"
Team:DTU-Denmark/Primers
From 2014.igem.org
- Home
- Overview
- Methods
- Achievements
- Team
At the Giant Jamboree, we received a gold medal and an Interlab Study Award. We also won the Overgrad Best Parts Collection.
Below is a list of primers used in the experimental work
| Primer name | 5'-sequence-3' | Description |
| VF2 | TGCCACCTGACGTCTAAGAA | Primer for sequencing insert in standard backbone |
