Detecting

Introductions, Results and Discussions.

As we know, some metal ions are toxic to bacterial cells at all concentrations, therefore detoxification and resistance systems that employ a variety of mechanisms to rid the cell of these potentially lethal toxins have evolved employ. In most cases, the expression of such resistance systems is controlled at the level of transcription by metal sensor proteins that sense specific metal ions via their direct coordination [1]. The most famous resistance system is smtB-OP-smtA device which defend metal ions including Zn²⁺, Co²⁺, Ni²⁺, Pb²⁺ and Cd²⁺ [1-3]. Briefly, the protein SmtB generally function as a repressor in the absence of metal ions and become activators upon metal binding, by driving a metal-induced DNA conformational switch that converts a sub-optimal promoter (OP-promoter) into a potent one, than activate the expression of SmtA. In previous reports, the smtB-OP-smtA element which located in Staphylococcus may alsofunctions as a metal ions (Zn²⁺, Co²⁺ and Cd²⁺) responsive repressor in E.coli [4-6]. In this case, we focused on detecting the content of Cd²⁺, whether this well-known element could be employed in our project still remained in uncertain. Therefore, we took steps of experiments and yielded several interesting data below.

Firstly, we obtained the smtB-OP-smtA device from Staphylococcus Genome and tested the growth of bacterium containing this element in Cd²⁺ present condition (Figure 1). The result displayed a significant growth advantage with smtB-OP-smtA positive E.coli, indicating the device worked in E.coli. Thus, we wanted to use pigments as reporters in our designed genetic construct which can be recognizable by the naked eye. According to the previous work, we have chosen an identified pigment in the Registry: the biobrick of RFP (BBa_E1010) was used as reporter gene in our metal detection device. After exchanging the biobrick part with SmtA in smtB-OP-smtA device, the pigment gene was under control of metal-induced promoter (smtB-OP).

It was important to us that the similar device which contained Lac-Z as reporter gene had ability to sense Zn²⁺ and Cd²⁺ in E. coli [7, 8]. Thus, there are four potential metal binding sites on protein SmtB as known as α3, α3N, α5 and α5C [9], different from Zn²⁺ resistance mechanisms, Cd²⁺ binds SmtB at the site α3N [10]. To gain deep insight regarding the detailed comparison of smtB-OP-reporter affected by these two metal ions in E. coli, we adopted Rosetta-plysS and detected the expression of reporter gene by measuring OD value (OD450 for RFP). As shown in Figure.2 A-B, pigment gene can be both activated by Zn²⁺ and Cd²⁺, the up-regulation from Cd²⁺ was with more sensitive with shorter period and lower consistency than Zn²⁺. With higher density of bacteria(1x107 cells ml-1), the pigment expression induced by Cd²⁺ in 2 hours could be easily distinguished by our naked eye (Fig.3C). Taken together, these data provided basic but necessary information that we could take this recombinant device to report the content of Cd²⁺ with certain degree (2-20μM in 2 hours) not affected by Zn²⁺.

Based on the conclusions above, we focused on the details of our detecting device resulting from Cd²⁺ only with certain degree. For quality control, we detected the standard substances by Optima 8300 ICP-OES Spectrometer the credible interval of this method displayed to land at 50-500μM (Table.1). For the pigment expression differences with Cd²⁺ at 10-50μM in 2 hours are not obvious, our team has coupled a more impressible biobrick part amilCP (BBa_K592009) with the smtB-OP element. Results from Fig 3 A-B indicated that, the diversity of amilCP expression (measured by OD600) was able to represent the continuous concentrations of Cd²⁺ precisely within 0-50μM in one hour. The visualization is another potential advantage of this system, we raised the dose of the engineering bacteria and extended the sense time. Finally, blue color produced by our device was strong enough to be observed by the human naked eye, however, similar lightness among 100-500μM Cd²⁺-treatment samples were shown which matched the our previous data (Fig.3 C).

In summary, the Rosetta-plysS strain made our system convenient to be applied, the classical smtB-OP-smtA device from Staphylococcus supported our system a responsive Cd²⁺ inducible-promoter, and the viewable pigment gene provided our system a reliable and macroscopic observation. After theoretical prediction, genetic engineering, experimental optimization and reasonable model analysis (deeply discussed in Modeling ), our detecting system residing in the engineering bacteria was able to sensitively represent the content of Cd²⁺ (1-100μM) in 1-2 hours.

Although the inducible operator in our case might also response to other metal ions including Zn²⁺, our date at least did point out that Cd²⁺ has acuter stimulus to the pigment gene than Zn²⁺ which was confirmed both from experimental data and model analysis. We achieved to our goal at a certain degree. Finally, our system is easier to utilize and exhibits improved flexibility as a tool to detect Cd²⁺ which belongs to the toxical heavy metal ions.

Protocols

Plasmid design and construction

The vector pHY300 PLK and vector PACYC184 were constructed based on the smtBCP/smtBRP backbone (see obtaining the target genes ) using standard cloning techniques. The sensor vector included an improved metal ions inducible promoter (smtO-P), a pigment gene (RFP or amilCP) marker. Detailed vector maps, sequence information and cloning protocols has been described above in Foundation .

Establishment of the detecting clonal cell lines

DNA transfection was performed as standard molecular cloning techniques, the Rosetta-plysS strain (kindly supported by our instructors) was cultured with LB medium. All the clonal cells were validated by PCR (see Foundation ).

OD value measurement and analysis

All measurement procedures were performed using an Eppendorf BioSpectrometer basic instrument. Briefly, the cells were centrifuged at 3,000g for 5 min. Then, resulting pellet was twice-washed with ddH₂O and resuspended at a density of 105-6 cells ml-1. After that, the cells were treated with metal ions using a shaker culture box with 200rpm at 37。C. All the data were analyzed using Sigmaplot software. For each experiment, triplicate cultures were measured.

Quality control of the Cd²⁺ standard samples by emission spectrometric detection

Briefly, the CdCl² (Sigma-Aldrich) was taken for preparing the standard samples. 183.32g (1M) was weighed by analytical balance and diluted at a concentration of 1M with ddddH₂O. After 10-times-dilution step by step, we got several standard samples of Cd²⁺ at different concentrations (1μM, 10μM, 50μM, 100μM and 500μM). Then, these samples were measured via Optima 8300 ICP-OES Spectrometer (this section was performed in HIT). Detailed condition for the detection was shown in table.2. For each experiment, 8 separate repeats were measured.

Figure and Table

Figure 1

Fig.1. Growth of cells containing smtB-OP-smtA element in LB medium supplemented with 2μM Cd²⁺. Cells were inoculated at a density of 1x106 cells ml-1, and growth was monitored by measuring the OD540 value. Data points represent the mean values from three separate cultures with SD.

Fig.2. A. Metal-induced expression of the pigments (RFP), Rosetta-plysS (1x10⁶ cells ml^-1) carrying the smtB-OP-RFP element were grown with Cd²⁺ and Zn²⁺ (1-50μM) supplement for 2h immediately before assay and expression was monitored by measuring the OD₄₅₀ value; B. Metal-induced expression of the pigments (RFP). Rosetta-plysS carrying the smtB-OP-RFP element were grown with Cd²⁺ and Zn²⁺ (2μM) supplement for 1-12h immediately before measurement; C. Cadmium-induced expression of the pigment (RFP) at different concentrations. Rosetta-plysS (1x107 cells ml-1) carrying the smtB-OP-RFP element were grown with Cd²⁺ (1-20μM) supplement for 2h. The data points shown in A and B represent the means of three separate assays with SD.

Table 1

Figure 3

Fig.3. A. Cadmium-induced expression of the pigment (amilCP) at constant concentration. Rosetta-plysS (1x106 cells ml-1) carrying the smtB-OP-amilCP element were grown with Cd²⁺ (1μM) supplement for 1-2h immediately before assay and the expression was monitored by measuring the OD600 value; B. Cadmium-induced expression of the pigment (amilCP) with different concentrations. Rosetta-plysS carrying the smtB-OP-amilCP device were grown with Cd²⁺ (1-100μM) supplement for 1h immediately before assay；C. Cadmium-induced expression of the pigment (amilCP) with different concentrations. Rosetta-plysS (1x107 cells ml-1) carrying the smtB-OP-amilCP element were grown with Cd²⁺ (10, 20, 50, 100, 200 and 500 μM) supplement for 2h. The data points shown in A and B represent the means of three separate values with SD.

Table 2

Reference

1. Busenlehner, L.S., M.A. Pennella, and D.P. Giedroc, The SmtB/ArsR family of metalloregulatory transcriptional repressors: Structural insights into prokaryotic metal resistance. FEMS Microbiol Rev, 2003. 27(2-3): p. 131-43.
2. Robinson, N.J., S.K. Whitehall, and J.S. Cavet, Microbial metallothioneins. Adv Microb Physiol, 2001. 44: p. 183-213.
3. Erbe, J.L., K.B. Taylor, and L.M. Hall, Metalloregulation of the cyanobacterial smt locus: identification of SmtB binding sites and direct interaction with metals. Nucleic Acids Res, 1995. 23(13): p. 2472-8.
4. VanZile, M.L., X. Chen, and D.P. Giedroc, Allosteric negative regulation of smt O/P binding of the zinc sensor, SmtB, by metal ions: a coupled equilibrium analysis. Biochemistry, 2002. 41(31): p. 9776-86.
5. Morby, A.P., et al., SmtB is a metal-dependent repressor of the cyanobacterial metallothionein gene smtA: identification of a Zn inhibited DNA-protein complex. Nucleic Acids Res, 1993. 21(4): p. 921-5.
6. Huckle, J.W., et al., Isolation of a prokaryotic metallothionein locus and analysis of transcriptional control by trace metal ions. Mol Microbiol, 1993. 7(2): p. 177-87.
7. VanZile, M.L., X. Chen, and D.P. Giedroc, Structural characterization of distinct alpha3N and alpha5 metal sites in the cyanobacterial zinc sensor SmtB. Biochemistry, 2002. 41(31): p. 9765-75.
8. Kar, S.R., et al., The cyanobacterial repressor SmtB is predominantly a dimer and binds two Zn²⁺ ions per subunit. Biochemistry, 1997. 36(49): p. 15343-8.
9. Cook, W.J., et al., Crystal structure of the cyanobacterial metallothionein repressor SmtB: a model for metalloregulatory proteins. J Mol Biol, 1998. 275(2): p. 337-46.
10. Busenlehner, L.S., et al., Spectroscopic properties of the metalloregulatory Cd(II) and Pb(II) sites of S. aureus pI258 CadC. Biochemistry, 2001. 40(14): p. 4426-36.

Recycling

TEM Protocol

In order to verify the synthesis of the CdS nanocrystal in E.coli (Rosetta plysS), the bacteria was harvested by centrifuged in 3000*g for 3 min then suspended in resin and hardened at 60℃ for 16 hours.

Then the hard pellets were cut into 60nm thin slices and the slices were floated on water and deposited on a carbon-coated copper TEM grid. Microscopy was performed with a JEM-1400 microscope at 120-keV electron energy.

Result

Shown as bellow

Reference

Damage of the Bacterial Cell Envelope by Antimicrobial Peptides Gramicidin S and PGLa as Revealed by Transmission and Scanning Electron Microscopy Antimicrob Agents Chemother. Aug 2010; 54(8): 3132–3142.

Biosynthesis and characterization of CdS quantum dots in genetically engineered Escherichia coli. Journal of biotechnology 153(2011) 125-132

Silver nanoparticles as antimicrobial agent: a case study on E. coli as a model for Gram-negative bacteria. Journal of Colloid and Interface Science 275 (2004) 177–182

Future Application

Purpose

Via successful application of module 1 and module 2 above, we achieved the goal that our engineering bacteria displayed the presence of Cd²⁺ and synthetize nanocrystals. However, there is another problem coming, the 2nd pollution committed by bacterium themselves spreading limits its future application and conceals the function of module 2. In our opinion, the rapid flocculation of our engineering bacteria is viable in avoiding this bottleneck and helpful in collecting the solid contaminant. As reported, flocculating system are capable to increase the flocculent activity of the bacteria, a flocculation gene was tentatively adopted in our next work. In this section, our host bacteria containing a flocculation gene cloned from Bacillus sp. F2 was presented and detected.

Strains, media and plasmids

The Bacillus sp. F2 [1] that was used in this study was stored at -40°C in 20% glycerol. The bacteria from the stock cultures were pre-cultured in Luria-Bertani culture medium (LB) prior to use. DH5α was taken as the host for recombinant plasmids. The pET-28b (+) was prepared as an overexpression vector to produce the target protein. Rosetta pLysS was used as the host for expression of the flocculation gene under the control of the T7 promoter. E. coli transformants were grown at 37°C in LB medium.

Cloning and overexpression of the flocculation gene in E. coli.

The extraction of total DNA from the strain of Bacillus sp. F2 was carried out according to standard techniques. The putative flocculation activity gene was amplified from the total DNA by using the primers introduced HindIII and NdeI restriction sites for cloning to the pET-28b (+). The following primers were used:

F,5'GGAATTCCATATGATGAGTCTACTTGCTGTTTTGTTTT3'. R,5'AAGGGGTTATGCTAGTTACGAATTCGAGCTC3' [2].

After sequencing, the positive PCR product was digested with NdeI /HindIII and then ligated into NdeI/HindIII-treated expression vector pET-28b (+) and transformed into Rosetta pLysS. The E. coli cells transformed with this plasmid were plated on LB agar containing 100 μg/ml Kanamycin. The transformant was grown in a 100-ml flask containing 10 ml LB medium supplemented with 100 μg/ml Kanamycin at 37°C until the optical density at 600 nm reached to 0.6–1.0, and then 0.8 mM IPTG were added to induce target protein expression. After incubation at 37°C for more than 8 h with shaking at 200 rpm, cells were harvested by centrifugation (6000g for 5 min at 4°C) and washed twice with cold 50 mM Tris-HCl buffer (pH7.0), and the cell pellet was stored at −20°C for further use.

Preparation of biomass

Cells were incubated at 37°C on an orbital shaker at 150 rpm for 24 h. After growth, cells were harvested by centrifugation (6000g, 5 min), washed two times with 30 mM ethylenediaminetetraacetic acid (EDTA) solution. Subsequently, cells were washed twice with deionised water. Then the cells were resuspended in phosphate buffer (10 mM, pH 7.0).

Measurement of sedimentation ability

The sedimentation ability was evaluated under standard conditions. Briefly, cells suspensions were placed in a 25 ml cylinder, at 5 g dry weight L-1 in phosphate buffer (10 mM, pH 7.0), containing 4 mM Ca²⁺. Then, the sediment ability of the E.coil strain was tested in phosphate buffer (10 mM, pH 7.0). At defined periods of time, samples were taken from a fixed position of the cylinder (the level corresponding to 20 ml) and dispersed in 30 mM EDTA solution. Cell concentration after a t time (Ct) was determined by measuring the absorbance of the suspension at 600 nm. Calibration curves (absorbance versus either number of cells or dry weight) were previously constructed.

In order to determine the initial cell concentration, 5 g dry weight L-1 of cell suspensions were placed in 30 mM EDTA solution, in a 25 ml cylinder. The suspensions were agitated. Samples were taken and diluted in 30 mM EDTA solution, before absorbance was determined at 600 nm (Ci).

The % of settled cells (%SC) was calculated by the following equation: %SC=100–(Ct / Ci) ×100, where Ci is the initial cell concentration and Ct is the cell concentration in suspension after t time [3].

Result

For comparative purposes, two E.coli strains with or without flocculation gene were used. The results were shown in Fig. 1. It was showed that the control strain could not settle efficiently within a short time. After 20 min static placement, only 55% of cells were flocculated. In contrast, the recombinant strain was strongly flocculent, 70% of cells were flocculated within only 10 min. At last, about 80% of the cells were settled after 20 min. The results indicated that the flocculation gene was expressed successfully in the E.coli strain. The flocculation ability of the recombinant strain could give us a new sight to remove cells from liquid environment. However, we only observed the flocculation characters of the strain in phosphate buffer containing 4 mM Ca2+, and we did not test the flocculation ability of the strain in the waste water which contains various metal ions and organic pollutant, and that is what we will focus on in our further study.

Fig. 1. Settling profiles of E.coil with or without flocculation gene.

Conclusion

In total, this work supported our project with convenience in enriching the nanocrystals and reliability against secondary pollution. Eventually, we can realize our double-win goal, safeguarding our environment by removing heavy metal ions and yielding available nanocrystals. However, this work was limited in the laboratory.

Reference

1. Fang Ma, Junliang Liu, Shugeng Li, Jixian Yang, Liqiu Zhang, Bo Wu, Yanbin Zhu. Development of complex microbial flocculant. China water and wastewater, 2003, 19(4):1-5.
2. Yuguang Chang, Fang Ma, Jingbo Guo, Nanqi Ren. Flocculent genomic clone and flocculating mechanism analysis. Environmental Science, 2007, 28(12):2849-2855.
3. Soares, E.V., Flocculation in Saccharomyces cerevisiae: a review. Journal of Applied Microbiology, 2011. 110(1): p. 1-18.