Growth experiments were conducted with fusaric acid concentrations ranging from 0 to 250 ug/ml were performed on Eschericia coli (Strains DH5alfa, BL21 and JM109), Bacillus subtilis and Pseudomonas putida. After 18 hours of incubation at 37 degress celcius, OD 600 measurements were taken.

NOTE: After ordering new fusaric acid later in the project, it was found out that the fusaric acid used in this experiment was not the same strength, with the old one most likely being (partially) degraded. Therefore data from this experiment is not used.

Since some soil bacteria are known to be able to degrade fusaric acid (FA), a HPLC experiment was started to test P. putida(PP) for fusaric acid degradation and carbon utilization. M9 media was used with glucose/fusaric acid(250ug/ml) or both as a carbon source.

For the HPLC the following settings were used.

• Column: Polaris C18A
• Eluent: Acetonitril
• Temperature: 35 degrees Celsius
• Flow speed: 0.5 ml/min
• Detection: UV (260 - 280nm)

Based on the initial results a more elaborate experiment was started in duplo. Six samples would be grown in duplo:

• A. Negative control for growth on M9 without carbon source. (PP+, Glucose-, FA-)
• B. Positive control for growth on M9 with carbon source (glucose).(PP+, Glucose+, FA-)
• C. Positive control for growth on M9 with carbon source and fusaric acid. (PP+, Glucose+, FA-)
• D. Test for PP growth on FA as carbon source.(PP+, Glucose-, FA+)
• E. E. Negative control for contamination and FA stability. (PP+, Glucose-, FA-)
• F. Negative control for contamination. (PP-, Glucose+, FA-)

Using an automated platereader, time based growth was measured on P. putida, to see the response to different concentrations of fusaric acid.

All gene clusters were isolated using PCR. The following primers were used. Temperatures were calculated using NEB Tm Calculator. If the initial temperature did not work, the Tm was lowered by 3 degrees and a duplo with 1 ul of DMSO was done.

P. putida - PP1263-1266

• FP: GTTTCTTCGAATTCGCGGCCGCTTCTAGAGATGCCGCGTCGCATCATC
• RP: GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTATCAACCTTCGCCAGGCTTGAC

Klebsiella oxycota - FDT-123

• FP: GTTTCTTCGAATTCGCGGCCGCTTCTAGAGATGCTCGCCTATTACGTTGC
• RP: GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTACTATGGGTGGATAGCCTGAGC

Pseudomonas cepacia - FusABCDE

• FP: GTTTCTTCGAATTCGCGGCCGCTTCTAGAGGGAGAAAATCATGCAGTCTC
• RP: GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTATTACGACTTCTTCTGCTTGTCC

Stenotrophomonas maltophilia - FuaABC

• FP: GTTTCTTCGAATTCGCGGCCGCTTCTAGAGATTGATTGTCATTGTAGCGAAATTC
• RP: GTTTCTTCCTGCAGCGGCCGCTACTAGTACGGTAATTTCCTGAACAGAC

No PCR results could be obtained for this cluster, possibly the DNA was degraded during the time spent shipping. Since the other PCRs did give results, it was chosen not to continue with this gene cluster

Initially pSB1C3 was chosen as a backbone. To serve as a repressible promotor J04500 was incorporated between the EcoRI and the XbaI site, because all the gene clusters to be integrated contain illegal PstI sites. Xba and SpeI were used to insert the gene clusters into the backbone vector.

All transformations using the fusaric acid resistance clusters proved unsuccesfull. Any colonies obtained were proven by colony PCR or restriction digestion to not contain any inserts. Since the expression of membrane proteins can often be toxic, it was considered that the leakiness of the pLac promoter in combination with the high copy pSB1C3 plasmid might prove toxic for our host organism. Therefore it was decided to construct low copy backbones using pSB3K3 and pSB4K5.

To prevent toxicity from leaky expression of potentially toxic membrane proteins low copy number backbones pSB3K3 and pSB4K5 were digested with EcoRI and XbaI to insert J04500 according to standard protocols.

As an alternate way to see if the proteins that were tried to be expressed were toxic, it was decided to isolate the three genes from the FDT-123 cluster seperatly. This could give insight in which of the genes would cause the potential toxicity.
Primers used were:

• AEX05579.1 FP - GTTTCTTCGAATTCGCGGCCGCTTCTAGAGCCACACTGGGGTTATTCGCATGAAATC
• AEX05580.1 FP - GTTTCTTCGAATTCGCGGCCGCTTCTAGAGCGATCTGCACTGCGCGTTAC
• AEX05580.1 RP - GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTAGGCCGCTACCGCTACTGC
• AEX05581.1 RP - GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTATCATTTATCATGGGTGGGTTCCTCGTTC

Using the low copy backbones transformations results were obtained. The transformation of the FDT-123 cluster in pSB4K5 initially gave positive results on colony pcr, but after miniprepping and digestion the plasmid seemed empty. Two of the transformants were sent for sequencing. Insert containing the FDT-123 FP and RP was inserted with a palindromic sequence of "ATCGATGCTA" or "TAGCATCGAT" was confirmed by sequencing. The PP cluster gave similar results but with a sequence of "TTGTCCT". Since these sequences are palindromic this might be an indication that the cluster is toxic and recombination with deletion of the cluster is the only viable way to survive.

For the seperate genes of the FDT clusters, succesfull transformants were obtained for FDT-2 and FDT-3 and confirmed by sequencing. FDT-1 did not result in any succesfull tranformants leading to the conclusion that this is most likely the gene responsible for the toxicity of the cluster in E. coli

Several more tries were done to characterize the possible fusaric acid breakdown of P. putida, however, several technical issues with the HPLC were had so no further results have been obtained yet.