Team:HNU China/Project

Background

Introduction

Biomining, is used to describe the novel approach in mining industry when microorganisms are applied to the extraction and recovery of precious and base metals from ores and concentrates[fig.1]. Technicially, it consists two branch, the bioleaching and biooxidation. The bioleaching strictly refers to the case when microorganisms are used to solubilize the metal. While biooxidation maily focus on the pretreatment of target metals by bio-processsing, mening minerals that occlude target metals, such as thiosulfate encompasses the gold.


Fig.1 Biomining is used to extract copper from copper ore.

In reality, the same biological process had been unknowingly used to extract metals at mine sites in, for example Spain, the UK and China, for several hundred years. The modern era of bioming began with the discovery of the bactreium, Thiobacillus ferrooxidans(now Acidithiobacillus ferrooxidans) in the mid-1940s and the initial understanding of this microbe’s involvement in copper extraction. In 1958 Kennecott Mining Company patented the use of Thiobacillus ferrooxidans for copper extraction from waste rock dumps at the Bingham Canyon mine in Utah, USA.As a survey illustrates that currently bioming is commercially praticed in the production of 15% of copper, 5% of gold.

Why biomine?

Bio-extractive techniques have to compete with alternative approaches for extracting metals from ores and concentrates. Some, such as pyrometallurgical technologies[fig.2] (ore roasting/smelting) have been refined over millennia and often represent major investments by mining companies, while others, such as pressure leaching, are more recent non-biological innovations. Main microorganisms involved in mineral oxidation processes are autotrophs, and the processes operate usually at atmospheric pressure and at relatively low temperatures (20–80 8C). Biomining is generally perceived as a much more environmentally benign (‘green’) approach, involving much lower temperatures (and hence energy costs) and smaller carbon footprints, which contrasts with current biomining operations, relied on the blasting and grinding of ore bodies, emitting large amounts of CO2, consuming 5% of total global energy production. Bio- processing also has niche advantages where firstly, the ore or concentrate contains significant quantities of arsenic, and secondly, for processing lowgrade and complex (polymetallic) ores.


Fig2. Pyrometallurgy

Configurations and microbiology for biomining

Engineering options for biomining have evolved from relatively inexpensive, partly controlled, irrigated dump or heap reactors to sophisticated, highly controlled and expensive stirred-tank reactors. Another distinguished way of bioming is the in situ mining, used extensively in Canada in the 1970s to recover uranium from worked out deep mines, which may well be the next major development in the mining sector. Mineral heaps and stirred tanks provide very different environments and challenges for mineral-leaching microorganisms, and different ‘optimal’ populations might be expected to emerge with similar target minerals depending on the reactor used.

The extreme physico-chemical nature of bioleach liquors — low pH, elevated concentrations of (toxic) metals, metalloids and other solutes, and highly positive redox potential (EH values may exceed +900 mV) — means that they are highly toxic to the vast majority of life forms, including microorganisms. Microorganisms oxidize both sulfur and iron of sulfide minerals, such as pyrite. It is now well established that bioleaching and biooxidation in all biomining operations is mediated by consortia of acidophilic prokaryotes. These have been categorized as: firstly, ferric iron-generating autotrophs which produce the mineral oxidant; secondly, sulfuric acid-generating autotrophs, which maintain the low pH environment required; and finally, heterotrophic and mixotropic prokaryotes, which degrade organic compounds leaked from autotrophic iron-oxidizers and sulfur-oxidizers, there avoiding potential toxicity issues.

Engineered microbial consortia

The field of synthetic biology has developed a wide range of highly engineered clonal populations of bacteria to perform complex tasks.The construction and analysis of synthetic gene circuits has not only provided us with new tools for genetic engineering but has given deeper insight into naturally occurring gene circuits, their evolution, architec.tures, and properties as well. The industrial practice of biomining and bioremediation of heavy metal contaminations could potentially benefit from synthetic consortia as natural consortia have been shown to play crucial roles in these processes.

To our best knowledge, hybrid consortia consisting of genetically engineered and naturally occurring bioleaching bacteria have not been reported so far. In fact only two knockouts and two expression mutants have been reported in the scientific literature. One rus overexpressing A. ferrooxidans strain and another expressing the mer determinant for a mercury resistant A. caldus strain. Once more suitable transformation protocols have been developed, it maybe feasible to modulate quorum-sensing signals with engineered microbes by either attenuating or amplifying natural signals or sending artificial signals to promote biofilm formation or mobilization respectively as recently demonstrated with engineered E. coli cells.

Fungi in acid mine drainage

Roles of fungi, the natural residents of acid mine drainage(AMD) and its attenuator are not emphasized adequately in the mine water research. Though AMD appears to be a certain special enviroment with relatively high metal concentration as well low pH, several species of fungi are also isolated from the AMD carrying streams, even AMD. Generally, fungi occur over a wide pH range (pH 1.0–11.0) and have been detected in acid habitats like volcanic springs, acid mine drainage or acid industrial wastewaters. Many of them are primarily acid-tolerant, but truly acidophilic species have also been detected[talbe.1]. While extracellular precipitation, complexation and crystallization, metal transformation, biosorption and sequestration are seen for fungi, endow fungi the ability to survive.



Under this condition, fungi may play the important role as primary degraders of complex organic matter, due to the absence of invertebrates that actively shred the leaves (shredders) at pH values below 3.5. At the same time, the fungi will contribute to oxygen consumption, thereby limiting oxidative stress for the anaerobic bactiria. Moreover, fungi can be directly involved in the reduction of ferric iron or sulphur. Comparatively, more reports are available concerning the absorption of heavy metals by fungi, in comparison to bacteria or algae in freshwater ecosystem. Fungi can absorb metals in their cell wall or adsorb in extracellular polysaccharide slime. This capacity enables them to grow in the presence of high amounts of heavy metals. Fungal activity in acid mine drainage is represented in Fig.3


Fig.3 Schematic diagram of fungal influence in acid mine drainage remediation

Conclusion

Biomining, is used to describe the novel approach in mining industry when microorganisms are applied to the extraction and recovery of precious and base metals from ores and concentrates. Compared with the conventional approachs, such as pyrometallurgical technologies and pressure leaching in mining industry, bioming has its unique advantages in energy conservation and emission reduction, both of which are definitely with rising importance in the modern time. Microorganisms are usually settled in the non-sterile condition, and participate the bio-processing in consortia. In most of the time, they play the role of iron-oxidizer, sulfur-oxdizer and mixotrophic or heterotrophic acidophiles repectively or together. In the “bottom up” approach to optimize the consortia, the logic of synthetic biology is a worthy try to get the optimum colonies, though short of precedent. Fungi is a natural resident in the acid mine drainage and involved in the reduction of ferric iron and sulphur, matching the mainly role in bioming consortia. Since Saccharomyces cerevisiae is one of the model organisms people study in, scientists has developed a relatively mature genetically engineering operation. According to above reasons, we chose Saccharomyces cerevisiae as a model, aiming to optimize the ability as a biomining microorganism with our biobricks.

Reference

1. Biomining — biotechnologies for extracting and recovering metals from ores and waste materials. D Barrie Johnson. Current Opinion in Biotechnology 2014, 30:24–31
2. The microbiology of biomining: development and optimization of mineral-oxidizing microbial consortia. Douglas E. Rawlings1 and D. Barrie Johnson2.Microbiology (2007), 153, 315–324
3. How will biomining be applied in future? C. L. BRIERLEY. Trans. Nonferrous Met. Soc. China 18(2008) 1302-1310
4. Engineering microbial consortia to enhance biomining and bioremediation. Karl D. Brune andTravis S. Bayer* . Frontiers in Microbiology. 05 June 2012
5. Occurrence and role of algae and fungi in acid mine drainage environment with special reference to metals and sulfate immobilization. Bidus Kanti Dasa, Arup Roya, Matthias Koschorreckb, Santi M. Mandalc, Katrin Wendt-Potthoffb, Jayanta Bhattacharyaa,*. water research 43 (2009)883–894

Description

Our microbial miner briefly consists of two systems, iron sensitive absorbing system and optogenetic apoptosis system, the last of which is designed for the biosafety reason.

1. Iron sensitive absorbing system:
1. IRE: part of the upstream none-coding sequence of human ADH1 RNA, which will form a hairpin structure with human protein IREBP, inhibiting the process of translation.
2. IREBP: human protein.
3. FET3: baker’s yeast protein, plays a substaintial role in the iron uptake.
2. optogenetic apoptosis system
1. Cry2-CIB1: both of these transcription factors are cloned from the genome of Arabidopsis, which will react under the blue light, then initiate the expression of the gene downstream.
2. Casp3: human protein, plays a core role in the cellular apoptosis.

Experimentation

Preliminary construction of the Cry2-CIB1 system

I.Background

Photoactivation mechanism of Arabidopsis cryptochrome 2(CRY2), in mediating light regulation of cell elongation and photoperiodic flowering, has been revealed as a blue light-specific manner cooperating with cryptochrome-interacting basic helix-loop-helix protein(CIB1), which is screened by yeast two-hybrid assay.[1] This system is recently engineered in a light-inducible transcriptional effectors (LITEs), applying in mice neuron or the brain in vivo to mediate reversible gene expression.[2] Reasonably, we would like to utilize them to serve for our project, which in detail is an optogenetic apoptosis system for the biosafety reason.

II.Cloning of the Cry2 & CIB1 gene

According to the sequences from NCBI, we designed two pairs of primers respectively, and cloned them based on the cDNA library of Arabidopsis.[fig.1]

Primer for Cry2:
Fwd 5’→3’   ATGAATGGAGCTATAGGA
Rev 5’→3’   TCAAACTCCTAAATTGCC

Primer for CIB1:
Fwd 5’→3’   ATGAAGATGGACAAAAAGA
Rev 5’→3’   TCATTTGCAACCATTTTT

III.Optogenetic yeast-two-hybrid

Two-hybrid or interaction trap systems exploit the fact that transcription factors are comprised of two domains, a DNA binding domain (DBD) and an activation domain (AD). Two separate hybrid proteins are constructed in two-hybrid screens. The first hybrid protein is the DBD/protein X, while the second hybrid protein is the AD/protein Y.These two hybrids are encoded on separate yeast expression plasmids, with independent selectable markers.[3] Based on the principle of yeast-two-hybrid, there are several pairs of plasmids designed for the screening of interacting protein library, commercially accessible.
What we chose is the pDEST32 and pDEST22[fig.2], where the DBD and AD is actually Gal4 BD and Gal4 AD respectively, and the Gal4 AD shall specifically bind to the upstream activating sequence(UAS), locating in the promoters of several reporter genes in the yeast strain genome like lacZ, HIS3 as well URA3.

Fig.2


Since we have obtained CRY2 and CIB1, what we do next is to induce both of them into their vectors with the technology named Gateway, constructing two new plasmids,
pDEST22-CIB1 and pDEST32-32 as below[fig.3]:

Fig.3


Then we transform the plasmids above into the baker’s yeast strain, AH109, screening by Leu and Trp auxotroph. To test the effect of light switchable gene expression system, blue-white selection is induced when the blue light in special incubator[fig.4] shall initiate the expression of LacZ, which combined with the IPTG and X-gal in solid medium, makes the colony into blue, contrarily, colony in dark remains white.[fig.5]

Fig.4


Reference

1. Photoexcited CRY2 Interacts with CIB1 to Regulate Transcription and Floral Initiation in Arabidopsis, Hongtao Liu, Xuhong Yu, Kunwu Li, John Klejnot, Hongyun Yang, Dominique Lisiero, Chentao Lin*, SCIENCE VOL 322 5 DECEMBER 2008
2. Optical control of mammalian endogenous transcription and epigenetic states, Silvana Konermann1,2*, Mark D. Brigham1,2,3*, Alexandro Trevino1,2, Patrick D. Hsu1,2,4, Matthias Heidenreich1,2, Le Cong1,2,5, Randall J. Platt1,2, David A. Scott1,2, George M. Church1,6 & Feng Zhang1,2, doi:10.1038/nature12466
3. ProQuest Two-Hybrid System user manual.

Cloning of the genes we need and Construction of T-vector

I.IRE-IRP

The regulation of the synthesis of ferritin in mammalian cells is mediated by the interaction of the Iron regulatory protein (IRP) with a specific recognition site, the iron responsive element (IRE), In the 5' untransiated regions (UTRs) of the respective mRNAs. [1]

1.IRP

We decide to clone the IRP from human cDNA library.

Primers for IRP[fig.1]:
Fwd 5’→3’   GCGAAGCTTTCAGTAATCATGAGCAAC
                                HindIII
Rev 5’→3’   GCGGAGCTCTTGAGCAGAGCGTAAGA
                                 SacI

Fig.1


2.IRE

Since IRE is a quite short sequence, counting 40 bp at all. A pair of single-stranded DNA are synthesized as the primers, and annealing shall create double-stranded DNA.

Pair of single-stranded DNAs
Fwd 5’→3’   GCGAAGCTTGTTCTTGCTTCAACAGTGTTTGGACGGAACACTAGTGCG
                                HindIII                                                                                      SpeI
Rev 5’→3’   CGCACTAGTGTTCCGTCCAAACACTGTTGAAGCAAGAACAAGCTTCGC
                                   SpeI                                                                                       HindIII

II.FET3

S. cerevisiae accumulate iron by a process requiring a ferrireductase and a ferrous transporter. [2] FET3 is an oxidase which depends on the Cu2+ in yeast membrance, and forms the complex for iron absorption with FTR1, which is the main part of the high absorption system[3]. Here we hope FET3 could active the function of high absorption system to make the system more efficient in absorption of iron.

1.Prepare for the genome of baker’s yeast

Due to the lack of existing yeast genome as the PCR template, we order a yeast genome extraction kit to prepare the source.[fig.2]

Fig.2


2.Cloning of FET3

Primers for FET3[fig.3]
Fwd 5’→3’   GCGAAGCTTATGACTAACGCTTTGCTCTCTATAG
                                HindIII
Rev 5’→3’   GCGGAGCTCTGGAACCCTTGACCGA
                                 SacI

Fig.3


III.CASP3

Caspase-3 normally exists in the cytosolic fraction of cells as an inactive precursor that is activated proteolytically when cells are signaled to undergo apoptosis.[4] So in the project, we want to make the modified yeast commit suicide through overexpress caspase-3 protein to protect natural environment.

The template for PCR is also the human cDNA library.

Primers for CASP3[fig.4]
Fwd 5’→3’   GCGACTAGTGCTCTGGTTTTCGGTGGG
                                 Spe1
Rev 5’→3’   GCGGAGCTCTGGAACCCTTGACCGA
                                 SacI

Fig.4


IV.Construction of the T-vector

To make sure the PCR-cloned sequences are expected, we ligate them into the pMD18-T vector, then sequence all together. On the other hand, objective sequence in circular plasmids makes it convenient and stable for storage for quite long time.

Reference

1. Translational repression by the human iron-regulatory factor (IRF) in Saccharomyces cerevisiae, Carla C.Oliveira, Britta Goossen1, Nilson l.T.Zanchin, John E.G.McCarthy*, Matthias W.Hentze1 and Renata Stripecke1, Nucleic Acids Research, 1993, Vol. 21, No. 23
2. The FET3 gene of S. cerevisiae encodes a multicopperoxidase required for ferrous iron uptake, Askwith, C., Eide, D., Van Ho, A., Bernard, P.S., Li, L., Davis-Kaplan, S., Sipe, D.M., Kaplan, J. Cell(1994)
3. Stearman R, Yuan D S, Yamaguchi-Jwai Y et al. Science, 1996, 271(15): 1552~1557
4. Activation of cyclin A-dependent protein kinases during apoptosis. Proc. Natl. Acad. Sci. USA, 91 (1994), pp. 3754–3758

Result

Gene cloning

The genes we have cloned:
  1.IRP and CASP3 are from existing cDNA library of human.
  2.CRY2, CIB1 are from existing cDNA library of Arabidopsis.
  3.FET3 is from the genome of Saccharomyces cerevisiae made by ourselves.
  4.IRE is made by annealing of two synthetic sigle-strain DNA.

TA cloning

For sequencing and the stability of conservation, IRP, CASP3, FET3 and IRE are all introduced into the pMD-18T vector.

Optogenetic yeast-two-hybrid

CRY2 and CIB1 are introduced into the commercial shuttle vectors, pDEST32 and pDEST22, by the gateway operation. Both of the pDEST22-CIB1 and pDEST32-CRY2 are transformed into the Saccharomyces cerevisiae cell AH109. Auxotroph screening and X-gal coloration prove the viability for the blue light to mediate CRY2-CIB1 interaction.

Future work

Step I.

When all of the schematic work finished, we are firstly going to verify the hypothesis of the apoptosis effect when caspase-3 expressed in yeast.

Step II.

The kinetic parameter of the light mediation, iron sensing and iron absorption are with worth to detect.

Step III.

Though we would like to see them in only one microorganism clone, according to the original design, iron sensitive absorbing system and optogenetic apoptosis system consists of two engineered plasmids repectively. Four plasmids in total makes it impossible for integration. Further genetically engineering design and operation are necessary, mainly in system simplification.