° C Forever
Blind

outcome:

bands seen at expected length.

July

July 3rd

We made a PCR of our tmm gBlock using this protocol:

Reagent	Volume
	1X	4X
5X Phusion HF Buffer	20uL	80uL
10mM dNTPs	2uL	8uL
oPB.010 (forward primer)	1uL	4uL
oPB.012 (reverse primer)	1uL	4uL
DNA	1uL	4uL
DMSO	3uL	12uL
Phusion polymerase	1uL	4uL
Nuclease Free Water	71uL	284uL

We used this thermocycle:

	Temperature	Time
Start	98°C	30s
Cycle x35	98°C	10s
Cycle x35	52°C	30s
Cycle x35	72°C	30s
Finish	72°C	5min
Blind	10°C	-

After gel migration, we got this:

The PCR worked.

Miniprep using Thermo scientific kits

Digestion using EcoR1 and Pst1

Extracted plasmids from miniprep 22 uL 30uL
FD Buffer 5uL 5uL
Pst1 2.5uL 2.5uL
EcoR1 2.5uL 2.5uL
NF Water 18uL 10uL

Incubation for 5min 37°C and 2 hours at room temperature.

Ligation of gBlock into Vector

PCR product: tmm gBlock with oPB.010 and oPB.012
Vector: pSB1C3 linearized

Concentration:
-digested PSB1C3: 4.6ng/uL
-digested tmm: 13.7ng/uL

Cohesive Ends
5X Ligase Reaction Buffer 4 μl

Insert: Vector Molar Ratio 3:1

Vector Ends 5ul

Insert Ends 5ul

Total DNA 0.092ug(0.01-0.1 μg)

T4 DNA Ligase 0.1 unit

Autoclaved distilled water to 20 μl

Incubate at 24°C for O/N.

Note: For optimal transformation, dilute the ligation reaction ≥ 5-fold, to at least 100 μl, before adding to competent cells

July 5th

Transformation of the part.

Strain: E.coli MG1655
plasmid: pPB.011

Heat Shock Transformation of E. coli

This protocol can be used to transform chemically competent (i.e. from CaCl2) with a miniprepped plasmid or a ligation product.

Note: Never vortex competent cells. Mix cells by gentle shaking.

No colonies after 24h, this might be due to the low concentration of reagents

July 12th

We transformed NEB and MG1655 with our ligation product according to this protocol

We finally had no colonies.

July 10th

1) Mini prep to extract plasmids (Qiagen)

I used this protocol. I made 2 tubes and got 163.2 and 242 ng/uL as concentrations.

2) Digestion of miniprep product with EcoR1 & Pst1

	Tube 1 (163ng/uL)	Tube 2 (242ng/uL)
pSB1C3 from miniprep	22uL	30uL
10X FD Buffer	5uL	5uL
PstI	2.5uL	2.5uL
EcoRI	2.5uL	2.5uL
NF Water	18uL	10uL

3) Gel migration

I had the digested pSB1C3 run on a gel using 0.5X TBE (2H-50V). We clearly saw a band at 2kb corresponding to pSB1C3. I cut the gel and stored it at 4°C.

July 11th

1) Gel purification of digested pSB1C3

I used this protocol

Result: I got concentrations of 59.6 and 55.1 ng/uL.

2) Ligation of digested tmm and digested pSB1C3

I used NEBiocalculator to calculate the mass of insert and vector I had to put (Insert length: 1488 bp, Vector length: 2037 bp, Vector DNA mass: 0,3 ug, Ratio insert:vector: 2:1). I need to put 450ng of insert and 300 ng of vector.

	Volume
Insert (tmm)	20uL of 10.1 ng/uL and 20uL of 13.7 ng/uL
Vector (pSB1C3)	5uL of 59.6ng/uL
T4 Ligase	3uL
T4 Ligase Buffer	6uL
NF Water	6uL

I incubated overnight at room temperature

July 14th

July 15th

1) Gel extraction of pSB1C3 digested plasmid

I used this protocol. I finally got 2 tubes with 13.9 and 19.8ng/uL concentrations.

2) PCR purification

I purified the PCR product of July 14th using this protocol.

3) Ligation of tmm PCR product and pSB1C3

I used NEBiocalculator to to calculate the needed amount of insert and vector with the values:

• Insert length: 1488 bp
• Vector length: 2037 bp
• Vector DNA mass: 50 ng
• Ratio insert: I made 1 ligation of ratio 1:1, 2:1 and 3:1 (insert:vector).

I made the ligation with the 13.9 ng/uL concentrated insert tube. I used this protocol:

	1:1	2:1	3:1
Digested tmm (insert)	1.5uL	3uL	4uL
Digested pSB1C3 (vector)	4uL	4uL	4uL
T4 Ligase	1uL	1uL	1uL
T4 Ligase Buffer	4uL	4uL	4uL
Nuclease Free water	9.5uL	8uL	7uL

I incubated the tubes at 24°C for 30min.

4) Transformation into NEB and MG1655

I used the Heat Shock transformation protocol to transform NEB and MG1655 with each one of the ligation products with ratios 1:1, 2:1 and 3:1 (I got 6 plates).

July 16th

1) Results of the transformations

We got no colonies in MG1655, big and small colonies for 1:1 and 2:1 ratios and only big colonies with 3:1 ratios. I prepared 5 liquid cultures in LB+Chloramphenicol: 1 for each type of colony for 1:1 and 2:1 ratios, and 1 for big colonies for 3:1 ratio. I incubated them at 37°C.

2) PCR colony

To check if the colonies developped in my plates have tmm gene, I made a PCR with this protocol and I ran a gel. I got nothing on it. I will do miniprep and digestion on July 17th to identify tmm construct into pSB1C3.

July 17th

1) Miniprep using each liquid culture of NEB+tmm-pSB1C3

I used this protocol.

2) Digestion of the plasmids by EcoRI

Then I digested the miniprep product by EcoRI in order to get a linearised plasmid before running it on a gel.

Reagent	Volume
Nuclease free water	12uL
10X Fast Digest Buffer	2uL
plasmid DNA	5uL
EcoRI	1uL
TOTAL	20uL

I incubated the tubes at 37°C during 30min.

3) Gel

I ran on a gel each one of the tubes (small and big colonies from 1:1 and 2:1 ratios and big colony from 3:1 ratio). But the plasmids may have not been digested enough because I got many bands.

July 18th

I will try again to identify tmm gene in my transformed bacteria.

1) Digestion of plasmids with EcoRI and PstI.

This time I digested by EcoRI and PstI to be able to directly identify tmm gene on the gel. I nanodroped the miniprep product from 17th. We need 1ug of DNA for the digestion.

	Concentration (ng/uL, given by Nanodrop)	Needed volume (uL)
big 1:1 ratio colony	316.4	3.5
small 2:1 ratio colony	156.9	7
big 2:1 ratio colony	207.6	5
big 3:1 ratio colony	207.6	4

Digestion protocol:

Reagent	big 1:1 ratio colony	small 2:1 ratio colony	big 2:1 ratio colony	big 3:1 ratio colony
Nuclease free water	13.5uL	10uL	12uL	13uL
10X Fast Digest Buffer	2uL	2uL	2uL	2uL
plasmid DNA	3.5uL	7uL	5uL	4uL
EcoRI	0.5uL	0.5uL	0.5uL	0.5uL
PstI	0.5uL	0.5uL	0.5uL	0.5uL
TOTAL	20uL	20uL	20uL	20uL

1)Gel

I ran all the samples on a gel but I did not get the bands I expected. We have to try a new cloning.

July 22nd

I had prepared liquid cultures to be able to do minipreps.

1) Miniprep of liquid cultures to get pSB1C3

I used this protocol. The Nanodrop gave me a concentration of 317ng/uL.

2) Digestion of pSB1C3 and tmm PCR product by EcoRI and PstI.

• pSB1C3:
  

  Reagent	Volume
  Nuclease free water	25uL
  10X Fast Digest Buffer	5uL
  plasmid DNA	14uL
  EcoRI	2.5uL
  PstI	2.5uL
  Fast AP (phosphatase)	1uL
  TOTAL	40uL



• tmm PCR product
  

  Reagent	Volume
  Nuclease free water	27uL
  10X Fast Digest Buffer	5uL
  plasmid DNA	13uL
  EcoRI	2.5uL
  PstI	2.5uL
  TOTAL	50uL

3)Gel

For pSB1C3 we can see two bands corresponding to 900bp and 2000bp (backbone) fragments. I will be able to extract the 2000bp fragment. But I got nothing for tmm.

4)Gel extraction

I used this protocol.

July 29th

We need tmm PCR product to be able to do a new cloning.

1) PCR of tmm gBlock

Reagent	Volume
	1X
5X Phusion HF Buffer	10uL
10mM dNTPs	1uL
oPB.010 (forward primer)	0.5uL
oPB.012 (reverse primer)	0.5uL
DNA	1uL
DMSO	1.5uL
Phusion polymerase	0.5uL
Nuclease Free Water	35uL

We used this thermocycle:

	Temperature	Time
Start	98°C	30s
Cycle x35	98°C	10s
Cycle x35	56°C for tube 1, 51°C for tubes 2 and 3	30s
Cycle x35	72°C	1min
Finish	72°C	5min
Blind	10°C	-

2) Gel

No bands were visible, even for the ladder. I tried a new one and got a few tiny bands for tube 3, particularly at 1500bp. I tried a gel extraction using this protocol and got 4.7ng/uL (unusable). I tried otherwise:

3) PCR purification

I puridied tube 3 according to this protocol and got a concentration of 11ng/uL which was not enough to do a digestion.

4) New PCR

Reagent	Volume
	1X
5X Phusion HF Buffer	10uL
10mM dNTPs	1uL
oPB.010 (forward primer)	0.5uL
oPB.012 (reverse primer)	0.5uL
DNA	1uL
DMSO	1.5uL
Phusion polymerase	0.5uL
Nuclease Free Water	35uL

We used this thermocycle:

	Temperature	Time
Start	98°C	30s
Cycle x35	98°C	10s
Cycle x35	55°C	30s
Cycle x35	72°C	1min
Finish	72°C	5min
Blind	10°C	-

3) PCR purification

I puridied tube 3 according to this protocol.

August

August 1st

1)Digestion of purified PCR product

Reagent	Volume
Nuclease free water	20uL
10X Fast Digest Buffer	20uL
plasmid DNA	7uL
EcoRI	0.5uL
PstI	0.5uL
TOTAL	50uL

I incubated the digestion at 37°C during 1h.

2) Purification of digested tmm

I used this protocol and got a really low concentration, unusable for ligation.

3) New PCR

I prepared 4 tubes according to this protocol:

Reagent	Volume
	1X
5X Phusion HF Buffer	10uL
10mM dNTPs	1uL
oPB.010 (forward primer)	0.5uL
oPB.012 (reverse primer)	0.5uL
DNA	1uL
DMSO	1.5uL
Phusion polymerase	0.5uL
Nuclease Free Water	35uL

We used this thermocycle:

	Temperature	Time
Start	98°C	30s
Cycle x35	98°C	10s
Cycle x35	51°C	30s
Cycle x35	72°C	1min
Finish	72°C	5min
Blind	10°C	-

4) Gel

Nothing was visible on the gel.

5) New PCR

Reagent	Volume
	1X
5X Phusion HF Buffer	20uL
10mM dNTPs	2uL
oPB.010 (forward primer)	5uL
oPB.012 (reverse primer)	5uL
DNA	1uL
DMSO	3uL
Phusion polymerase	2uL
Nuclease Free Water	53uL

We used this thermocycle:

	Temperature	Time
Start	98°C	30s
Cycle x35	98°C	10s
Cycle x35	50°C	30s
Cycle x35	72°C	45s
Finish	72°C	5min
Blind	10°C	-

6) Gel

There was a diffused band next to 200bp. Maybe there is a problem of specificity of the primers. We will try a PCR with the very first protocol which worked.

August 5th

1) PCR of tmm gBlock

Reagent	Volume
	1X
5X Phusion HF Buffer	20uL
10mM dNTPs	2uL
oPB.010 (forward primer)	1uL
oPB.012 (reverse primer)	1uL
tmm DNA	1uL
DMSO	3uL
Phusion polymerase	1uL
Nuclease Free Water	71uL

We used this thermocycle:

	Temperature	Time
Start	98°C	30s
Cycle x35	98°C	10s
Cycle x35	52°C	30s
Cycle x35	72°C	30s
Finish	72°C	5min
Blind	10°C	-

We still got nothing. We decided to design new primers.

August 6th

We think that that the reverse primer (oPB012) might have a strong secondary structure and that it may prevent the PCR to work as expected. We designed modified versions of oPB010 and oPB012 respectively called oPB056 and oPB057, shorter then the first ones. We removed the first restriction site at each end making sure the other enzyme would still have enough nucleotides to bind. We also shortened the bind part to have a melting temperature around 52°C.

oPB.010 TATAGAATTCGCGGCCGCTTCTAGAGCTGACAGCTAGCTCAGTCCTAG
-> oPB.056 CTTCTAGAGCTGACAGCTAGCTCAGTCC

oPB.012 TTAACTGCAGCGGCCGCTACTAGTATCAGTGGTGATGGTGATGATGGTTA
-> oPB.057 TACTAGTATCAGTGGTGATGGTGATGATG

Note:The digestion should now use XbaI and SpeI as EcorI and PstI were removed from the PCR product.

August 13th

We received our new primers (oPB.056 and oPB.057).

1) New PCR with different combinations or primers

We used this protocol:

Reagent	Tube 1	Tube 2	Tube 3	Tube 4
5X Phusion HF Buffer	20uL	20uL	20uL	20uL
10mM dNTPs	2uL	2uL	2uL	2uL
tmm DNA	10L	10L	10L	10L
DMSO	3uL	3uL	3uL	3uL
Phusion polymerase	2uL	2uL	2uL	2uL
Nuclease Free Water	53uL	53uL	53uL	53uL
oPB.010	5uL	-	5uL	-
oPB.012	5uL	-	-	5uL
oPB.056	-	5uL	-	5uL
oPB.057	-	5uL	5uL	-
TOTAL	100uL	100uL	100uL	100uL

We used this thermocycle:

	Temperature	Time
Start	98°C	30s
Cycle x35	98°C	10s
Cycle x35	52°C	30s
Cycle x35	72°C	30s
Finish	72°C	5min
Blind	10°C	-

August 14th

After having ran the PCR product on a gel, only one PCR seemed to have worked and the yield was very low. We made a new PCR with the same protocol except a longer elongation time (2min) and it worked: after purification, we got a concentration of 584ng/uL.

We also digested tmm PCR product, pSB1C3 and pSEVA351 before doing a ligation:

	tmm	pSEVA351	pSB1C3
NF Water	18uL	14uL	27uL
10X FD Buffer	4uL	4uL	4uL
XbaI	1uL	1uL	1uL
SpeI	1uL	1uL	1uL
DNA	14uL	18uL	5uL
FastAP	2uL	2uL	2uL
TOTAL	40uL	40uL	40uL

August 18th

The digestion products were purified and we got these concentrations: 84.1ng/uL for digested tmm, 41.1ng/uL for digested pSEVA351 and 28.6ng/uL digested pSB1C3.

The amounts of vector and insert were calculated thanks to NEBiocalculator with a insert:vector ratio of 2:1

	tmm+pSEVA351	tmm+pSB1C3
NF Water	14.5uL	12.5uL
10X T4 Buffer	2uL	2uL
T4 ligase	1uL	1uL
tmm	0.5uL	1.5uL
Vector	2uL	3uL

The tubes were incubated at 22°C for 1H and overnight at 16°C.

August 21st

E.coli competent cells (NEB turbo) were transformed with tmm+pSEVA351 and tmm+pSB1C3 ligation products using the Heat Shock transformation protocol. On August 22nd we got 4 colonies of NEB transformed with tmm+pSB1C3.

August 25th

A colony PCR was done with 2 different colonies but the result was not convincing.

August 27th

Miniprep and digestion were done using liquid culture of the 2 colonies.

	colony 1	colony 2
NF Water	14.5uL	12.5uL
10X FD Buffer	2uL	2uL
XbaI	1uL	1uL
SpeI	1uL	1uL
DNA	15uL	11uL
Fast AP	2uL	2uL
TOTAL	40uL	40uL

On the gel we can see a band at 1.5kb for colony 1 but not for colony 2. The cloning seems to have worked.

September

September 1st

tmm also has to be cloned using pSEVA351 so that we can transform into C.striatum.

E.coli was transformed using tmm+pSEVA351 ligation product from August 18th with electroporation. It did not work on the first time.

September 3rd

A new ligation of tmm and pSEVA351 was done:

NF Water	13.5uL
10X T4 Buffer	2uL
T4 ligase	1uL
tmm	1uL
pSEVA351	2.5uL

The tube was incubated 1H at 22°C and overnight at 4°C.

September 4th

A new electroporation was done with the same protocol.Some colonies developped. Two of them were transfered in LB+Chlormaphenicol and two glycerol stocks were made with the strains called sPB.054 and sPB.055. Analytical digestion was performed on these strains: miniprep and digestion using XbaI and SpeI. The gel showed nothing corresponding to tmm.

September 25th

The cloning was tried again from the beginning. 2 new pairs of primers were designed: 1 pair (oPB.087 and oPB.088) corresponding to pSB1C3 cloning including XbaI and PstI restriction sites and 1 pair (oPB.089 and oPB.090) corresponding to pSEVA315 cloning including XbaI and HindIII restriction sites. The gBlock was amplified using the first pair (PCR1) and the second pair (PCR2) of primers. The DNA template is tmm gBlock diluted 1:50.

Reagent	Volume
	1X	4X
5X Phusion HF Buffer	20uL	80uL
10mM dNTPs	2uL	8uL
Forward primer	1uL	4uL
Reverse primer	1uL	4uL
DNA	1uL	4uL
DMSO	3uL	12uL
Phusion polymerase	1uL	4uL
Nuclease Free Water	71uL	284uL

We used this thermocycle:

	Temperature	Time
Start	98°C	30s
Cycle x35	98°C	10s
Cycle x35	52°C	30s
Cycle x35	72°C	40s
Finish	72°C	5min
Blind	10°C	-

On the gel the bands look perfect. After purification, the concentration is 80ng/uL.

September 26th

The PCR products were digested:

1 - oPB.087 and oPB.088

Digest with XbaI, PstI. Product is 80 ng/ul.

Reagent	Volume
Nuclease free water	135uL
10X Fast Digest Buffer	20uL
PCR product	30uL
FastDigest XbaI	10uL
FastDigest PstI	10uL
TOTAL	200uL

The tubes were incubated at 37°C for 1H. After purification, the concentration was 26ng/uL.

2 - oPB.089 and oPB.090

Digest with XbaI, HindIII. Product is 80 ng/ul.

Reagent	Volume
Nuclease free water	135uL
10X Fast Digest Buffer	20uL
PCR product	30uL
FastDigest XbaI	10uL
FastDigest HindIII	10uL
TOTAL	200uL

The tubes were incubated at 37°C for 1H. After purification, the concentration was 33ng/uL.

Digestion of pSEVA315

Reagent	Volume
Nuclease free water	155uL
10X Fast Digest Buffer	20uL
Plasmid	15uL
FastDigest XbaI	5uL
FastDigest HindIII	5uL
FastAP	5uL
TOTAL	200uL

The tubes were incubated at 37°C for 1H. After purification, the concentration was 38ng/uL.

September 29th

Ligation and transformation

	Volume
Insert (XbaI, PstI) 26ng/uL	3uL
Digested pSB1C3 (XbaI, PstI) 6.5ng/uL	12uL
T4 Ligase	1uL
T4 Ligase Buffer	2uL
NF Water	2uL
TOTAL	20uL

	Volume
Insert (XbaI, HindIII) 33ng/uL	2uL
Digested pSEVA315 (XbaI, HindIII) 38ng/uL	2uL
T4 Ligase	1uL
T4 Ligase Buffer	2uL
NF Water	13uL
TOTAL	20uL

The transformation was performed according to the Heat Shock transformation protocol.

After 24h, we observed many colonies, including some dark ones which could be due to indigo produced by TMM. These dark colonies were transfered in order to miniprep them and do an analytical digestion.

October

October 1st

After miniprep, the plasmids were digested.

Reagent	Volume
Nuclease free water	13uL
10X Fast Digest Buffer	2uL
Plasmid	3uL
FastDigest XbaI	1uL
FastDigest PstI or HindIII	1uL
TOTAL	20uL

On the gel, we can see bands at 1.5kb corresponding to tmm (tmm+pSB1C3 on the left and tmm+pSEVA315 on the right). The cloning worked.

Glycerol stocks were prepared with these strains called sPB.091 (pSB1C3) and sPB.092 (pSEVA315).

October 8th

TMM activity was found in E.coli pSB1C3-TMM (tmm+) but not in E.coli pSB1C3 (tmm-). TMM does not only degrade trimethylamine into trimethylamine-N-oxide, but also converts indole into indigo. To measure the activity of TMM, the growth medium was supplemented with tryptophan, a precursor of indole, which is the substrate of TMM. After 14h of culture, cells were pelleted, washed with water twice, and then resuspended in DMSO and sonicated. TMM activity was determined by measuring the absorbance spectrum of bacterial extractions. Peaks at 620 nm were found in tmm+ cultures supplemented with tryptophan, which was identified as indigo according absorbance spectrum analysis.

Details: we made a overnight preculture of 2 strains (sPB.026: control and sPB.091: pSB1C3+tmm) in LB+Cm. Then, the cells were resuspended and diluted in 3 tubes of each to get a OD600 of 0.2 (beginning of the exponential phase). The resuspension solution was LB or LB supplemented with tryptophane (2g/L): 3 tubes +tmm +TRP, 3 tubes -tmm +TRP, 3 tubes +tmm -TRP and 3 tubes -tmm -TRP. After 14h of culture at 37°C, the cells were washed twice (centrifugation 4000g 10min and resuspension in 10mL of water) and resuspended in 1mL DMSO. After having sonicated the cells, the solution was centrifuged (4000g 10min) and the supernatant was transfered into cuvettes to measure the absorbance spectrum. The results are in this file .

October 9th

A dilution scale of TMA was prepared to determine what is the lowest concentration people can smell in order to know which concentration we have to use in the olfactory experiment. Concentrations from 1M to 1uM were prepared with serial dilutions. 10 people were asked to smell the tubes from the lowest concentration and to stop when they smell fish odor. The results show that most of people smell trimethylamine from to a concentration of 1mM.

October 9th

GC/MS analysis were performed in the chemistry lab of Paris-Diderot University. We prepared overnight precultures of TMM-expressing E. coli and E. coli expressing empty pSB1C3. After having diluted them in LB to get an OD600 of 0.2, we added 1mM of TMA and incubated the tubes for 36H at 37°C. Then we brought the tubes for the analysis and got these figures.

October 15th

C.striatum was transformed with pSVEA351 containing tmm gene. according to this protocol. 70mL LB medium were supplemented with 7mL of 50% glucose solution. After 2h of recovery, the cells were plated on LB supplemented with chloramphenicol plates (one with 20uL and one with 200uL). Another plating was done the day after (20uL and 200uL).

Text