Team:DTU-Denmark/Achievements/Parts

From 2014.igem.org

Revision as of 09:19, 17 October 2014 by Rbechster (Talk | contribs)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

Parts

Main Contribution

Our main part contribution is the Spinach2.1 BioBrick (BBa_K1330000). Spinach is an RNA aptamer, developed at Cornell University, that binds and activates a fluorophore called DFHBI. Spinach2 is an improved version of Spinach with increased fluorescence. Spinach2 has not been included in any BioBrick until now.

The Spinach2 sequence contains an internal SpeI site, which makes it incompatible with the iGEM assembly standard. To overcome this we predicted several mutations that should not affect folding, and synthesized these mutated versions of the sequence. One of these mutated sequences, Spinach2.1, was confirmed to have fluorescence comparable to the original Spinach2.

Spinach2: GATGTAACTGAATGAAATGGTGAAGGACGGGTCCAGTAGGCTGCTTCGGCAGCCTACTTGTTGAGTAGAGTGTGAGCTCCGTAACTAGTTACATC
Spinach2.1: GATGTATCTGAATGAAATGGTGAAGGACGGGTCCAGTAGGCTGCTTCGGCAGCCTACTTGTTGAGTAGAGTGTGAGCTCCGTAACTAGATACATC

The sequences of Spinach2 and Spinach2.1 are shown above. The SpeI site is highlighted in blue. The two point mutations we introduced are highlighted in red.

[Image of the predicted folding of Spinach2 and Spinach2.1]

[Data on in vitro fluorescence comparisons of Spinach2 and Spinach2.1]

To increase the stability of the Spinach2.1 RNA-aptamer our BioBrick contains the sequence flanked by a human tRNALys3. We have submitted two versions of our Spinach2.1 BioBrick:

BBa_K1330000 contains the Spinach2.1 tRNALys3 complex.
BBa_K1330001 contains the Spinach2.1 tRNALys3 complex followed by terminator BBa_B0052.

These BioBricks can be combined with various promoters using Standard Assembly, allowing for rapid assays of different promoters’ activities.

Additional Parts

In addition to our main contributions we decided to streamline the Anderson promoter library, as only 15 of the 20 promoters were distributed in the standard backbone pSB1C3. We were successful in cloning 4 of the 5 missing promoters and have submitted these parts as:

BBa_K1330002 contains the promoter BBa_J23105
BBa_K1330003 contains the promoter BBa_J23110
BBa_K1330004 contains the promoter BBa_J23112
BBa_K1330005 contains the promoter BBa_J23116

We believe that this streamlining will help future iGEM teams as these promoters are now ready to use in the standard backbone.