"
Team:Imperial/EColi
From 2014.igem.org
Team E. coli
Overview
Zombie ipsum reversus ab viral inferno, nam rick grimes malum cerebro. De carne lumbering animata corpora quaeritis. Summus brains sit, morbo vel maleficia? De apocalypsi gorger omero undead survivor dictum mauris. Hi mindless mortuis soulless creaturas, imo evil stalking monstra adventus resi dentevil vultus comedat cerebella viventium. Qui animated corpse, cricket bat max brucks terribilem incessu zomby. The voodoo sacerdos flesh eater, suscitat mortuos comedere carnem virus. Zonbi tattered for solum oculi eorum defunctis go lum cerebro. Nescio brains an Undead zombies. Sicut malus putrid voodoo horror. Nigh tofth eliv ingdead.
Key Achievements
- We have contributed significantly to the Registry of Standard Parts by providing the necessary components for the assembly of a 10kB operon for cellulose production in a wide range of organisms.
- We have proven system portability by transferring the cellulose production machinery from Gluconacetobacter xylinus into Escherichia coli and demonstrating its functionality in the latter.
- Assembled a fully synthetic, functional, cellulose-producing system in Escherichia coli without engineering signal peptides, indicating that these and the signal peptides of G. xylinus must be of high similarity.
- We were able to successfully maintain the native stoichiometry and ratios of expression of the native host to ensure proper protein folding, complex assembly and correct levels of activity of each of the parts in the process of making cellulose.
- In summary, we have majorly contributed to the Synthetic Biology community by encouraging the implementation of non-native, complex functions and systems into new hosts and by encouraging the production and uses of bacterial cellulose by a broader range of hosts to widen the applications of such useful biomaterial.
Introduction
BEING UPDATED Despite its unique chemical, physical and mechanical features and great potential in a variety of industries, wider use of bacterial cellulose as a biomaterial has been limited due its high cost of production (mainly driven by the need of high medium volumes and large surface areas for the cellulose pellicle to grow on under optimized conditions), in addition to the slow and particularly low production yields, which do not meet the demands of an industrial setting. Therefore, it is essential to develop a sustainable, affordable and efficient approach for optimal cellulose productivity (alternative: optimal cellulose mass production)
Aims
By aiming to transfer the cellulose production operon from its native organism Gluconacetobacter xylinus into the lab-friendly strain E. coli, we aimed to emphasize the importance of increasing cellulose production per unit time to achieve a reduction in pellicle growth timeframe and production costs. We also aim to optimize growth conditions by potentially allowing shaking incubation, and to ease genetic engineering and cloning procedures due to the wider availability of functional, already characterized Biobricks to work with cellulose (by having the two highest expressed elements in a high copy plasmid (pSB1C3) and the lowest expressed elements in a low copy plasmids (pSB3k3), and by having two different inducible promoters that allow for an even finer tuning of expression).
Engineering
The cellulose production operon in Gluconacetobacter Xylinus is a 10kb genomic region, consisting of four main elements:
- acsAB, the cellulose synthase element, which is in turn made up of two domains: acsA being the catalytic domain, and acsB being the cyclic-di-GMP-binding domain. This modular enzyme requires the second messenger cyclic-di-GMP in order to carry out efficient catalysis
- acsC codes for an oligomeric element that allows transport of the growing polymer across the cell membrane into the extracellular space
- acsD is believed to be a non-essential element, although it is a key player in the control of cellulose crystallinity and required for maximal cellulose productivity.
The native operon has surprisingly high levels of internal regulation and its expression responds to a wide set of internal signalling events and environmental cues. The native RBS appear weak but are still able to efficiently maintain the stoichiometry of the system for all elements to be expressed and function at the right levels.
Unfortunately, the promoter region has not yet been characterized, and it was also noticed that there are overlapping regions between the 3’ end of an element, and the 5’ end of the following element downstream of it.
The first step of our design engineering approach, was to identify the coding sequences and extract them from NCBI. We removed the native regulation by codon-optimizing the sequences for expression in E.coli and other standard hosts, and replaced the native RBS with stronger ones, but maintaining the strength differences amongst them so that the expression levels of each coding sequence could be replicated in any other organism. We replaced the existing promoter (uncharacterized and both negatively and positively regulated by native second messengers) with inducible promoters of our choice to develop the following strategy:
Gene Designer served as a very useful tool for assembling constructs and predicting cloning outcomes before proceeding with the experimental procedure. Find below the plasmid maps of our resulting constructs, and refer to Materials and Methods for a deeper insight into the assembly process.
Materials and Methods
Cell Strains and Media Components
Escherichia coli strain DH10B were made chemically competent following a standard protocol and were used to clone the pSB-AraC-pBAD and pSB-LacI-pLAC elements. Additionally, High Efficiency chemically competent DH10B E.coli were purchased from New England Biolabs for assembly of the Acs cellulose-producing operon, which was codon-optimized for expression in E.coli and synthesized by GenArt. Both strains were grown overnight in liquid cultures (supplemented with specific antibiotics), or on semi-solid LB-Agar plates, provided with the specific antibiotic, as listed on the table below.
Luria Broth Miller (LB) and LB Agar were purchased from ????, prepared using standard protocols and used throughout the experimental procedure. During characterization, Acs-containing strains were supplemented with 1% D-glucose, 0.1% Arabinose and 0.5mM IPTG.
| Plasmid name | Vector backbone | Antibiotic concentration (ug/ml) |
|---|---|---|
| pSB-AraC-pBAD | pSB1C3 | Chloramphenicol 50 |
| pSB-LacI-pLAC | pSB3K3 | Kanamycin 25 |
| pSB-AcsAB | pSB1C3 | Chloramphenicol 50 |
| pSB-AcsCD | pSB1C3 | Chloramphenicol 50 |
| pSB-AraC-pBAD-AcsAB | pSB1C3 | Chloramphenicol 50 |
| pSB-LacI-pLAC-CD | pSB3K3 | Kanamycin 25 |
Chemicals
Congo Red was purchased from Sigma Aldrich (Steiheim, Germany) and diluted in 1x PBS to a concentration of 350 uM. The final Congo Red concentration used during system characterization steps was 20 uM.
Construct Assembly
Cloning of pSB-AraC-pBAD
The AraC and pBAD elements were obtained by PCR, using the Biobricks BBa_K325108, BBa_K325218 and BBa_K325219 as DNA templates, all of which follow the standard structure showed on the image below (left hand side, add legend, add figure number). The primers used during this procedure were as follows:
- Forward: TACTAGTAGCGGCCGCTGCAG
- Reverse: GCTAGCCCAAAAAAACGGGTATGGAG
The amplified elements were DpnI-treated following a standard procedure (New England Biolabs), and were subsequently submitted to a purification step (Qiaquick PCR clean up, Qiagen) prior to self-ligation. Three different template concentrations were tested during ligation (specifically 3 ng, 7.5 ng and 15 ng), and were incubated at room temperature for 1h+. The ligation mix was then transformed into chemically competent DH10B E.coli using a standard chemical transformation protocol and plated out on Chloramphenicol-specific LB plates.
Cloning of pSB-LacI-pLAC
Cras dictum. Pellentesque habitant morbi tristique senectus et netus et malesuada fames ac turpis egestas. Vestibulum ante ipsum primis in faucibus orci luctus et ultrices posuere cubilia Curae; Aenean lacinia mauris vel est.
Suspendisse eu nisl. Nullam ut libero. Integer dignissim consequat lectus. Class aptent taciti sociosqu ad litora torquent per conubia nostra, per inceptos himenaeos.
Assembly of Acs elements
The AcsABCD operon was designed in silico as described in the previous section. It was ordered for synthesis at GenArt in the form of four separate elements of similar sizes, named AcsA, AcsB, AcsC and AcsD, respectively. After synthesis, the constructs were directly transformed into DH10B E.coli using a standard chemical transformation protocol and plated overnight supplied with 50 ug/ml Kanamycin. 5 ml LB were inoculated with a freshly growing colony and grown overnight at 37°C, under shaking conditions. Glycerol stocks were produced prior to proceeding with the assembly process.
In order to meet the Registry standards, we aimed to clone these elements into pSB1C3. To do so, the vector backbone (pSB1C3), AcsA and AcsB were submitted to SpeI/PstI, XbaI/SpeI and XbaI/PstI double digests, respectively, to later yield pSB-AcsAB. AcsC, AcsD were digested in a similar manner, and would be cloned into pSB1C3 to yield pSB-AcsCD. Prior to ligation, the vector backbone was dephosphorylated using AP phosphorylase (Roche). A three-part ligation was then set up, keeping equimolar ratios amongst all three parts, and incubated at 4 degrees overnight. The resulting ligation mix was transformed using the NEB High Efficiency Transformation protocol into NEB 10B cells (New England Biolabs), which were in turn plated and incubated overnight at 37 degrees. 5ml LB supplied with 50ug/ml Chloramphenicol were inoculated with a selection of colonies for further.
Results
Constructs
pSB-AraC-pBAD Assembly
The pSB-AraC-pBAD construct was assembled as described in Materials and Methods. As a preliminary verification step, a restriction analysis was carried out using XbaI and PstI, and results were visualized on a 1% Agarose Gel. A 2-band pattern was obtained, indicating the presence of a ~2kb DNA fragment potentially corresponding to the pSB1C3 vector backbone, and a ~1kb fragment corresponding to the AraC and pBAD elements being cloned. Final confirmation of successful cloning was obtained by gene sequencing of the part in question, using the BioBrick Verification Primers, shown below: (refer to the “Sequencing” section to find a compilation of all confirmed parts)
- Verification Primer Forward: T GCC ACC TGA CGT CTA AGA A
- Verification Primer Reverse: ATT ACC GCC TTT GAG TGA GC
pSB-AcsAB and pSB-AcsCD Assembly
pSB-AraC-pBAD-AcsAB Assembly
Characterising Cellulose Production
Preliminary Characterization: Congo Red Assay
Data Analysis
Future Work
References
