Growth experiments were conducted on Eschericia coli (Strains DH5alfa, BL21 and JM109), Bacillus subtilis and Pseudomonas putida. Fusaric acid concentrations ranged from 0 to 250 ug/ml. After 18 hours of incubation at 37 degress celcius, OD 600 measurements were taken.

Both B. subtilis and all of the E. coli strains show a strong response to increasing doses of fusaric acid in the medium. P. putida, however, does not show any decrease in growth for the concentrations used. Therefore another experiment was done with higher concentrations for P. putida.

NOTE: Fusaric acid used in this experiment was probaply (partially) degraded. Therefore data from this experiment is not used.

Since some soil bacteria are known to be able to degrade fusaric acid (FA), a HPLC experiment was started to test P. putida(PP) for fusaric acid degradation and carbon utilization. M9 media was used with glucose/fusaric acid(250ug/ml) or both as a carbon source.

For the HPLC the following settings were used.

• Column: Polaris C18A
• Eluent: Acetonitril
• Temperature: 35 degrees Celsius
• Flow speed: 0.5 ml/min
• Detection: UV (260 - 280nm)

The HPLC method used delivered a linea calibration curve, but peak resolvance was not optimal, with the FA peak having overlap with several smaller peaks in the samples with P. putida. Therefore it was decided to repeat the experiment to improve the HPLC method. Initial results on fusaric acid breakdown showed signs of breakdown, but because peak resolvance was not optimal and the measurements were not done in duplo more data was needed to draw conclusions.

Based on the initial results a more elaborate experiment was started. Six samples were grown in duplo:

• A. Negative control for growth on M9 without carbon source. (PP+, Glucose-, FA-)
• B. Positive control for growth on M9 with carbon source (glucose).(PP+, Glucose+, FA-)
• C. Positive control for growth on M9 with carbon source and fusaric acid. (PP+, Glucose+, FA-)
• D. Test for PP growth on FA as carbon source.(PP+, Glucose-, FA+)
• E. E. Negative control for contamination and FA stability. (PP+, Glucose-, FA-)
• F. Negative control for contamination. (PP-, Glucose+, FA-)

Using an automated platereader, time based growth was measured on P. putida, to see the response to different concentrations of fusaric acid.

All gene clusters were isolated using PCR. The following primers were used. Temperatures were calculated using NEB Tm Calculator

P. putida - PP1263-1266

• FP: GTTTCTTCGAATTCGCGGCCGCTTCTAGAGATGCCGCGTCGCATCATC
• RP: GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTATCAACCTTCGCCAGGCTTGAC

Klebsiella oxycota - FDT-123

• FP: GTTTCTTCGAATTCGCGGCCGCTTCTAGAGATGCTCGCCTATTACGTTGC
• RP: GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTACTATGGGTGGATAGCCTGAGC

Stenotrophomonas maltophilia - FuaABC

• FP: GTTTCTTCGAATTCGCGGCCGCTTCTAGAGATTGATTGTCATTGTAGCGAAATTC
• RP: GTTTCTTCCTGCAGCGGCCGCTACTAGTACGGTAATTTCCTGAACAGAC

Pseudomonas cepacia - FusABCDE

• FP: GTTTCTTCGAATTCGCGGCCGCTTCTAGAGGGAGAAAATCATGCAGTCTC
• RP: GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTATTACGACTTCTTCTGCTTGTCC

Initially pSB1C3 was chosen as a backbone. To serve as a repressible promotor J04500 was incorporated between the EcoRI and the XbaI site, because all the gene clusters to be integrated contain illegal PstI sites. Xba and SpeI were used to insert the gene clusters into the backbone vector.