From 2014.igem.org

Revision as of 19:51, 15 October 2014 by Vblos (Talk | contribs)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

iGEM Berlin

Explore our Project:

1. What is it all about?
2. Animation
3. Detailed description of the different strategies
4. Flow Chart with the strategies
5) Our Results
6. Lab-summary
7. Notebook

GO TO TOP

1

What is it all about?

iGEM Berlin 2014: A remote control for E. coli
As the first iGEM team from Berlin to take part in the competition, we decided to construct a simple BioBrick that enables synthetic biologists to remotely control the movement of the laboratory workhorse Escherichia coli. A seemingly simple and non-invasive mechanism for this remote control is the use of magnetic fields, which enable a vast variety of applications. In nature, these are already used by several mammals, as well as bacteria for orientation. Remote-controlled E. coli cells could be used as “bacteria-based nanorobots” in order to maneuver them live in the intestine - targeting diseased tissue or even tumors. Combined with BioBricks from other iGEM teams a local, site-directed treatment of intestine cancer is envisioned[1]. Therefore, we work with the probiotic E. coli strain Nissle 1917, which already has an 80 year history as a treatment for chronically inflamed intestine tissue and is sold commonly as “Mutaflor”[2]. Our experiments should enable us to construct simple BioBricks capable to produce a diverse set of nanoparticles, including quantum dots, magnetic nanoparticles, semiconductor nanoparticles, noble metal nanoparticles and many more[3]. For example, cheap and efficient production of magnetic nanoparticles could be used in hyperthermal cancer therapy. Subsequently, we would like to investigate if our method can also be adapted to the synthesis of rare earth metals, which despite their abundance are not mineable. This would offer an alternative to the environmental hazardous mining operations that are common today. A remote control for E. coli will enable a whole variety of application relevant for bioprocess engineering. Therefore one can imagine neglecting centrifugation for cell separation - simply use a magnet. Also, it should be possible to use high frequent oscillating magnetic fields for cell lysis or even use rotating magnetic fields for self-stirring cultures in bioreactors solving scale up limiting issues like tip speed. Nature is the world’s most skilled engineer and has naturally occurring magnetotactic bacteria such as Magnetospirrilium magneticum. Under certain conditions, these organisms form magnetosomes, which are chains of magnetite nanoparticles. These function as an intracellular compass for the cell and even allow them to orientate along earth’s weak magnetic field. As previous iGEM teams have shown, synthesizing fully functional magnetosomes in E. coli is highly difficult as more than 60 highly regulated genes are involved[4]. The Berlin iGEM team came up with an alternative strategy that does not rely on the formation of magnetosomes. By knocking out the iron efflux transporter gene FieF and the iron uptake suppressor Fur, we want to increase the total iron level of the cytosol. By sequestering iron in a ferritin protein, iron crystals are formed and the cell is detoxified. In order to create ferromagnetic crystals, we will use intensive high-throughput growth medium optimization to discover the best conditions for the formation of magnetic nanoparticles in E. coli. We will work with other metal binding proteins such as metallothioneins and phytochelatin synthases in order to achieve nanoparticle synthesis. Once we have discovered the best way to magnetize E. coli bacteria, we will build and characterize suitable BioBricks that can be used by any research lab or iGEM team in the world in order to remote control the cellular movement.

Involving the Community
Although there are several scientific institutions located in Berlin which are conducting research in synthetic biology, there has never been an iGEM team from Berlin before. This is even more surprising as Berlin with its vibrant bio-arts and diy-biology community seems to be the perfect location for successful iGEM projects. As an interconnected workforce, our team incorporates members from various scientific, cultural and creative backgrounds, which makes our team able to address complex issues from various persepctives. So far, iGEM Berlin consists of students from biotechnology, history, design, medicine, theoretical physics, informatics, and more. So far our diverse team has been able to make valuable connections into the bio-arts scene of Berlin, working together with think tanks such as the Hybrid Plattform, as well as EU advisor Markus Schmidt and his Biofaction AG. Supported by the Hybrid Plattform, we organized a science and design workshop event on the 8/9.08.2014. During this event we conducted a series of short presentations about synthetic biology, as well as about prototyping and speculative design. Participants from different backgrounds designed and constructed interactions, which deal with the idea of a biological modularity. The resulting interactions addressed currently debating issues about the future of syntheic biology applications. Surpisingly the participants focused on topics like performance enhancement, transhumanism, alternative materials and housing as well as standardiziation. By explaining the basic principles of synthetic biology and approaching synthetic biology with a limited complexity synthetic biological speculation became easily accessible and reached wide variety of people. In the beginning of September, we collaborated with the artists and scientists from the c-lab collectiv (UK) as well as the Artlaboratory - a berlin bio-arts space. In the Synthetic Biology Workshop artists and other people were introduced to synthetic biology and performed their own cloning experiment. The whole event came to an end in Berlins first Science Café event for synthetic biology organized by the iGEM Berlin Team. During this event, we had speakers from different backgrounds and we discussed chosen aspects of synthetic biology with participants openly over drinks and food. The artist Ping Lui from Cologne presented his speculative design of an oracle based on magnetotactic bacteria. Rüdiger Trojok, a infamous German biohacker presented his current project, Howard Boland shared his bioart projects and former iGEM involvement with us and Johann from our team gave a short presentation about iGEM and our project. These events were designed to have a high impact on the German understanding of synthetic biology and were a major success in Berlin. One of the current major issues in synthetic biology is the laws and regulations concerning patents. iGEM generally refuses patents and promotes the idea of open source biology. However, as the success and applicability of synthetic biology depend on industry investments, there has to be a compromise in policy regulations. To discuss this topic in detail we teamed up with patent lawyers from the Adares Patentanwältekanzlei as well as Biocommons (Creative Commons license model for Synbio) activist Rüdiger Trojok to discuss patenting and fundamental principles of intellectual property.
In summary, we used art events and practical workshops to confront the German public with issues of synthetic biology. Furthermore, our project of creating a remote control for E. coli bears various practical applications as well as expands the possibilities of future functional biological systems.

References
[1] https://2012.igem.org/Team:Penn/ProjectResults (11.07.2014)
[2] http://www.mutaflor.de/cms/ (11.07.2014)
[3] Park, T. J., Lee, S. Y., Heo, N. S. and Seo, T. S. (2010), In Vivo Synthesis of Diverse Metal Nanoparticles by Recombinant Escherichia coli. Angew. Chem. Int. Ed., 49: 7019–7024.
[4] https://2011.igem.org/Team:Washington/Magnetosomes/Magnet_Toolkit (11.07.14)

GO TO TOP

2

Animation

The following animaton visualizes the concept of using ferritin iron storage proteins as a magnetism mediating module.

This animation was developed by Florian Renner who is an science interested and very talented grafic designer based in munich. We thank Florian for his amazing job he did voluntarily for iGEM Berlin helping us to overcome the limitations of our budget.

GO TO TOP

3

Project Outline

3.1 Basics
Advantages and basic principles of using magnetic fields
In order to control E. coli remotely, we decided to use magnetic fields because of a few key reasons. First, magnetic fields allow to control the cells by an external force field which means that cells do not have to be directly treated or media conditions have to be changed as it is the case in many chemotaxis assays. Second, magnets are widely spread and electro magnets easily built as you can see in this video: https://www.youtube.com/watch?v=wzXRFp0DDrU The accessibility and safety of magnetic fields opens up the field for new innovation and ideas using remote controlled bacteria. Third, magnetic fields do have a high energy density and are way more viable to transfer energy than other energy fields like electrical fields. However, the magnetic moment of an atom is the product of of the atoms orbital angular momentum and its electron spins. Atomic magnetism is based on unfilled electron orbits. Nobel gases and alkyl halogenide are non-magnetic or “diamagnetic”. Other elements like metals may have an increased magnetic moment as long as their electron orbit are unfilled, meaning they are unbound. Mn2+, Fe3+ have a magnetic moment of about 5 µB, Cr2+, Mn3+, Fe2+ and Co3+ have a magnetic moment of 3 µB. [http://www.diss.fu-berlin.de/diss/servlets/MCRFileNodeServlet/FUDISS_derivate_000000000626/2_f-Kapitel1.pdf?hosts=]
Because of the variety of atomar magnetic properties, magnetism can be divided into different forms by looking at apparent forces and effects. There is diamagnetism, antiferromagnetism, paramagnetism, ferrimagnetism, superparamagnetism and Ferromagnetism. Ferromagnetic forced are about 1000 times stronger than super paramagnetic forces. However, it turns out that creating ferromagnetic particels or residues is very difficult (see magnetite formation in magnetospirrilium bacteria). Also note that in a lot of biological papers, people tend to mix e.g. super paramagnetism with ferromagnetism [Various magnetic Nanoparticles Paper].
Magnetic properties are depended on the crystal structure of a metall particle. The magnetic moment is proportional to the aligment of the electron spins within an component. If electron spins are alignt magnetism can be observed. However on a nanoscale real ferromagnetism can only be noted after a critical particle size of 128 nm.[An-Hui Lu, An-Hui; E. L. Salabas; Ferdi Schüth (2007). "Magnetic Nanoparticles: Synthesis, Protection, Functionalization, and Application". Angew. Chem. Int. Ed. 46 (8): 1222–1244] This is due to thermal fluctations that prevent the alignment of electron spins and therefore prevent the development of sufficient magnetic moments. Because of this phenomena all meassurements for magnetism are usually conducted at very low temperatures.
All magnetic effects that are observed for particles between 1 nm to 100 nm are considered superparamagnetic. Superparamagnetic nanoparticles only show magnetic effects when an external magentic field is applied. This field aligns the electron spins in the particle resulting in an magnetic moment mediated by an external magnetic field. [Picture Atomarer Magnetismus]

3.2 Iron Homeostasis, E. coli Nissle and Knockouts
As an essential element for almost all life iron is often necessary for the activity of certain proteins but can also be problematic because of its toxicity and poor solubility. Organisms have evolved to regulate their iron effectively and as iron in an organism is usually supplied in a limited condition pathogens evolved iron aquisation systems to outcompete other microorganism. A very efficient iron aquisition system, which bacteria inlcuding E. coli use are siderophore mediated transport pathways. [Simon C. Andrews, Andrea K. Robinson, Francisco Rodriguez-Quinones; School of Animal and Microbial Sciences, University of Reading, Reading RG6 6AJ, UK; 2003] Iron E.coli Link

3.3 Ferritin Strategy
Ferritins as scaffolds for magnetic nanoparticle synthesis
In order to protect themselves against radical stress as well as the lack of co-factors, organisms evolved a high regulated and stable iron acquisition system, also known as iron homeostasis. [Iron Homeostasis of E. coli] To put it in a nutshell iron is taken up by iron transporters or siderophore mediated mechanism and is transporters through the outer membrane into the periplasm, in the periplasm it “changes” transporters and is transported through the inner membrane into the cytoplasm. It always gets released as Fe2+ into the cytoplasm. In order to protect themselves against superoxide formation by the Fenton-Reaction a lot of organisms evolved iron storage proteins. One of the superfamily of these proteins is called ferritin. These ferritins are highly symmertrical protein nanocages synthesizing iron concentrates required for cells to make cofactors of iron proteins. Through their ability to cage in biominerals they were the first and most obvious scaffolds for the synthesis of magnetic nanoparticles. These natural metal storage homomers form solid particles inside of their protein shell. Ferritins are ubiquitous in nature and protect the cell from redox stress through iron overload and from iron deficiency. They consist of 24 protein subunits which can consists of a heavy (catalytical active) and light chain (catalytical inactive but stabilizing). Caged ferritin minerals can have diameters as larg as 8-12 nm with thousands of iron and oxygen atoms. Between species ferritins have different affinity for phosphate. Phosphate is low in animal ferritin iron minerals (Fe:P = 8:1) whereas in bacterial and plant ferritins iron minerals are usually occurring in higher relations (Fe:P = 1:1).[1] Mössbauer studies on the superparamagnetic character of bacterioferritins (bfr) revealed that the phosphate concentration in a ferritin iron mineral reduces superparamegntic effects heavily due to replacement of the iron bridges between the iron atoms with phosphate. As these bridges have a lower exchange constant the order temperature is reduced further. [2] The hollow ferritin nanocages are used in the chemical industry as scaffolds for synthesis of magnetite particles as well as for delivery of magnetic resonance imaging (MRI) contrast agents, drug delivery and catalysis.
[1]
Ferritins for Chemistry and for Life.
Elizabeth C Theil, Rabindra K Behera, Takehiko Tosha Children's Hospital Oakland Research Institute, University of California, Berkeley ; Department of Nutritional Science and Toxicology, University of California, Berkeley. Coordination Chemistry Reviews (Impact Factor: 11.02). 01/2013; 257(2):579-586. DOI: 10.1016/j.ccr.2012.05.013
[2] Mössbauer studies of superparamagnetism in E. coli; Hawkins, C.; Williams, J. M. Journal of Magnetism and Magnetic Materials, Volume 104, p. 1549-1550

iGEM Berlin Ferritin Library
During our summer we collected a variety of ferritin-coding sequences from bacterial and mammalian sources. As ferritins are common among all organisms we categorized our ferritins in three major groups. (Table)

3.4 Inclusion body Strategy
By talking to the Fussenegger group from the ETH Zurich, who published the superparamagnetism paper about ferritins we got the tip to look for another strategy as they experienced the limitations of ferritins. [1] For this reason, we came up with a different strategy. Park et al came up with a different strategy for the synthesis of biogenic nanoparticles in E. coli. [2] A strategy where they produced impressive results showing one strategy to synthesize a whole array of diverse nanoparticles with E. coli. (See Figure 1) Two heavy metal binging proteins were combined and co-expressed on one plasmid. Peptides called phytochelatins are produced in fungus and plants to detoxify the cell from harmful heavy metals. Structurally phytochelatins are (gamma-Glu-Cys)n-Gly (n=2-7) peptides and function as metal ion accumulators through formation of peptide-metal conjugates. In this study the phytochelatin synthase from Arabidopsis thaliana (Columbia leave) was used (ATPCS). The other peptid that was used in combination with ATPCS was a metallothionein from Pseudomonas Putida KT2240 strain (PPMT). Metallothioneins are low-molecular proteins with a high content of cysteine and bind well cadmium, zinc, nickel and copper. For expression of ATPCS a trc promotor was used while PPMT was expressed using a T5 promotor. After co expressing both proteins in an standard E. coli strain(DH5alpha) for 4 h the culture broth was centrifuged and fresh metal rich LB media added. (1 – 5 mM of corresponding final metal concentration (see table 1.). After further incubation at 37°C for about 6 - 12 hours the cultures and the biogenic synthesized nanoparticles can be harvested. Park et al reported further that by incubating these ATPCS and PPMT co-expressing in 1.0 mM FeSO4 and MnCl2 magnetic nanoparticles where obtained and cell moved by high magnetic fields (see figure 2).

[1] Kim T, Moore D, Fussenegger M. Genetically programmed superparamagnetic behavior of mammalian cells. J Biotechnol. 2012 Dec 31;162(2-3):237-45. doi: 10.1016/j.jbiotec.2012.09.019. Epub 2012 Oct 2. PubMed PMID: 23036923.
[2] Park, T. J., Lee, S. Y., Heo, N. S. and Seo, T. S. (2010), In Vivo Synthesis of Diverse Metal Nanoparticles by Recombinant Escherichia coli. Angew. Chem. Int. Ed., 49: 7019–7024. doi: 10.1002/anie.201001524
[3] Wu CM, Lin LY. Immobilization of metallothionein as a sensitive biosensor chip for the detection of metal ions by surface plasmon resonance. Biosens Bioelectron. 2004 Nov 1;20(4):864-71. PubMed PMID: 15522603.

3.5 Magnetic modelleing (Andres)

GO TO TOP

4

Flow Chart

GO TO TOP

5

The Results

Results, jo!

GO TO TOP

6

Lab Summary

Week 1: 02.04.2014 – 06.04.2014

Cultivation of E. coli Nissle 1917
Genomic DNA extraction of E.coli Nissle strain
Production of BfR, FTNA1 and FTNA2
Restriction digest
PCR Purification
Ligation Assay
Transformation into DH5α-Cells

Week 2: 07.04.2014 – 13.04.2014

Colony PCR to check the results
Bfr, FTNA 1, FTNA 2 primar designed for amplification
Transformation of pQE_80L into DH5α
Cultivation of BfR, FTNA 1, FTNA 2 in LB

Week 3: 14.04.2014 – 20.04.2014

Miniprep of the cells from Week 2
DNA concentration determination and sequencing
Expression of BfR, FTNA 1, FTNA 2 and induction with IPTG
Production of a Mutaflor-Supression culture and streaking

Week 4: 21.04.2014 – 27. 04.2014

Minirep

Week 5: 28.04.2014 – 04.05.2014

PCR Plasmid/Primar and Parameter check with Q5 Polymerase and Phusion Polymerase
Miniprep of [pKD46+ DH5α] and [pKD4 + DH5 α]
Genomic DNA extraction from Pseudomonas putida
Enzyme digestion of different plasmids

Week 6: 05.05.2014 – 11.05.2014

Preculture of strains from Budisa strain databse in LB medium and Midiprep
Canamycin cassette PCR of pKD4
Restriction digest of Plasmid pKD4 and pKD46v

Week 7: 12.05.2014 – 18.05.2014

Biotransformation of Ferritin and pKD46 in Nissle and DH5 α strains

Week 8: 19.05.2014 – 25.05.2014

Gel extraction of FieF PCR
Gene Knockout of FieF in [RV + pKD46] and [WM10+pKD46]
Transformation of pKD46 in Nissle and MG 1655
PCR of ATPCS and PPMT
Digestion of pQE_80L for cloning

Week 9: 26.05.2014 – 01.06.2014

Production of LB plates
AMB-1 and Microfluidic Chip were picked up from Max-Plank Institute

Week 10: 02.06.2014 – 08.06.2014

Colony PCR and analytical gel electrophoresis for identifying the right clones
PCR of ATPCS and PPMT to identify the correct amplification parameter.
Colony PCR for Knockout.
PCR of ATPCS and PPMT with Q5 High Fidelity Mastermix.

Week 11: 09.06.2014 – 15.06.2014

Refine the PCR of PPMT and ATPCS with DMSO

Week 12: 16.06.2014 – 22.06.2014

PCR amplification of ATPCS from cDNA
Colony PCR to seperate cells with FieF Knockout
Restrcition digest of pQE_80L and ATPCS-PCR Fragment
Test expression of Ferritin in RV308 (pSB1C3_Ferritin) and Nissle (pSB1C3_Ferritin)

Week 13: 23.06.2014 – 29.06.2014

Amplification of ATPCS from cDNA and PCR Purification
Preparation of Nissle, Nissle + Ferritin, RV 308, Rv 308 + Ferritin pre-cultures
Transformation of human Ferritin on PC514 to Nissle and RV 308
Induction of Ferritin expression with IPTG

Week 14: 30.06.2014 – 06.07.2014

Colony PCR and Ligation of ATPCS
Knockout of FieF and FUR in RV308 and Nissle
Transformation of RFP device and Ferritin in RV308, Nissle and WM110 strains.
PCR amplification of knockout cassette FUR/FieF
Expression of RV308 (RFP) and RV308 (RFP + Ferritin) after Induction with IPTG

Week 15: 07.07.2014 – 13.07.2014

Preparation of cryostocks and pre-cultures of ATPCS clone 1-10, WM 110, RV 308, Nissle
PCR of PPMT with goTaq Polymerase
Miniprep of ATPCS clone number 3

Week 16: 14.07.2014-20.07.2014

Midiprep of pQE_80L , PMA-T_PPMT, pKD46
Digestion of pQE_80L with Hind III and SacI

Week 17: 21.07.2014-27.07.2014

Miniprep and Restriction of pBADex-mYFP Venus (Amp); pEx-HisII (Amp); pJS418_Phagemid (dummy) (Cm)
Ligation of PPMT Fragment from pMAC_PPMT into pEX_HisII

Week 18: 28.07.2014-3.08.2014

Degradation test of prepped TB-Expression Plasmids
Transformation of pEX_His_PPMT in MG1655, DH5α, DH10B strains
Colony PCR of the PPMT clones
Miniprep and Sequencing of pEX_His_PPMT in DH5 α
Ligation of ATPCS PCR Fragment into pQE_80 L
Colony PCR of pQE_80L_ATPCS

Week 19: 04.08.2014 -10.08.2014

Preculture of ATPCS clones for Sequencing
PCR of BamHI_PPMT_GS, GS_ATPCS_HindIII, BamHi_HuFerritin_HindIII
Transformation of BFR M52H in DH10B.

Week 20: 11.08.2014 - 17.08.2014

Prepare chemically competent cells
Generation of Heme-free BFR by Site-directed Mutagenesis
Digestion of various PCR fragements for cloning into pQE_80L
Colony PCR of pQE_80L
Clone Sequencing

Week 21: 18.08.2014 – 24.08.2014

SDS-PAGE with Coomasie staining for identification of protein expression

Week 22: 25.08.2014 – 31.08.2014

Calibration curve for iron concentration measurement

Week 23: 15.09.2014 – 21.09.2014

Preparing cultures for fluorescence microscopy
Constructing pQE_80L_T5_ATPCS_lac_PPMT
Digest and Dephosphorylation of vector pQE_80L_ATPCS
PCR of Biobrick parts (BB0-BB3)
Digest of pSB1C3-Ferritin

Week 24: 22.09.2014 – 28.09.2014

Preparation of pre-cultures
Checking insertion of gene in ATPCS_PPMT clones by colony PCR
Digestion of miniprepped pSB1C3_Ferritin (Calgary) for extraction of vector for Biobrick preparation
Mutagenesis of ATPCS in different plasmid_ATPCS construct
Berlin Vector – pQE-80L-JBFS- huFerritin Assembly PCR
Isolation of plasmid DNA of pQE80L_ATPCSMut_GS_PPMT and pQE80L_ATPCS_PPMT
Repeat PCR of Biobricks

Week 25: 29.09.2014 – 05.10.2014

Digestion of Biobrick parts
Ligation of Biobrick parts with pSB1C3 backbone
Plasmid Digestion and checked with PCR

Week 25 06.10.2014 – 12.10.2014

Colony PCR
Miniprep of cultures and preparation of sequencing samples
Preculture of knockouts
PCR of pSB1C3 backbone
Extraction of PCR Product (pSB1C3 linearised)
Iron concentration measurement in knockout strains

GO TO TOP

7

Notebook

04/02 Wednesday - Cultivating E. coli Nissle 1917

LB plates were produced without antibiotic. Therefore 10 ml MQ-H₂O were sterile filtered in 15 ml falcon tube. 1 capsule Mutaflor 331800 was solved in the sterile water. The E. coli Nissle solution was incubated at 37°C and 200 rpm for 1 h and crossed out at 4 plates to get different dilution of cells.

dilution	E. coli Nissle solution	H₂O	dilution factor
I	2 µl	1998 µl	1:10³
II	100 µl from dilution I	900 µl	1:10⁴
III	10 µl from dilution II	990 µl	1:10⁵

04/03 Thursday - Genomic DNA extraction of ECN - first step

For extraction of the genomic DNA of E. coli Nissle, 2 E. coli colonies were oicked from LB plate (dilution 1:10³) and used for inocculation of 6 ml LB precultures. These were grown over night at 37°C and 200 rpm.

04/04 Friday - Genomic DNA extraction of ECN - second step

For preperation of the genomic DNA 1 ml of each preculture was taken and a genomic extraction performed using the Wizard Genomic DNA purification Kit. See instructions of the purification Kit by Promega. Genomic DNA was stored at 12°C in fridge. As E. coli Nissle is a natural organism without resistence genes both precultures were streaked out on LB, LB+KAN and LB+AMP. All plates were incuvated over the weekend at 37°C. DNA concentration was meassured by 260 nm using Goldi. DNA was diluted 1:40 in a UV cuvette and DNA absorption meassured at 260/28 nm in goldi.
'''For genomic DNA:'''

1:	1390 ng/µl
2:	988 ng/µl

04/05 Saturday - Genomic DNA extraction of ECN - results

Bacteria growth only on LB plate indicates that there was no contamination with AMP or KAN restinatant E. coli. This doesn´t mean that there is no contamination at all. See for sure on PCR.

LB	LB+KAN	LB+AMP
+	-	-

04/06 Sunday

           Production of BfR, FTNA1 and FTNA2
           Restriction digest
           After 2 purifications of plasmids:

p1	84ng/µl	10µl
p2	72,2ng/µl	10µl
p3	54,8ng/µl	23µl

           Restriction program

	1x	4x
plasmid P2	3µl	12µl
BamHI (FD)	1µl	4µl
HindIII (FD)	1µl	4µl
Buffer (FD)	2µl	8µl
H₂O	13µl	52µl

           --> 37°C for 1h (restriction)
           --> 80°C for 10min (deactivation)

PCR	6,38µl	4,56µl	2,71µl
BamHI (FD)	1µl	1µl	1µl
HindIII (FD)	1µl	1µl	1µl
Buffer (FD)	2µl	2µl	2µl
H₂O	19,62µl	21,44µl	23,29µl

           --> 37°C for 1h (restriction)
           --> 80°C for 10min (deactivation)

Plasmid	1	2	3
P	10µl	10µl	18µl
BamHI (FD)	1µl	1µl	1µl
HindIII (FD)	1µl	1µl	1µl
Buffer (FD)	2µl	2µl	3µl
nuc.free H₂O	6µl	6µl	7µl

           --> 37°C for 1h (restriction)
           --> 80°C for 10min (deactivation)

           PCR Purification (without isopropanol)

           Elution buffer 20µl; 1min incubated

plasmid P1-3	45,3ng/µl
BfR	12,9ng/µl
FTNA1	34,4 ng/µl
FTNA2	29,9ng/µl

           Ligation Assay

-	Control	BFR	BFR	BFR	FTNA1	FTNA1	FTNA1	FTNA2	FTNA2	FTNA2	BFR_E	BFR_E	BFR_E
Dilution	-	1x	3x	5x	1x	3x	5x	1x	3x	5x	1x	3x	5x
Vector DNA	1,1	1,1	1,1	1,1	1,1	1,1	1,1	1,1	1,1	1,1	1,1	1,1	1,1
Insert DNA	0	0,4	1,6	2,0	0,10	0,47	0,79	0,18	0,52	0,90	0,40	1,16	2,0
Buffer	1	1	1	1	1	1	1	1	1	1	1	1	1
T4 DNA-Ligase	0,25	0,25	0,25	0,25	0,25	0,25	0,25	0,25	0,25	0,25	0,25	0,25	0,25
H₂O	7,65	7,25	6,5	5,65	7,5	7,20	6,85	7,50	7,20	6,85	7,25	6,50	5,65

           Transformation
           --> Transformation of 5µl Sample into DH5α-Cells
           --> Incubation o/n at 37°C after streating out on LB+amp plates using sterile beads

BFR	FTNA1	FTNA2
5,2ng	5,51ng	5,43ng
15,6ng	16,5ng	16,27ng
26,0ng	27,4ng	27,13ng

04/07 Monday - Cloning Results

Sample	CFU
Control	13
tBFR 1	121
tBFR 3	38
tBFR 5	664
BFR 1	87
BFR 3	151
BFR 5	150
FTNA1 1	65
FTNA1 3	131
FTNA1 6	191
FTNA2 1	84
FTNA2 3	114
FTNA2 5	151

           --> picked 5 colos per construct for coloPCR (50µl TE-buffer; 96°C; 10min)
           --> rescue plate

           colPCR Programm

-	1x	Mastermix 23x
nuc.free H₂O	13,7µl	315,1µl
10x Dream Taq Buffer	2µl	46µl
25mM MgCl₂	1,2µl	27,6µl
10mM dNTPs	0,5µl	11,5µl
Primer T5 prom (PB16)	0,5µl	11,5µl
Primer T5 term (PB17)	0,5µl	11,5µl

boiled colos	1µl + 18,4ml Mastermix
Taq Polymerase	0,5µl

Temperature	Time
95°C	3'
30 cycles
95°C	30
55°C	30
72°C	1'

72°C	10'
12°C	hold

04/08 Tuesday - Amplification of ferritin genes

Primer designed for amplification:

           primer Bfr:

           FW: 5'   GC   G| G A T C C AAAGGTGATACTAAAGTTATAAATTATCTC(GC 23,33% Tm = 57,5)  3'  OK

           RW: 5'   GC   A| A G C T T TCAACCTTCTTCGCG(GC 50% Tm = 58,5)  3'                    OK

           primer FtnA1:

           FW: 5'   GC   G| G A T C C GCAACCGCTGGAATG(GC 60%  Tm = 60,5) 3'                    OK

           RW: 5'   GC   A| A G C T T TCAATGCAGCTGATGC(GC 50,0% Tm = 58,5)  3'                 OK

           primer FtnA2:

           FW: 5'   GC   G| G A T C C CTGAAACCAGAAATGATTG(GC 36,8%  Tm = 65,1)  3'             OK

           RW: 5'   GC   A| A G C T T TTAGTTTTGTGTGTCGAGG(GC 42,1%  Tm = 56,8)  3'             OK

           Using the Thermoscientific  PCR mastermix phusion polymerase, 2x 50 µl reactions per amplification:

Nuc-free H₂O	39,5 µl
2x mastermix	50,0 µl
FW primer	5,0 µl
RW primer	5,0 µl
template DNA	0,5 µl

           PCR programs:

	98°C	10s	1x
	98°C	5s	30x
primer	Bfr/ FtnA1/ FtnA2	60,5°C/ 58,9°C/ 56,1°C	30x
	72°C	10s	30x
72°C	60s	Beispiel	1x

           Transformation of pQE_80L into DH5alpha

           Plasmid from plasmid database of TU workgroup by Prof. Budisa was taken: 

           plasmid ID: 4; concentration = 308 ng/µl

           Unthaw 50 µl aliquot of DH5alpha or BL21 DE3 gold on ice for 10 min.Than Use 308 ng and 616 ng of plasmids to bind on Ca2+-surface of the cell membranes. Heat shock was performed for 30-90 s. The cells were incubated on ice for 2 min and than there was added 950 µl LB media. The cells were incubated at 37°C for 60 min. After this 70 µl of transformed E. coli suspension was streacked out onto a plate with the appropriate selection marker. The plate was incubated over night at 37°C. To prepare preculture 2 colonies were picked and added into 5 ml LB media + 5 µl AMP. The precultures were incubated over night at 37°C and 200 rpm.

04/10 Thursday - Expression of Ferritin in LB

→Innoculate 20ml LB + amp with 1ml of a preculture

Title	No.	Wavelength	Absobance	Volume
BfR	1	600nm	0,529A	1,51ml
FTNA1	2	600nm	0,307A	3,25ml
FTNA2	3	600nm	0,605A	1,32ml

           →Incubation for 2h until OD₆₀₀=0,6-08

Title	No.	Wavelength	Absobance
BfR	1	600nm	0,825A
FTNA1	2	600nm	0,883A
FTNA2	3	600nm	0,859A

           → Take SDS Sample non-induced

           →Induce with 20µl IPTG

           →Add Fe²⁺

           →Expression: 4h at 22°C

           
            Cultivation was aborted because of heat development

.

04/14 Monday - Miniprep

Miniprep of the cell-seperation streak out of the cloning procedure from december 2013
Miniprep-Kit of ThermoScientific

-	Title	Concentration in ng/µl
A4	BfR	66
B3	FTNA1	138
C5	FTNA2	88
D2	BfR_Electro	144

           DNA Concentration Determination

Dilution Factor	20
Integration Time	1s
Factor	50
Units	µg/ml

-	Title	No.	260nm	280nm	320nm	Ratio	Conc.
A4	BfR	1	0,056	-0,022	-0,010	2,05	66
B3	FTNA1	2	0,135	0,067	-0,003	1,96	138
C5	FTNA2	3	0,078	0,035	-0,008	2,00	86
D2	BfR-Electro	4	0,150	0,078	0,006	2,02	144

04/16 Wednesday - Sequencing

Preparation of the sequencing for the Samples from 16.01.2013

T5 prom. Primer	3µl
Plasmid	12µl

A4	6µl
B3	6µl
C5	6µl
D2	6µl

04/17 Thursday - Expression of BfR and FTNA1/2

4x sterile 250ml Erlenmeyer
+50ml LB
+50µl amp
+2,5ml preculture
Incubation: 1h at 30°C

No.	Title	Wavelength	Absorbance
1	BfR	600nm	0,909A
2	FTNA1	600nm	0,980A
3	FTNA2	600nm	0,930A
4	BfR+20??	600nm	0,970A

→Take SDS-Sample
→Induction with 50µl IPTG
→Addition of 0,0525g Fe-citrate (20mM dissolved in 1ml sterile Water)
→Incubation for 3h at 30°C
→continue incubation o/n
→Centrifuge with 6800g for 5min

04/18 Friday - Production of LB-Plates

Production of a Mutaflor-Supression-culture →10ml sterile LB
→Add the content of a Mutaflor capsula (white pouder)
Incubation: 37°C at 220rpm
Production of Dilutions of the Supression-culture and out streaking →1µl of the supression-culture to 999µl LB (1:1000)
→100µl of that dilution to 900µl LB (1:10⁴)
→10µl of that dilution to 990µl LB (1:10⁵)
→Streak out 50µl of each culture on LB with sterile beads
Incubation: 37°C

04/24 Thursday - Mini-Prep

1	PSB	D40	9fP	CR/LB
2	PSB	D20	9fP	CR/LB
3	PSB	D40	fs	LB/CR
4	PSB	D40	LB/CR
5	PSB	AB	Turyu	CR/LB
6	PSB	D48	9fP	CB/CR

04/28 Monday -PCR Plasmid/ Primer and Parameter Check

(Salah and Christina)
Check of:
-Plasmids/Primer
-Annealing temperature
-Phusion and Q5 Polymerase Plasmids

           iGEM Plasmid pkD4 (Stock 200ng/µl) =>1:200 diluted = 1ng/µl

           WH (Willi Hauke) Plasmid pkD4 (0,72ng/µl)

           Primer

           P1 FieF (iGEM)                                   fwd tnaA KO (WH)

           P2 FieF (iGEM)                                   rev  tnaA KO (WH)

           Combinations

           (4 combinations with Phusion; 4 combinations with Q5 )

	Plasmid	Primer	Primer
1.	iGEM Plasmid	P1 (iGEM)	P2 (iGEM)
2.	WH Plasmid	fwd tnaA KO	rev tnaA KO POSITIVCONTROL
3.	iGEM Plasmid	fwd tnaA KO	rev tnaA KO
4.	WH Plasmid	P1 (iGEM)	P2 (iGEM)

           Each of the four combinations was prepared 3 times => for Gradient PCR

           Phusion Polymerase PCR Assay

           20µl Reaction

	Plasmid	Primer	Primer
1.	iGEM Plasmid	P1 (iGEM)	P2 (iGEM)
2.	WH Plasmid	fwd tnaA KO	rev tnaA KO POSITIVCONTROL
3.	iGEM Plasmid	fwd tnaA KO	rev tnaA KO
4.	WH Plasmid	P1 (iGEM)	P2 (iGEM)

           Q5 Polymerase PCR Assay

           20µl Reaction

5xQ5 Reaction Puffer (G2 runder Behälter)	4µl	1x
10mM dNTPs	0,4µl	200µM
10µM forward Primer	1µl	0,5µM
10µM reverse Primer	1µl	0,5µM
Template DNA	1µl	1pg-1ng sein
Q5 High Fidelity DNA Polymerase	0,2µl	0,02U/µl
GC enhancer	4 µl
Nuclease-Free Water	to 20µl

	8,4µl

           FUR PCR Assay

           (Along with the above mentioned PCR Assays another Gradient PCR with FUR-Primer is performed)

           Aliquot of the FUR Primer (100µM) 1:10 diluted =>10µM

           20µl Reaction with Phusion-Polymerase (see above)

           with WH Plasmid and P1 FUR & P2 FUR Primer

           Gradient PCR Program

           Thermocycling Conditions for the Gradient PCR

           Programm-NAME: Q5 grad trp KO

Step	TEMP	TIME
Initial Denaturation	98°C	30 sec
5 Cycles	98°C	8 sec
	64±5°C	25 sec GRADIENT
	72°C	Trp ko: 1528bpà45s
25 Cycles	98°C	8 sec
	72°C	70 sec
Final Extension	72°C	2 min
Hold	8°C

           Gel-Electrophoresis

           1% Agarose Gel

           5µl Sample +1µl loading dye (1:6)

           8µl diluted GeneRuler Mix ladder

           MODE: 90V 25min

           Sample label:

           P = with Phusion Polymerase

           Q = with Q5 Polymerase

           1 = 1. Kombination

           2 = 2. Kombination

           3 = 3. Kombination

           4 = 4. Kombination

           Gradient

           1 = 59°C

           4 = 63°C

           8 = 69°C

Gel 1 Phusion

'

P FUR

P1

P2

Marker

P3

P4

8

1

4

8

1

4

8

1

4

8

1

4

8

Gel 2 Q5

Q1

Q2

Marker

Q3

Q4

1

4

8

1

4

8

1

4

8

1

4

8

           Results

Gel 1 Phusion Result:	For FUR-Primer no Amplifikation

	For iGEM-Plasmid no Amplifikation

	Combination 2 (WH Plasmid & Primer)= only non-specific amplification

	Combination 4 (WH Plasmid & iGEM Primer)=Bands for 59°C and 63°C + non-specific amplification


Gel 2 Q5 Result:	For iGEM-Plasmid no Amplifikation

	Combination 2 (WH Plasmid & Primer) = bands for all three annealing temperature observed+non-specific amplification

	Combination 4 (WH Plasmid & iGEM Primer)= Bands at all three annealing temperature+non-specific amplification

iGEM Plasmid not to be used anymore. FUR need to be checked again.

04/29 Tuesday - Mini-Prep

(Aritra)
[pKD46 + DH5α]→ 155ng/µl
[pKD4 + DH5α]→ 302ng/µl

05/02 Friday - Genomic DNA extraction from Psedomonas putida

(Johann)
-->see Protocol Wizard ® Genomic DNA Purification Kit - Strain from VLB Martin Senz PHO Psedomonas putida KT2242 B_0712 from 29.04.2014 culture
- 2 days in 30°C Shaking Incubator.
- Mikro 22R Centrifuge Hettich (16000g)
Final DNA Concentration measured after purification = 95ng/µl

02.05.2014 - DNA Digestion to test Plasmids

Samples	Conc. DNA (ng/µl)	Enzymes used	Expected band length	Evaluation
pKD4	302	Xbal	1874,1393	Possible plasmid, failed
pKD46	40	EcoRI	4820,1509	Failed
pKD46	39	EcoRI	4820,1509	Failed
pKD4	60	Xbal	1874,1393	Possible(passed); whole plasmid
pSBAC3	88	SpeI/EcoRI	2047,22	Possible (passed); smallpattern
pSBAC3-D20-GFP	115	SpeI/EcoRI	2047,957	whole plasmid; failed
pSBAC3-D40-Bfr	86	SpeI/EcoRI	2047, 774	Whole plasmid; failed
pSBAC3-D40-GFP	80	SpeI/EcoRI	2047,1014	Whole plasmid; failed
pSBAC3-AB-Tyrosin	110	SpeI/EcoRI	2047,3319	Failed
pSBAC3-D40	164	SpeI/EcoRI	2047,267	Failed
pSBAC3-D40-GFP-ssr	106	SpeI/EcoRI	2047,1032	Passed; whole plasmid

           Gel Electrophoresis
           Key:

           -band1: Ladder

           -band5:Ladder

           -residual bands, see table above
           


            

            Results

            pKD4 with 60(ng/µl) best candidate for PCR.

05/05 Monday - Preculture of strains from Budisa strain database in LB Medium

1. BU31 (pKD4) in 50 ml LB+Kanamycin+Ampicillin 37°C 220 rpm
2. BU32 (pKD46) in 50 ml LB+Ampicillin 30°C 240rpm
3. BU31 (pKD46) in LB plate+Ampicillin 30°C
Midiprep Midiprep of BU31 (pKD4) and BU32 (pKD46) from strain Database.
Concentration pKD4 = 104 ng/µl
Concentartion pKD46 = 161 ng/µl

05/06 Tuesday - Gel-Electrophoresis

Kanamycin Cassette PCR (pKD4 from MidiPrep 05.05.2014 104ng/µl Christina)
Key:
- 1st: Ladder

           - 2nd and 3rd: Fief

           - 4th: Negative control

           - 7th and 8th: FUR

           
            
            

            Results
            FieF worked well; FUR no bands

             
           Restriction digest of Plasmid pKD4 and pKD46

'	'	'
	pKD4	pKD46
Plamid	19.2µl	12.5µl
Digestion Enzym	Xbal 1µl	Xmal 1µl
nuclease free H2O	24.8µl	31.5µl
10xFO green Buffer	5µl	5µl
Total	50µl	50µl

              - Both the reaction mix incubated at 37°C for 1 hr.
              - After that another 1 hr at RT.

           Gel-Electrophoresis
           - 20µl of both the samples together with whole plasmids loaded on 1% Agarose Gel

           Results
           Key:

           -1st: pKD4 (XbaI digested)

           -2nd: pKD4 (undigested)

           - 3rd: Ladder

           - 4th: pKD46 (undigested)

           -5th: pKD46 (XmaI digested)

           Gel Extraction
           -Used GeneJet GelExtraction Kit by Thermo Scientific
           Results
           DNA Concentration: 16ng/µl

05/16 Friday - Biotransformation of Ferritin and pKD46 in Nissle and DH5-α strain

concentration Ferritin 120ng/µl
concentration pKD 46 95 ng/µl

           Protocol
           *electro competent cells of DH5α and Nissle were thawed on ice
           *0.4µl of Ferritin and 0.53 µl of pKD46 was added to the cells
           *cells with DNA were transferred to cuvettes for electroporation, then 950ml (LB-medium) was added to the cells immediately
           *incubation at 37°C for ferritin, 30°C for pKd46 for 1 h with shaking
           *the cells were plated on Amp plates for pKD46 and CM for Ferritin
           *Transformation did not work.

05/21 Wednesday - PCR Gel-Extraction of FieF

1% Agarosegel + 0,5µl EtBr
45µl Sample+9µl Loading Dye
8µl Ladder
--> Gel-Extraction Kit used with 50µl nuclease-free water for elution
Gene Knockout of FieF (Salah) Preparation of the preculture Used Precultures:
- RV +pKD46
- WM10 +pKD46
The precultures was diluted to OD₆₀₀=0,1 and then incubated for 2h at 30°C until they reach OD₆₀₀=0,6

Title	Wavelength	Absorbance
Reference	600nm	0,000A
RV+pKD46	600nm	0,066A
WM10+pKD46	600nm	0,050A

           (The culture was diluted 1/10 for the OD measurement)

           →The precultures are ready for the Rekombinase induction with Arabinose
           Induction with Arabinose
           The cultures have been induced with 500µl arabinose (1M)
           →After the induction, the cultures have to be incubated for further 30min at 30°C

Title	Wavelength	Absorbance
Reference	600nm	0,000A
RV+pKD46	600nm	0,084A
WM10+pKD46	600nm	0,067A

           →From now on the cultures need to be cooled on ice
           Preparation for the Electroporation

           Electroporation
           Electroporation-Program: Ec1

           -Amount of DNA sample: 75-150ng

Sample	Conc	Used Volume	Strain	Electroporation Time
FieF1	42ng/µl	2µl (84ng)	RV	4,4ms
FieF2	9ng/µl	10µl (90ng)	RV	4,1ms
FieF1	42ng/µl	2µl (84ng)	WM10	4,3ms
FieF2	9ng/µl	10µl (90ng)	WM10	4,8ms

           After the transformation, the cultures was immediately prepared with 950µl SOC and incubated for 60min at 30°C without antibiotics --> recovery
           Selection-cultures
           The selection of positive clones is done by using LB plates with kan+amp

           Incubation: 30°C o/n

05/22 Thursday - Transformation of pKD46

Preparation of the preculture Used Precultures:
- MG1655
- Nissle
The precultures was diluted to OD₆₀₀=0,1 and then incubated for 2h at 30°C until they reach OD₆₀₀=0,6

Title	Wavelength	Absorbance
Reference	600nm	0,000A
MG1655	600nm	0,062A
NIssle	600nm	0,054A

           (The culture was diluted 1/10 for the OD measurement)

           →From now on the cultures need to be cooled on ice
           Preparation for the Electroporation

           Electroporation
           Electroporation-Program: Ec1

           -Amount of DNA sample: 75-150ng

Sample	Conc	Used Volume	Strain	Electroporation Time
MG1655 1	42ng/µl	2µl (84ng)	RV	5,4ms
MG1655 2	9ng/µl	10µl (90ng)	RV	5,8ms
Nissle 1	42ng/µl	2µl (84ng)	WM10	0,7ms (thrown away)
Nissle 2	9ng/µl	10µl (90ng)	WM10	5,8ms

           After the transformation, the cultures was immediately prepared with 950µl SOC and incubated for 60min at 30°C without antibiotics --> recovery
           Selection-cultures
           The selection of positive clones is done by using LB plates with amp

           Incubation: 30°C o/n

            PCR of ATPCS and PPMT

Mastermix	ATPCS	PPMT
nuc.free water	18.9	17.5
2x Fusion Mastermix	25	25
Fw Primar	2.5	2.5
Rw Primar	2.5	2.5
template DNA	1.1	2.5

ATPCS	Programm
98°C	10
98°C	5 30 cycles
62°C	5 30 cycles
72°C	5 30 cycles
72°C	60 secs
8°C	store

PPMT	Programm
98°C	10
98°C	5 30 cycles
63,1°C	5 30 cycles
72°C	21 30 cycles
72°C	60 secs
8°C	store

           ATPCS 1469 bp; PPMT 234 bp
           --> wrong Programm

05/23 Friday - Digestion of Vector for Cloning

Plasmid: pQE80L
Old Plasmid of Johann:
-P1≈1000ng
-P3≈400ng

P3		P1
SacI	1µl	SacI	1µl
HindIII	1µl	BamHI	1µl
Buffer	2µl	Buffer	2µl
Plasmid 1	4µl	Plasmid 3	16µl
nuc.water	12µl	nuc. water	0µl

           --> Incubation: 1,5h at 37°C

           --> Deactivation: 20min at 80°C

05/27 Tuesday - Production of LB Plates

LB Agar Plates prepared:
4x with Ampicillin (25µl in 25ml)
4x with Ampicillin+ Kanamycin (25µl+25µl in 25ml)
4x Cm (25µl in 25ml)

05/28 Wednesday

Picked up from MPI: AMB-1 and Microfluidic Chip. (From the two AMB-1 cultures, one is in the freeze and the other one in the RT-Incubator)
Digestion of pQE80L:
Marker: 2 log DNA ladder 5µl
Sample 1: P1 Sacl-BamHI 10µl
Sample 2: P3 Sacl-HindIII 10µl

06/02 Monday - Colony PCR and analytical gel electrophoresis for identifying the right clones

Primer: C1 C2

                      C2   C5

Components	20 µL Reaktion


Nuc. Free water	13.7
10x Dream Taq Polymerase Puffer	2
25mM MgCl2	1.2
10mM dNTPs	0.5
10mM FW Primer	0.5
10mM RW Primer	0.5
Colony	1
Taq DNA Pol	0.6

Denaturation	95°C	10min	'
Denaturation	95°C	30sec
Annealing	55°C	30 sec
Extension	72°C	X min	30x
Extension	72°C	10 min
End	12	hold

Backup plates done. Cells given direct to PCR. 11 colonies selected.
Colony PCR with some of the clones performed. (All negative)

06/03 Tuesday - Strategy 2: PCR of ATPCS 2PPMT

             PCR Assay

-	Sample1(PPMT)	Sample2(ATPCS)
nuc. free water	17,5µl	18,9µl
FW Primer	2,5µl	2,5µl
RW Primer	2,5µl	2,5µl
2x Phusion Mastermix	25µl	25µl
Template DNA	2,5µl (250ng)	1,1µl (250ng)

             PCR Program

PPMT (234bp)		ATPCS (1469bp)
98°C	10'	98°C	10'
30cycles start
98°C	5"	98°C	5"
62°C	5"	63°C	5"
72°C	10"	72°C	45"
30cycles stop
72°C	1'	72°C	1'
8°C	hold	8°C	hold

             Gel-Electrophoresis
             Key: 

             2nd band= Ladder

             3rd band= PPMT

             5th band= ATPCS

06/04 Wednesday - PCR amplification of ATPCS and PPMT

(see under protocol "Amplification BamHI_PPMT_Sacl and Sacl_ATPCS_HindIII" After Gel: 1 Band visible for ATPCS around 1500bp (expected); no band for PPMT Purification of the ATPCS-PCR product from gel. conc. of ATPCS-fragment 6ng/microL freezed at -20°C on 1st floor

04.06.2014 - Colony PCR for Knockout

6 clones were picked from 2 Agar plates; Agar plates labelled with numbers with RED

             3 PCR:  a) Primers C1, C3

                     b) Primers C2, C4

                     c) Primers C1, C5

BandNr:	Clone Nr:	PCR type	Primers
1	6	C	C1,C5
2	1	A	C1,C3
3	2	A	C1, C3
4	3	A	C1, C3
5	4	A	C1, C3
6	5	A	C1, C3
7	6	A	C1, C3
8	1	B	C2,C4
9	2	B	C2,C4
10	Marker
11	3	B	C2,C4
12	4	B	C2,C4
13	5	B	C2,C4
14	6	B	C2,C4
15	1	C	C1,C5
16	2	C	C2,C4
17	3	C	C2,C4
18	4	C	C2,C4
19	5	C	C2,C4

Results: all samples with same primers are identical PCR A: one band an dimer (900-800bp) PCR B: one band (1200bp) PCR C: two bands (800 and 400 bp) - 2 of the colonies are quite luckily mix colonies that contains our knockout, bands are shown for wildtype and 2 show amplification for kanR cassette - they should be transfered to a new plate for single colony test

06/05 Thursday - New PCR protocol for ATPCS and PPMT with Q5 High Fidelity MasterMix

             PPMT PCR Reaction:

Component	25µl	Final Conc.
2x Q5 MM	12. Mai	1x
10µM FW Primer	02. Mai	0,5µM
10µM RW Primer	2,5	0,5µM
95ng/µL Putida genomic DNA	2.63 (250ng)	9.99 ng/µL
Nuc. Free water	Apr 87

             ATPCS PCR Reaktion

             result

Component	25µl	Final Conc.
2x Q5 MM	1.,5	1x
10µM FW Primer	Jan 25	0,5µM
10µM RW Primer	Jan 25	0,5µM
230ng/µL Arabidopsis cDNA	1.1 (250ng)	10 ng/µL
Nuc. Free water	08. Sep

             PCR Program
             PPMT 234 bp   
             result

denaturing	98°C	180sec
Denaturing	98°C	10 sec

Annealing 30x
	64°C	30 sec
Elongation	72°C	20 sec
Final Elongation	72°C	2min
Store	8°C

             ATPCS 1469bp 
             result

denaturing	98°C	30 sec
Denaturing	98°C	10 sec

Annealing 30x
	62°C	30 sec
Elongation	72°C	60 sec
Final Elongation	72°C	2min
Store	8°C

05.06.2014

Cryostocks: RV 308 ferritin (Cm)
Nissle ferritin (Cm)
500 µl 7%DMSO+ 500 µl Cell Culture medium => -80°C

06/06 Friday - PCR for ATPCS and PPMT with Q5 High Fidelity MasterMix

PPMT PCR Reaction:

Component	25µl	25µl	Final Conc.
2x Q5 MM	12. Mai	12,5	1x
10µM FW Primer	02. Mai	Jan 25	0,5µM
10µM RW Primer	2,5	Jan 25	0,5µM
95ng/µL Putida genomic DNA	5,26 (500ng)	5,26 (500 ng)
Nuc. Free water	Apr 87	4,74

             ATPCS PCR Reaction

Component	25µl	Final Conc.
2x Q5 MM	12. Mai	1x
10µM FW Primer	Jan 25	0,5µM
10µM RW Primer	Jan 25	0,5µM
230ng/µL Arabidopsis cDNA	2.2 (500ng)
Nuc. Free water	08. Sep

             PCR programm

             PPMT 234 bp

denaturing	98°C	120sec
Denaturing	98°C	10 sec

Annealing 30x
	64°C	30 sec
Elongation	72°C	20 sec
Final Elongation	72°C	2min
Store	8°C

             ATPCS 1469bp

denaturing	98°C	30 sec
Denaturing	98°C	10 sec

Annealing 30x
	62°C	30 sec
Elongation	72°C	60 sec
Final Elongation	72°C	2min
Store	8°C

10µl of PCR reaction + 2µl 6XDNA loading dye was loaded onto a 1 % agarose gel
ATPCS (one clear thick epxacted band at Test of purity and quality of genomic DNA by running it through a 1% agarose gel1400 bp)
PPMT1 (no band)
PPMT2 (no band)

>

             Test of genomic DNA of P.Putida for purity and quality by running it on a 1% agarose gel

             - looks fine on a gel. One clear band over 10 000 bp

             !!! Improve PPMT !!!:

             Try using DMSO (NEB PCR grad) and set Annealingtemperature down to 55°C

             Try different DMSO conc. : 0; 1; 5; 8  %

06/11 Wednesday - Continuation of work from 06.06.2014: PCR for (ATPCS and) PPMT with Q5

PPMT PCR without success last weak. Therefore the temperature of the annealing step should reduce from 64°C up to 55°C in the pcr programm.
1) corrected pcr programm for PPMT

'	T [°C]	t [s]
Denaturating	98	120
Denaturating	98	10
Annealing	55	30
Elongation	72	60
Final Elongation	72	120
Store	8

             2) PPMT pcr reaction

             Different samples with concentrations on DMSO 0%, 1%, 5%, 8% were prepared. Use 99,97% DMSO the samples were prepared with the following pattern:
             The final volume is 25μl.

'	#1 [μl]	#2 [μl]
Q5 MM	12,5	12,5
10 μl FW Primer	2,5	1,25
10 μl RW Primer	2,5	1,25
Putida genomic DNA 95 ng/μl	5,26	5,26
dazu 1.: DMSO,	0	0

nuclease free H₂O	2,24	4,74
dazu 2.: DMSO,	0,25	0,25
nuclease free H₂O	1,99	4,49
dazu 3.: DMSO,	1,25	1,25
nuclease free H₂O	0,99	3,49
dazu 4.: DMSO,	2	2
nuclease free H₂O	0,24	2,74

             the 7 samples were labeled by the following schema:

             PPMT.1.1, PPMT.1.2, PPMT.1.3, PPMT.1.4 (Primer je 2,5μl, DMSO Konz. 0,1,5,8 %)

             PPMT.2.2, PPMT.2.3., PPMT.2.4 (Primer je 1,25μl, DMSO Konz. 1,5,8 %)

06/12 Thursday - PCR of PPMT

Amplification of PPMT with DMSO
''(Continuation of work from 06.06.2014: PCR for PPMT with Q5'' For Protocol please see Labjournal from 11.06.2014

             following labeling for 8 samples was used:

             PPMT.1.1, PPMT.1.2, PPMT.1.3, PPMT.1.4 (Primer je 2,5μl, DMSO Konz. 0,1,5,8 %)

             PPMT 2.1, PPMT.2.2, PPMT.2.3., PPMT.2.4 (Primer je 1,25μl, DMSO Konz. 0,1,5,8 %)

             Gel Electrophoresis

             1µl loading buffer+5 µl sample  loaded on 1% agarose gel; 90V

             (rest of sample in iGEM freezer)

             Results

             contamination from water (band 3000bp for every sample)

             with higher DMSO conc. (5% and 8%) bands from visible

06/17 Tuesday - PCR Amplification of ATPCS from cDNA

PCR-pipetting scheme

Volume [µl]	Chemicals
12,5	2x Q5 Mastermix
1,25	10µM fwd Primer
1,25	10µM rev Primer
2,2	Arabinopsis Thaliana cDNA
8,9	nucl.free H₂O
26,1µl total volume

             PCR-program

PCR-step	Temperature [°C]	Time [sec]
Denaturation	98	30
"30 cycles start"
Denaturation	98	10
Annealing	62	30
Elongation	72	60
"30 cycles stop"
Final Elongation	72	120
Store	8

 

              PCR Purification of ATPCS
              - Kit Purification

              - Elutionbuffer: 30µl

              


              - Final concentration: 69 µg/ml

06/18 Wednesday - PCR of drag outs to separate cells for FieF Knockout

Pick up 7 single colonies + 20µl d. H₂O each (on ice)
--> Labeling: K1, K2, K3, K4, K5, K6, K7
PCR for each colony with Primer combinations: C1-C3, C2-C4, C1-C5 --> 7x3= 21 Samples

             PCR Assay

Amount [µl]	Chemical
1	Sample (Colony)
13,5	d. H₂O
2	10x Dream Taq Polymerasebuffer
1,2	25mM MgCl₂
0,5	10µM fwd Primer
0,5	10µM rev Primer
0,5	10mM dNTPs
0,6	Taq DNA Polymerasse

             PCR Program
             Colony-PCR: Elongation Time : 1,2 Min, Annealing Temp.: 55°C 

 
              Gel Electrophoresis

              

              Result
              RV-strain is not appropriate for Fief-Knockout. Unknown genome leads to unspecific binding of designed primers, too many bonds in gel electrophoresis picture.

06/19 Thursday
Continue working with colonies: K1, K5, K6, K7 from 18.06.2014
PCR-programme:

Amount [µl] Chemical

1 Sample (Colony)

13,5 d. H₂O

2 10x Dream Taq Polymerasebuffer

1,2 25mM MgCl₂

0,5 10µM fwd Primer C1

0,5 10µM rev Primer C4

0,5 10mM dNTPs

0,6 Taq DNA Polymerasse

PCR-programme:
Elongation time: 2Min, Annealing Temperature: 56°C

Magnetization of E. coli by expression of human Ferritin, 1st Experiment part 1 of 4

Aim: Test the possibility of Magnetization of E.coli cells by the expression of human Ferritin:

Procedure:

To evaluate the effect of Ferritin on the Magnetization different cultures were compared:

For Both RV308 and Nissle

Culture 1 2 3 4

Plasimd + - + +

iron + + - +

induction + + + -

- Transform the Human Ferritin gen carried on the Plasmid PC514 provided from (iGEM Team of Calgary university, Canada) to E. coli strains (Nissle and RV308) via electroporation, plate on (Amp) plates for selection.

06/20 Friday Restriction digest of pQE_80L and ATPCS-PCR fragment

1x 5x Mastermix pQE_80L

H2O nucfree 23,1µl 115,5µl 2µl

10x green FD buffer 2µl 10µl 2µl

DNA 2,89µl 14,5µl 14µl

BamHI 1µl 0µl 1µl

SacI 1µl 0µl 1µl

5x Mastermix = Mastermix for ATPCS

Enzymes were added to each single aliqout and not into the Mastermix

Incubation: for 1,5 h at 37 °C

Deactivation: 80°C for 5 min

I used the wrong restriction enzymes as I got confused with the PCR fragment. Digestion with SacI and HindIII is needed not BamHI. Repeat PCR for ATPCS as well as restriction digest!

Test expression of Ferritin in RV308 (pSB1C3_Ferrtin) and Nissle (pSB1C3_Ferrtin)

5ml overnight culture used as an inoculum.

4 ml culture were diluted to 40 ml with LB and grown for 1 h at 37°C until an OD600 of 0.7 and 0.8 was reached.

Non-induced SDS sample was taken and induced with 1 mM IPTG

After expression for 3 h induced SDS sample was taken. SDS PAGE Ferritin band ecpected at 21kDa
Key:
- 1st band: Nissle (non induced)
- 2nd band: RV308 (non induced)
- 3rd band: Ladder
- 4th band: Nissle (induced)
- 5th band: RV308 (induced)

06/25 Wednesday - Amplification of ATPCS (cDNA)
PCR-pipetting scheme

Volume [µl] Chemicals

12,5 2x Q5 Mastermix

1,25 10µM fwd Primer

1,25 10µM rev Primer

1,5 Arabinopsis Thaliana cDNA

8,9 nucl.free H₂O

25,4µl total volume

PCR-program

PCR-step Temperature [°C] Time [sec]

Denaturation 98 30

"30 cycles start"

Denaturation 98 10

Annealing 62 30

Elongation 72 60

"30 cycles stop"

Final Elongation 72 120

Store 8

PCR Purification -Purification Kit

→DNA concentration measurement showed, that the Absorbance ratio of 260nm:280nm is quite low, which means that targeted DNA got contaminated.

Preparation of pre-culture Strains:
- e.coli nissle
- e.coli nissle + ferritin
- RV308
- RV308 + ferritin

Assay - 5ml LB media + 1 picked clone of the pre-day
- Addition of 5µl CN37 to the strains with ferritin

Incubation: 37°C; 170rpm; o/n

06/27 Friday
Magnetization of E. coli by expression of human Ferritin, 1st Experiment part 2 of 4 - Preculture of 1 positive clone over night ( preculture: 7 ml LB+ 7µL Amp + 1 Clone)

06/28 Saturday
Magnetization of E. coli by expression of human Ferritin, 1st Experiment part 3 of 4
- Transfer the Precultures (OD= 0.4-0.5) to 25, 50 mL flasks (half filled with LB) and cultivate them at 37°C for 3 hours RV308 (+,+,+) & (-,+,+) And Nissle (+,+,+) were cultivated in 50 mL flasks

Strain: OD
RV308 0,78
Nissle 0,86

- Induction with (20µl (50 ML flasks)/10µl (25 ML flasks)) IPTG (concentation 1 M).
- Add FeCl2 and MnCl2 (100µL in 50ml flasks/ 50µl in 25ml flasks) Incubation over night at 37C°

Strain: OD
RV308 2.56
Nissle 2.8

06/29 Sunday
Magnetization of E. coli by expression of human Ferritin, 1st Experiment part 4 of 4 -Sampling for testing the Ferritin content via SDS-Page, different ODs were taken in consideration!
-Prepare the sample for SDS-gel by centrifuation and discard the supernatant then add (60µl Dis.water + 15 SDS+ MH-EtoH), boil for 10 min at 94°C.
- Test the Magnetization using an permanent magnet under light microscope.

Evaluation:

SDS Page: was not clear!

Magnetization :

RV308

Culture 1 2 3 4

Plasimd + - + +

iron + + - +

induction + + + -

Nissle In samples with Iron aggregates were observed with strong Mag.effect.

06/30 Monday - Colony PCR and Ligation ATPCS
PCR pipetting scheme

Culture 1 2 3 4

Plasimd + - + +

iron + + - +

induction + + + -

Volume [µl] Chemicals

13,7 nucl.free H₂O

2 10x Dream Taq Buffer

1,2 25mM MgCl₂

0,5 10mM dNTPs

0,5 10µM fwd Primer

0,5 10µM rev Primer

1 Sample (Colony)

0,6 Dream Taq DNA Polymerase

20µl Total Volume

PCR program

PCR-step Temperature [°C] Time [sec]

Denaturating 95 180

30 cycles start

Denaturating 95 30

Annealing 55 30

Elongation 72 120

30cycles stop

Final Elongation 72 600

Store 12

Gel Electrophoresis 1% Agarose gel with EtBr; 8µl sample; 5µl Ladder
"Key:"
First band= Ladder
Each other band is a different picked clone (10 clones were picked)

07/01 Tuesday - ATPCS Ligation
The ligation of ATPCS was checked with 1% Agarose gel (stained with ethidiumbromid) after colony pcr.

07/02 Wednesday - Knockout of Fief and Fur in RV308 and Nissle
To pepare the knockout 5 µl CM solution (pFerritin with canamycin resistance cassette)and 500 µl culture solution were added to 5 ml LB media. For each stain two samples were determined (RV1/2 and N1/2). The samples were incubated at 37°C up to an OD₆₀₀ of 0.53-0.55. After incubation 1 ml of each culture was transfered in sterile eppi and washed for 7 min at 7000 rpm and 4°C. The supernatant was descarded, the pellet was resuspended in 1 ml sterile H₂O and washed for 7 min at 7000 rpm and 4°C and descarded the supernatant. The pellet of N1 was resuspended in 25 µl pRFP (c = 41 ng/µl) and 25 µl sterile H₂O. The pellets of N2 and RV1/2 were resuspended in 2 µl pRFP and 50 µl sterile H₂O. 50 µl of each suspension were transfered in electroporation cuvette and electroporated for a few sec (table below). Directly after this, 1 ml fresh LB media (37°C) was added, the suspension was transfered in a sterile eppi and incubated at 37°C at 600 rpm. The cultures were recovered, deleted on CM+Amp plates and incubated at 37°C ove night.

Überschrift [kV] [ms]

N1 1,8 2,3

N2 1,2 5,4

RV1 1,2 5,3

RV2 1,5 5,3

Transformation of stains RV, Nissle, WM

The stains RV308[ferritin], Nissle[ferritin], RV308, Nissle and WM110 were transformed with RFP. RV308[ferritin] and Nissle[ferritin] were deleted on CM+Amp plates and 5 ml culture was added with CM/Amp and incubated at 37°C. The transformed strains RV308, Nissle and WM110 were deleted on Amp plates and 5 ml culture was added with Amp and incubated at 37°C.

Results of transformation

stain colonies on plate cells in culture

Nissle1 + RFP 3 Yes

Nissle2 + RFP 19 Yes

WM110 1 + RFP 0 Yes

WM110 2 + RFP n.d. Yes

RV308 1 + RFP 0 Yes

RV308 2 + RFP 87 Yes

Nissle[ferritin]1 + RFP 10⁸ No

Nissle[ferritin]2 + RFP 0 No

RV308[ferritin] 1 + RFP 330 Yes

RV308[ferritin] 2 + RFP 300 Yes

The cultures of WM110 1 + RFP and WM110 2 + RFP were deleted on Amp plates and incubated at 37°C. Moreover 5 ml precultures from RV308 + RFP + Amp and RV308[ferritin] + RFP + CM+Amp were prepared.

07/03 Thursday - PCR amplification of knockout cassette FUR/FieF
The pcr preparation was performed at the pattern in the table below.

pcr preparation FUR (25µl) FieF (50µl)

Os High Fedility 2x Mastermix 12,5 µl 25 µl

forward primer 10mM 1,25 µl 2 µl

reverse primer 10mM 1,25 µl 2,5 µl

pkD4 plasmid DNA 1 ng/µl 1 µl 1 µl

nuclease-free H₂O to 25 µl to 50 µl

The amplification was performed with the programm in the table below.

step T [°C] t [sec]

initial denaturation 98 30

5 cycles 98/ 63/ 72 8/ 25/ 45

25 cycles 98/ 72 8/ 70

final elongation 72 120

--> hold at 8°C

The amplification results were analysed in agarose gelelectrophorese (1% agarose; 0,5µl Gel Red; 10x diluted ladder; 6x loading dye).

07/04 Friday - Expression von RV308 (RFP) und RV308 (RFP + Ferritin)
50 ml LB + 50 µl Amp inoculated with 5 ml overnight culture of RV308 (RFP)
50 ml LB + 50 µl Amp/Cm inoculated with 5 ml overnight culture of RV308 (RFP + Ferritin)
After a OD of 0.6-0.7 was reached 50 ml cultures were portioned into 4 sterile 100 ml flasks so that there was a final volume of 10 ml in each flask.
The cultures were then cultred the following:

RV308 (RFP) RV308 (RFP + Ferritin)

Induced 1 mM IPTG + - + - + - + -

Fe/Mn each 1 mM* + + - - + + - -

*Fe/Mn were solubilized by autoclaving and 1M stock solution

Altough not planned IPTG and metal ion solutions were added simultaneously due to time constraints. It was planned to add metal ions 2h after induction

07/07 Monday - Preculture prepared of:
1. ATPCS Klon 1 - 10 (Amp) --> check if anything grew and contact Johann
2. WM110 (RFP), RV308 (RFP), Nissle (RFP), RV308 (Ferritin + RFP) --> make Cryostock for each
Overgrown WM110 (RFP) plate streaked out again, please take out and put in cool room
Rune:
PCR of PPMT and ATPCS

07/09 Wednesday - PCR for PPMT with goTaq (Promega)
25 mikrol reaction:
12,5 mikrol goTaqMastermix
1,25 mikrol fw Primer 10mikrom
1,25 mikrol b Primer 10mikrom
1,0 mikrol DNA Template PPMT
9,0 mikrol nucleasefreies Wasser
'''Mit folgenden PCR-Programm Parametern:''' Denaturation 98°C 10 min
Denaturation loop 98°C 1 min
Annealing Temp loop 56°C 1 min
Elongation Time loop 72°C 1 min
Final Elongation 72°C 5 min
Storage 8°C infinite
Miniprep Miniprep of ATPCS clone number 3 = 94ng/µl and sent for Sequencing

07/17 Thursday - Midiprep
#pQE_80L = 183 ng/µl
#pMA-T_PPMT =321ng/µl
#pKD46 = 218ng/µl
Digestion
Digestion pQE_80L with HindIII and SacI
deactivated at 80°C for 10 mins

07/24 Thursday - miniPrep + restriktion PPMT und iGEM plasmids
Plasmide: 1. pBADex-mYFP Venus (Amp)
2. pEx-HISII (Amp)
3. pJS418_phagemid(dummy) (Cm)
Restriction-enzymes: XbaI | PstI (used SpeI instead :X)
kit-miniprep
1. 220ng/µl 2. 130ng/µl 3. 430ng/µl
restriction:
500 ng DNA + 1µl XbaI + 1µl PstI + 5µl 10x Buffer + ->50µl Wasser (x3) [ppmt x4]
1. 2,3µl 2. 3,8µl 3. 1,2 µl PPMT 1,6µl
2nd try w/ right enzyme:
1,5 µg DNA + 0.5 µl enzymes + 3µl BUffer + -> 30 µl Wasser
1. 6,5µl 2. 11 µl 3. 3,5 µl PPMT 4,5 µl (x3)
Fragments: 1. 4043/700 2. 4450/55 3. 3800/861 PPMT 2400/251
Gel1 L|3| 1 |1|2|2|2|P|3|3 Gel2 L|P|P|P
Neu: Gel 1|2|3|L|P|P|P
GelEx QiagenKit -> extrakte in grüner box im freezer
Ligation 2 + P
10µl Ansatz: 1µl BUffer + 0.5 µl Ligase + 1.4 µl PPMT + 7.14 µl pEX-HisII [78ng]

07/25 Friday
1. Ordered Primer for cloning hu_Ferritin into pQE80L
2.) Ligation of PPMT Fragment from pMAC_PPMT into pEX_HisII
pMAC_PPMT and pEX_HisII were digested with HF PstI and HF XbaI (NEB)
PPMT (Insert) and cut pEX_HisII (Vector DNA) were purified via an Gel extraction
Ligation was performed using NEB T4 DNA Ligase in molar ratios of (Insert:Vector) and 40 ng Vector were used.
0:1 2:1 3:1 5:1

Ratio 02:01 03:01 05:01

Amount Insert 4,04 ng 6,06 ng 10,1 ng

Ligase was deactivated and ligation transformed after weekend

07/28 Monday
1. Degradation test of prepped TB-Expression Plasmids by running samples on agarose gel
pBADex_MYFP_Venus (no observable degradation)
pEX_HisII (no observable degradation)
pJS418_Phagemid (Dummy) (no observable degradation)
Data:
Fabian : 28072014_1
2.Transformation of 0.2 µl pEX_His_PPMT ligation into DH5alpha, DH10b, and MG1655 via electroporation

07/29 Tuesday
1.) Transformation worked and we got colonies for pEX_HisII_PPMT
Colony PCR was performed (Sascha)
See Standard Protocol
2.) Ligation of ATPCS PCR Fragment into pQE_80L
ATPCS PCR fragment and PQE80L Vector were digested with FD HindIII and FD SacI (ThermoScientific)
ATPCS was purified via PCR purification and Vector DNA was purified via an Gel extraction
Vector DNA was dephosphorylised using Fast-AP and deactivated
Ligation was performed using NEB T4 DNA Ligase in molar ratios of (Insert:Vector) and 40 ng Vector were used.
0:1 2:1 3:1 5:1

Ratio 02:01 03:01 05:01

Amount Insert 24,96 ng 37,41 ng 62,36 ng

Ligase was deactivated and ligation transformed next day

<img src="" alt="" />

#pMAC_PPMT* #pQE_80L* #pSB1c3 #pKD46*

(*)Bands at 20 kbp for Promega prepped Plasmids.

07/30 Wednesday
Results Colony PCR for pEX-HisII-PPMT clones preculture 4 and 5 in incubator for Miniprep and Sequencing

Transformation Chemical competent cells XL Blue * 3 µl for each Ligation Assay * 10 min incubation on ice *60 s Heat schock * 2 min incubation on ice *950µl LB added *1h --> 37 °C for Recovery *platted on Amp-plates Eporation *0.2 µl Ligationassay in competent DH5α [iGEM] *1.7 kV * 1h; 37°C * platted on Amp plates

07/31 Thursday
Miniprep for sequencing of pEx_His_ppmt in DH10B? 90-100 ng/µl
Cryostock & miniprep of pjs418 in DH5a 518ng/µl
PCR of 7 clones with pQe80l_ATPCS
16 µl wasser
2 green dreamtaq buffer
0.5 dNTP
0.5 primer (each)
colony
0.6 dream taq
95° 3min
95° 30s x30
55° 30s x30
72° 2min x30
72° 10min
Colonie PCR did not work--> no positive clones concentration after MiniPrep
* pJS418 = 518 ng/µl * Klone 4 = 90 ng/µl * Klone 5= 105 ng/µl

08/06 Wednesday
PCR

' BamHI_PPMT_GS GS_ATPCS_HindIII BamHI_HuFerritin_HindIII

Q5 2x Mastermix 12,5 12,5 25

10 µM Primer fw 1,25 1,25 1,25

10 µM Primer rev 1,25 1,25 1,25

template (1ng) 0,30 0,5 1

nucfree H2O 9,7 9,5 19

Program:

BamHI_PPMT_GS ' ' GS_ATPCS_HindIII ' ' BamHI_HuFerritin_HindIII '

98 30 98 30 98 30

98 10 98 10 98 10

58 30 56,3 30 58,6 30

72 12 72 60 72 45

72 2' 72 2' 72 2'

8 end 8 end 8 end

Analytical Gel Expacted Bands clearly seen for PPMT and Ferritin. Only little ATPCS band shows Primer Dimer inhibit PCR. Anyhow we will try a Gel extraction and after a Assembly PCR Generation of Heme-free BFR by Site-directed Mutagenesis, part 1 of 5
Site-directed mutagenesis was performed by the QuickChange method
Primer design with http://www.bioinformatics.org/primerx/ methionine (on position 52) was substituted by histidine BFR M52H

08/07 Thursday
Analysing 2 colonies of pQE80L_ATPCS whether ATPCS was inserted by sequencing revealed no proper results.
Tested by colony PCR (see protocols) using 55°C Annealing temp and 2' Elongation time (expected bands should be 2000bps).
Gel showed PCR was about 500 bp big -> ATPCS NOT INSERTED.
Outcome:BamHI_PPMT_GS super
GS_ATPCS_HindIII bad
BamHI_Ferritin super

08/08 Friday - Gradienten PCR GS_ATPCS_HindIII

PCR

' 3x GS_ATPCS_HindIII

Q5 2x Mastermix 12,5

10 µM Primer fw 1,25

10 µM Primer rev 1,25

template (1ng) 0,5

nucfree H2O 9,5

Program:

GS_ATPCS_HindIII ' '

98°C 30

98°C 10

56,3-62°C 30 34

72°C 60

72°C 2'

8°C end

- preparative agarose gel 1% and gel ex of GS_ATPCS_HindIII bands at ca. 1490 bp

- accidentally also loaded BamHI_PPMT_GS onto Gel and was also extracted (elution with 25 µl elution buffer).

- BamHI_Ferritin_HindIII was PCR purified

- DNA concentration meassurement for purificated pcr fragments:

GS_ATPCS_HindIII = 33 ng/µl

BamHI_PPMT_GS = 48 ng/µl

BamHI_Ferritin_HindII = 125 ng/µl

Assembly PCR

An Assembly PCR was used to align BamHI_PPMT_GS with GS_ATPCS_HindIII and amplify the complementary structure in order to form a fusion protein coding sequence.

Therefore, both fragments were added a templated equal molar amounts.

Calcultation:

bpATPCS = 1493

bpPPMT = 255

mATPCS/bpATPCS = mPPMT/bpPPMT

mATPCS = (1ng * 1493) / 255

mATPCS= 58 ng

' BamHI_PPMT_GS_ATPCS_HindIII

Q5 2x Mastermix 25

100 µM Primer fw 0.25 (not added till later to second PCR run)

100 µM Primer rev 0.25 (not added till later to second PCR run)

template (1ng) 1,750 µl ATPCS + 0.208 µl PPMT

nucfree H2O 18.042

Program:

1. PCR BamHI_PPMT_GS_ATPCS_HindIII ' '

98 30

98 10

68 30 5

72 55

72 1'

8 end

2. PCR BamHI_PPMT_GS_ATPCS_HindIII ' '

98 30

98 10

68 30 30

72 55

72 2'

8 end

Transformation into DH10B #BFR M52H # BFR M52H *Recover in LB--> 1h at 37°C

08/11 Monday - Plan-prepare fragments for digest
Constructs aimed for *In pQE_80L (Amp) BamHI_PPMT_GS_ATPCS_Hind III (PCR Construct available) Construct Size 1724 of 4731
*In pQE_80L (Amp) BamHI_FTH_FTL_Hind III (PCR Construct available) Construct Size 1077 of 4731

*In pQE_80L (Amp) Sacl_ATPCS_Hind III (PCR Construct not available) Construct Size 1400 of 4731

*In pJS418 (CM) XbaI_PPMT_PstI (PCR Construct available) Construct Size 255 of 3800

Q5 MasterMix 25μl

ATPCS SacI 2.5

ATPCS Hind III 2.5

cDNA At. 0.5

H₂O 19.5

PCR Programm

98°C 30 sec

98°C 10 sec

62°C 34cycles 30 sec

72°C 60 sec

72°C 2 mins

4°C Store

PCR Fragmente PPMT_GS_ATPCS+ATPCS+Purification (Gelex)

After Gelex:
PPMT 48ng/μl
Ferritin 125ng/μl (Pur from PCR)
ATPCS 33ng/μl

08/12 Tuesday - Preparing chemically competent cells
V=100ml, 37°C
BU36=DH10B OD at 600nm=0.461A
DH10B competent cells

Digestion

Inserts PCR Pur JBH1 PPMT_GS_ATPCS 1 JBH2 PPMT_GS_ATPCS 2 JBH3 Ferritin JSH ATPCS

PCR Fragment 20 20 8 20

Buffer 3 3 3 3

FD BamHI /FD SacI 1 1 1 1

FD Hind III 1 1 1 1

nuclease free H₂O 5 5 17 5

Vector VBH pQE_80L VSH pQE_80L SacI 2x PJS_418 2x P_Mac_PPMT

Vector 5.5 5.5 1.9 3.2

Enzyme 1 1 BamHI 1 SacI 1 FDxBa 1 FDxBa

Enzyme 2 1 HindIII 1 HindIII 1 FD PST 1 FD PST1

Buffer 3 3 2 2

Fast AP 1 1 0 0

nuclease free H₂O 18.5 18.5

* 35 ng/L PPMT ATPCS 1 * 15ng/L PPMT ATPCS 2 * 25ng/L ATPCS * 13ng/L P_Mac_PPMT * 31ng/L PJS_418

Ligation 5:1 JBH1 in VBH JBH2 in VBH JBH3 in VBH JSH in VSH PPMT in PJS_418

10x T4 DNA ligase Buffer 1μl 1μl 1μl 1μl 1μl

Vector 1.42 1.42 1.42 1.33 1.29

Insert 3.29 7.08 1.36 7.17 1.03

Nuclease free H₂O 3.79 0 5.72 0 6.18

T4 DNA ligase (NEB) 0.5 0.5 0.5 0.5 0.5

Ampicillin
JBH1 in VBH
JBH2 in VBH
JSH in VSH

Chloramphenicol
PPMT in PJS_418

Transformation in DH10b (cc.c)
10⁶ Kolonie for every approach

08/13 Wednesday - pQE 80L Colony PCR

Mastermix 1x 35x 10x

nuclease free H₂O 14 490 140

10 dreamtaq 1 70 20

25µM MgCl₂ 1.2 42 12

10mM dNTPs 0.5 17.5 5

10mM Forward Primar 0.5 17.5 5

10mM Reverse Primar 0.5 17.5 5

Taq 0.3 10.5 3

PCR Programm

95°C 3 mins

95°C 30 secs

55°C 30 secs

72°C 60 secs

72°C 10 min

8°C Store

Samples :
# PPMT GS ATPCS size 1912 # PPMT GS ATPCS size 1912 # ATPCS in pQE80L size 1770 # Ferritin in pQE80L size 1376 # PPMT in PJS size 420

pQE80L=300bp
pJS = 170bp

Sequence clones A - H + J

Generation of Heme-free BFR by Site-directed Mutagenesis, part 2 of 5

QuickChange Site-Directed Mutagenesis

20µL approach:

Überschrift component

2 µL 10x Pfu Buffer (MgSO4)

0,6 µL 10µM forward Primer

0,6 µL 10µM reverse Primer

x µL 30ng Template

0,4 µL dNTPs

0,6 µL Pfu Polymerase

to 20 µL PCR Wasser

Template BFR:

0,5 µL A4 (66ng/µL)

0,2 µL D2 (144ng/µL)

labeling Template Annealing Temp.

17 D2 (144ng/µL) 71°C

15 D2 (144ng/µL) 55°C

67 A4 (66ng/µL) 71°C

65 A4 (66ng/µL) 55°C

PCR Program

Temp time

95°C 30sec

________ ______

16 Cyclen

95°C 30sec

55/71°C 1min

68°C 5min

________ ______

68°C 10sec

4°C finale

Σ20µL -8µL fürs Gel= 12µL +1µL DpnI

37°C 90min

chemical Transformation (Fabian)

in DH10b

plating out on Amp plates

08/15 Friday - Clone Sequencing

Clone Name Construct present concentration after isolation

A pQE_80L_PPMT GS ATPCS yes 388ng/µL

B pQE_80L_PPMTGSATPCS yes 373ng/µL

C pQE_80L_PPMTGSATPCS yes 442ng/µL

D pQE_80L_PPMTGSATPCS no 389 ng/µL

E pQE_80L_huFerritin yes 490ng/µL

F pQE_80L_huFerritin no 402ng/µL

G pQE_80L_ATPCS yes 497ng/µL

H pQE_80L_ATPCS yes 443 ng/µL

I pJS418_PPMT yes 596 ng/µL

08/19 Tuesday
Generation of Heme-free BFR by Site-directed Mutagenesis, part 3 of 5 ÜN culture
5ml LB + 5µL Amp →shakingincubator

08/20 Wednesday
Generation of Heme-free BFR by Site-directed Mutagenesis, part 4 of 5 MiniPrep nach Protocol
Photometer
4µL Probe + 76µL dilution (Wasser)

08/21 Thursday
Generation of Heme-free BFR by Site-directed Mutagenesis, part 5 of 5 Sequencing:
Primer PB 16
Crystocks:
ÜN culture
500µL culture + 500µL DMSO
2xclon 17
2xclon 67

08/22 Friday - SDS-PAGE with Coomasie staining
Samples

# Marker # Pellet ATPCS/PPMT #15:00 after induction ATPCS/PPMT #overnight ATPCS/PPMT #GS Pellet #PGSA after induction 15:00 #GS P/A overnight #human Ferritin Pellet #human Ferritin after induction 15:00 #human Ferritin overnight

Analysis of Expression
Human Ferritin = 42 kDa (Potparam Expasy)
ATPCS = 56.3 kDA (Potparam Expasy)
PPMT = 7.9 kDA (Potparam Expasy)
ATPCSGSPPMT = 64.3 kDa (Potparam Expasy)

08/29 Friday - Calibration curve for Iron concentration measurement

Überschrift Überschrift

0.017A 10 µg/ml

0.105A 50 µg/ml

1.076A 100 µg/ml

2.095A 150 µg/ml

2.747A 200 µg/ml

09/03 Wednesday
Magnetization of E. coli by expression of human Ferritin, 2nd Experiment part 1 of 8 Aim: Test the possibility of Magnetization of E.coli cells by the expression of human Ferritin:

Procedure: ...

-Precultures of Nissle and RV308 (wild types)

09/04 Thursday
Magnetization of E. coli by expression of human Ferritin, 2nd Experiment part 2 of 8 -Prepare chemical competent cells ( Nissle and RV308) . see Protocol

09/05 Friday
Magnetization of E. coli by expression of human Ferritin, 2nd Experiment part 3 of 8 -Chemical biotransforamtion (double Trafo, 200ng of each) of, red fluorescence protein carried on plasmid (kan) Human-Ferritin carried on PQE-80L (Amp) [was prepared by iGEM-Berlin using the '''Biobrick''' from Calgary, unlike does not contains polypeptide at the beginning].

09/06 Saturday
Magnetization of E. coli by expression of human Ferritin, 2nd Experiment part 4 of 8 -Positive colones for both RV308 and Nissle

09/11 Thursday
Magnetization of E. coli by expression of human Ferritin, 2nd Experiment part 5 of 8 - Precultures of the transformed colones

09/12 Friday
Magnetization of E. coli by expression of human Ferritin, 2nd Experiment part 6 of 8 - Transfer the precultures into 250ml filled until 100ml with LB and incubate them at 37°C Strain OD
RV308 0.71
Nissle 0.6
- Induction with 100µl IPTG (1M), incubation over night at '''30°C''' and 200rpm

09/13 Saturday
Magnetization of E. coli by expression of human Ferritin, 2nd Experiment part 7 of 8 -samples were taken for protein analysis SDS-Page Strain OD
RV308 6.2
Nissle 5.2
- adding 7ml of 1M Mn-citrate (wrongly) and incubated at 4°C over weekend

09/15 Monday
Magnetization of E. coli by expression of human Ferritin, 2nd Experiment part 8 of 8

-Test the Magnetization using a permanent magnet under Fluorescent microscope.

Evaluation

-Cells grew -no red fluorescence observed -no Magnetization observed

Possible Explanation: - Adding Mn ions instead of Fe could be effected the Magnetization - The red Fluorescence gen contains a cadaverin chain, this could explain the non-fluorescence.

09/16 Tuesday
Preparing Cultures for flouruscence microscopy
E. coli Nissle 1917 (pQE_80L Hu_Ferritin + RFP)
E. coli RV308 (pQE_80L_HuFerritin + RFP)
Nissle OD600 = 5.08
RV 308 OD600 = 5.81
take OD=1
wash in 1000 µl PBS three times ( centrifuge at 6000g for 2min, discard supertanent and resuspend pellet in PBS) finally resuspend pellet in 500 µl Put it into a cool box and take it over to the fluorescence microscope facility. Constructing PQE_80L_T5_ATPCS_lac_PPMT
Plasmid for Co-Expression of PPMT and ATPCS on one plasmid. Source: pJS418_PPMT (amplifying insert) pQE_80L_ATPCS (as target vector) PCR of HindIII_lac_PPMT_HindIII Construction of the HindIII_lac_PPMT_HindIII in pQE80L_Hind III

3x HindIII_lac_PPMT_HindIII

Q5 2x Mastermix 12,5

10 µM Primer fw 1,25

10 µM Primer rev 1,25

template (1ng) 0,5

nucfree H2O 9,5

Program

Temperature Durattion in seconds Cycles

98 30 1

98 5 loop start

62-65 15 loop 32

72 10 loop end

72 2' 1

8 infinite 1

09/17 Wednesday - Digest and Dephosphorylation of vector pQE_80L_ATPCS

pQE80L_ATPCS digest 1x 3x

pQE_80L_ATPCS 2 µl 7 µl

FD HindIII 1 µl 3 µl

10x FD Buffer 2µl 7 µl

FastAP (Thermo) 1 µl 3 µl

nucfree H2O 14 µl 51 µl

Gelextraction resulted in HindIII cut pQE80L_ATPCS 20 µl with 12 ng/µl
In parallel the PCR fragment HindIII_lac_PPMT_HindIII was purified and is ready for digest.

09/18 Thursday
Magnetization of E. coli by expression of human Ferritin, Bio-transformations, 3rd Experiment part 1 of 7

'Aim

-Double Trafo of the Human-Ferritin and fluorescence marker.

Procedure:…

Stains: RV308, Nissle and DH0B (control)
-chemical Double-biotransformation of:
-0.5 µl of Human-ferrtin on PQE-80L(490 ng/µl) with (Amp)
-3 µl green fluorescence protein Nerm ASGP-R-GFP (83 ng/µl) with (Kan)

for control:
- 3 µl green fluorescence protein Nerm ASGP-R-GFP (83 ng/µl) with (Kan) is transformed into DH05
- Double Trafo of (pJS418_PPMT and pQE_80L_ATPCS)

09/19 Friday
PCR of BB0 - BB3 parts (Saba)

compound V/µl (50µl total)

Q5 2xMM 25.0

10µM P_fv 2.5

10µM P_rev 2.5

DNA (template 1ng) 2.0 (of diluted plasmid)

nuc.-free H2O 28.0

Primers

Reaction fw Primer rev. Primer TmTm/°C Template bp

BB0 BBa_K1438000_fw BBa_K1438000_rev 62 pQE80L_BFR 507

BB1 BBa_K1438000_fw BBa_K1438000_rev 62 pQE80L_BFR M52H 507

BB2 BBa_K1438002_fw BBa_K1438002_rev 68 pQE80L_Hu-Fer 1000

PCR Programms BB0 & BB1

T/°C t/min cycles

98 0:30 30

98 0:10 30

62 0:30 30

72 0:15 30

72 2:00 30

8 infinity 30

BB2

T/°C t/min cycles

98 0:30 30

98 0:10 30

68 0:30 30

72 0:40 30 (probably too long since ~1000bp and not 1408bp however worked well as seen on gel)

72 2:00 30

8 infinity 30

Biobricks derived from pQE80L constructs
BB1 BFR 191µg/ml
BB2 BFRM 173µg/ml
BB2 HuFerritin 166 µg/ml Magnetization of E. coli by expression of human Ferritin, Bio-transformations, 3rd Experiment part 2of 7 -No positive colones were detected for double-trafo expect these for control (transformation was successful in DH05).

09/20 Saturday - Digest of PSB1C3-Ferritin
Plasmid: PSB1C3 - ferritin with Peptid 120ng/µl

component µL

NEB Xba1 2 µL

NEB Pst1 2 µL

NEB Buffer 3.1 20 µL

nucleasefree H₂O 151 µL

PSB1C3 Feriitin 25 µL

total volume 200µL

37°C for 1,5h (inactivate for 20min at 80°C)

Gel electrophoresis 1% Agarose-Gel
+ 3 µL EthBr

200µL Probe + 40 µL loading dye (6x)

5 µL GenRuler-Mix

no Gel-extraction, because nothing was seen on the gel, except the marker (GenRuler)

(add Figure)
Figure not in Dropbox

Magnetization of E. coli by expression of human Ferritin, Bio-transformations, 3rd Experiment part 3 of 7 -Transformation of RF (red fluorescence protein) on with (Kan) into DH05

09/21 Sunday
Magnetization of E. coli by expression of human Ferritin, Bio-transformations, 3rd Experiment part 4 of 7 -Transformation was successful

09/22 Monday - Precultures
Precultures of PSB1K3_RFP in DH10b (Kan)
pQE80L_ATPCS & pJS418_PPMT in Dh10b (Amp & Cm)
Clones with pQE80L_ATPCS'n'PPMT in DH10b (Amp)
PSB1C3_Ferritin in DH10b (Cm) Checking Insertion of gene by colony PCR
Performing PCR for clones of ATPCS-PPMT construct

1x in µl 12x in µl 10x in µl

nuclease free H₂O 14 168 140

10x DreamTaq buffer 2 24 20

25mM MgCl₂ 1.2 14.4 12

10mM dNTPs 0.5 6 5

10mM FW Primar
HindIII-lac-prom-fw 0.5 6 5

10mM RW Primar
PB17 (T7 term_rev) 0.5 6 5

Taq Polymerase 0.3 3.6 3

Programm colony PCR Temp Time

Denaturing 95°C 7 min

Denaturing 95°C 30

Annealing 69°C 30

Elongation 72°C 1 min

Final Elongation 72°C 10 min

Store 8°C

Dissolved colonies 4 and 6 which showed band at 400 bp were grown each in a cultivation tube with LB+Amp100 at 37°C

09/23 Tuesday - Mutagenesis of ATPCS
The elimination of the XbaI restriction site of all our ATPCS containing constructs was achieved by quick change mutagenesis.

... Details Saba....

After digest with DpnI the reaction was transformed into competent DH10b E. coli cells via heat shock transformation.
After streaking out all aliquots on LB-Amp Agar plates, they were incubated at 37 °C over night.

Digest of miniprepped PSB1C3_Ferritin (Calgary) for extraction of vector for BioBrick preparation

Components Volume in µl

NEB XbaI 2

NEB PstI 1,5

NEB Buffer 3.1 5

nucfree H2O 26,5

plasmid PSB1C3_ferritin (Calgary) 15

50 µl reaction

The reaction was incubated at 37 °C for 1,5 h.

The digested vector was purified using a 1% agarose gel and the Roth GelNebulizer purifiction kit. The vector band was expected at 2000 bp and the insert band at about 1000 bp.

both colonies from Saba were grown --> Mini-prep (Johann) to harvest plasmid DNA

Mutagenesis of ATPCS in pQE80L_ATPCS-GS-PPMT
pQE80L_ATPCS_PPMT
pQE80L_ATPCS
3x PCR-Reactions
Q5 MM 12.0µl
PB_for SN_ATPCS_xbaI_Mut_for 1.25µl
PB_rev SN_ATPCS_xbaI_Mut_rev 1.25µl
nuc.-free H2O 10.5µl
template (1ng) ~ 1.0µl (dilations of original plasmids)
Total 26µl

PCR Programm

T/°C t/min

98 0:30

98 0:10

69 0:30

72 :

72 2:00

Trafo of 5µl PCR-Product in DH10b cells --> incubation at 37 °C

Magnetization of E. coli by expression of human Ferritin, Bio-transformations, 3rd Experiment part 5 of 7

- Preculture of DH05 with RF plasimd

09/24 Wednesday
Berlin Vector - pQE-80L-JBFS-huFerritin Assembly PCR Running Gel Electrophoresis

* 1% Agarose, Ethidium bromide

* 50µL Assembly PCR product + 10µL 6*DNA dye * 10µL GeneRuler DNA Ladder Mix (ThermoScientific) * Gel Electrophoresis conditions 100V, 30min

Gel Extraction Gel Extraction using GeneJET Gel Extraction Kit (ThermoScientific) * Determination of Concentration by Ultraviolet Spectrophotometry

?

Double Digest

* Digestion of 1μg of purified Insert DNA using FastDigest BamHI / HindIII * 1h at 37°C ?

* Heat inactivation of FastDigest BamHI / HindIII, 15min at 80°C

PCR purification

* PCR purification of BamHI / HindIII digested insert using GeneJET PCR Purification Kit (ThermoScientific) * Determination of Concentration by Ultraviolet Spectrophotometry

?

Ligation

* Using the Molar Ligation Ratio 1:5 (1 times vector and 5 times insert)

* 20min at RT

Chemical Transformation

* 100µL Aliquots of Chemically Competent Cells - DH10B E.coli + 10µL Ligation approach chilled on ice for 30 min * Heat shock for 1min at 42°C * Add 900µL preheated (37°C) LB * Incubate the cells for 1h at 37°C with shaking approx. 200rpm * Plate 200µL and spin down the rest and plate on LB Ampicillin, incubate overnight at 37°C

Saba o/n culture of clones from successful pQE80L_ATPCS-mut_GS_PPMT and pQE80L_ATPCS-mut_PPMT transformation --> 37°C, 200pm, o/n 5-6 nl LB+AB (Amp)

Magnetization of E. coli by expression of human Ferritin, Bio-transformations, 3rd Experiment part 6 of 7

- Miniprep of the Preculture, DNA concentration 71 ng/µl

Chemical Biotransformation of: -3 µl of RFP 71 ng/µl -2 µl Ferritin jbfs_m (different ferrtin)(120 ng/µl) with (Amp)'

in RV308 and Nissle (2 plates each)

09/25 Thursday - PCR of Biobrick Parts
Isolation of plasmid-DNA with Mini-Prep Kit of pQE80L_ATPCSMut_GS_PPMT and pQE80L_ATPCS_PPMT PCR of Biobrick-Parts 03,04,06 & 10-15

BB PB_fw PB_rew Tm/°C template bp part

03 BBa-K1438003_fw BBa-K1438003_rew 67 pQE80L_PPMT_GS_ATPCS 1715 PPMT GS ATPCS

04 BBa-K1438004_fw BBa-K1438003_rew 65 pQE80L_PPMT_ATPCS 1408 ATPCS

10 XbaI_T7_prom for Lambda_Term_suffix_rew 66 -->67 pQE80L_BFR 690 (+377bp-->cp) BFR_cp

11 " " 66 -->67 pQE80L_BFRM52H 690 (+377bp) BFRM52H_cp

12 " " 66 -->65 pQE80L_FTH_FLH(HuFer) 1337(+377bp) FTH_FLH_cp

13 " " 66 -->67 pQE80L_PPMT_GS_ATPCS 1968(+377bp) PPMT_GSATPCS_cp

14 " " 66 -->67 pQE80L_PPMT_ATPCS 2091(+377bp) ATPCS_cp

06 " " 66 pQE80L_fbfs_mil_Ferritin 1403(+377bp) fbfs_mil_Ferritin_cp

PCR-Ansätze V/µl Q5 2xMM 25.0 10µM PB_fw 2.5 10µM PB_rew 2.5 template 2.0 (~1ng) nuc.-free H2O 18.0 PCR-Programm

T/°C t/min cycles

98 30" 30

98 10" "

66/67 30" "

72 40"/12"/1' "

72 2' "

8 infinity "

PCR purification of 1,2, 3 (Jbfs_mil_Ferritin_cp),BF-cp and BFM-cp biobrick parts

Concentration µg/ml

fbfs_mit_Ferritin1 42

fbfs_mit_Ferritin2 35

fbfs_mit_Ferritin3 42

ATPCS and PPMT -12 too low

Bacterioferritin CP 56

BFM52H CP 57

Magnetization of E. coli by expression of human Ferritin, Bio-transformations, 3rd Experiment part 7 of 7
- Double-trafo was successful in all RV308 plates but not in Nissle

09/30 Tuesday
Ligation of Biobrick parts with PSBIC3 backbone (digested on 23.09.2014 by Johann Transformation into DH10b c.c.cells by chemical transformation
5µl of each ligation was transformed to 100µl aligusted cells each
--> after recovery at 37°C, 30min cells were plated on Cm/LB-Agar plates after centrifuging-->pelleting and resuspending in 100µl LB to plate all cells. --> incubation at 37°C, o/n Mini Prep von pSB 1U 3-RFP concentration 112 ng/µl
Preculture
pQE-80L-jbfs-Ferritin 5ml LB+5µl Amp at 37°C overnight

10/01 Wednesday - Plasmid Digestion & PCR Probe
Plasmid Digestion

Plasmid Digestion

NEB Buffer 3.1 5µl

NEB XbaI 0.5µl

NEB PstI 0.5µl

P_MA_T_PPMT 312ng/µl 3.2µl

null. free water 40.5µl

PCR Probe Ligation plates evaluated:
All plates had clones except for BFR_cp from each plate transformation one clone was cultivated with LB/Cm (~5ml) o/n at 37°C

10/02 Thursday - Cultures were Mini-preped
--> elution with 40µl EB --> DNA contration measurement

10/06 Monday- Colony PCR

Biobrick Sequenzierung Sequenz (?) (???)

BB0 BFR 100Y BFR M52H -A ws ATGf (??)

BB1 BFR M52H 100% BFR -A wr

BB2 HFTN_LFFN (?) 96Y HuFerritin (Rw Sep nötig) ??

AnP ATPCS f 70% ok, aber Fragment f PCR nochmal ... Gelex (?)

BFM1cp BFR1cp ?

BFM2cp BFR2cp ?

HuFecp HuFerritin cp ?

Colony-PCR of other clones

PCR-Programm

T/°C t/min cycles

95 7' 30

95 30" 30

52 30" 30

72 1' 30

72 10" 30

8 infinity 30

--> gel (1% Agarose)

Clones 3, 5, 6, 7 and 13 were grown o/n in LB/Cm for Mini-prep on the following day. therefore 5µl of the disolved clones were used for each inoculation

--> 37°C, 200rpm

2x M9 Media Production (Christina)

2X M9 mineral medium

For 500 ml M9 minearal medium add to XXX ml sterile water:

100ml M9 salt solution (10X) Na₂HPO₄

KH₂PO₄
NaCl
NH₄Cl || 67.4mM
44.0mM
17.10mM
18.70mM

10/07 Tuesday
Mini-Prep of cultures (Ben) and preparation of sequencing samples (Saba): 9µl nuc.-free H2O + 3µl DNA + 3µl PB794

Preculture of Knockouts * λΔ FieF +PCP 20 : 5ml LB+tet/amp (1:1000) * λΔ FUR : 5ml LB+tet/kan (1:1000) * MG1655 ΔFieF: 5ml LB + amp/kan (1:1000)
incubation at 30°C

10/08 Wednesday - PCR of PSB1C3 Backbone
Q5 Mastermix 2x

Component Volume in µl

Q5 Mastermix 2x 25

Primer fw (PSB1C3 Suffix fw) 2,5

Primer rev (PS1C3 Prefix rev 2,5

template (PSB1C3_BBa_K1189018) 2

nuc free H2O 18

Temperature in °C Time Nr. of cyles

98 30

98 5 loop start

70 15 30

72 1' loop end

72 2'

8 infinit

Extraction of PCR Product (PSB1C3 linearised)

After extracting the expected band at 2000 bp it was purified using the EMDMillipore Montage Gel Extraction Device.
Resulting in about 120 µl DNA extract in TAE buffer with an concentration of 9ng/µl

Digestion of PCR Product

NEB Buffer 3.1 15µl

NEB PstI 1.5µl

NEB XbaI 1.5µl

nuc. free water 83µl

PCR Product 100µl

* 1.5 hours at 37°C * PCR Purification * DNA concentraion measurement = 35ng/µl

Ligation Calculation *BFM52H = 3.22µl *BF_cp= 6.7µl *jbfs_m = 8.06 µl *BB_AnP = 10.64 µl * HuFer = 9.45 µl Iron Concentration measurement 278 mg FeSO₄.7H₂O dissolved in 10 ml d.H₂O
λ FieF PCP₂ Amp 1:100 ---> 3.0 OD
iGEM BV125 tet 1:100 --> 3.0 OD
λ FieF PCP₁ Amp 1:20 -->3.26 OD iGEM BV125 tet 1:20---> 2.44
too high OD!

Both samples diluted 1:2 Samples # FieF + 5µl 0.1 M Fe-stock solution # FieF + 15 µl 0.1 M Fe-Stock solution # BV + 5 µl 0.1M Fe-stock solution # BV + 15 µl 0.1 M Fe-stock solution

Overnight incubation at 30°C on a shaker

10/09 Thursday
Mini Prep (using: AccuPrep Plasmid Mini Extraction Kit Ver. 2.0, Company: BIONEER), using 100µl Elution Buffer
and dsDNA Measurement: 4 µl Sample + 76µl MilliQ, blanked with MilliQ

Samplenumber Samplename dsDNA conc [ng/µl] Sample [µl] used for Sequencing nucl.free Water [µl] used for Sequencing

#1 cp HuF 111 9 3

#2 AGSP 107 9,4 2,6

#3 AGSP 59 12 0

#4 AGSP 64 12 0

#5 jbfs_Fer 54 12 0

#6 A'n'P 67 12 0

For Sequencing: *total volume: 15µl *Primer used: PB795 3µl each Sequencing approach *Sample [µl] see table *nucl.free Water [µl] see table

evaluation of Trafos ---> no growth --->Repeat Trafo in other cells

10/10 Friday - STRATEGY 1 - Knockout of FieF and FUR Genes
Detection PCR kan-deletion-cassette for FieF and FUR Genes was transformed into 2 different strains (MG1655 and λ MAGE). Additionally pCP20 was already transformed into one of the λ MAGE Clones (has to be re-validated).
The positive clones have to be validated.
Detection-PCR of one clone of Plates 1-3:
Plate 1: MG1655 ΔFieF
Plate 2: λ ΔFieF + pCP20
Plate 3: λ ΔFUR
Primer-Combinations FieF

- Combination WT length Clone length Annealing Temperature range

A C1+C2 2060bp 2654bp 58,4-60,1°C

B C1+C3 0 1046bp 59,5-60,1°C

C C4+C2 0 1181bp 57,5-58,4°C

D C1+C5 1134bp 0 60,1-60,5°C

--> Annealing Temperature: 57°C

FUR

- Combination WT length Clone length Annealing Temperature range

A C1+C2 1130bp 2219bp 59,5°C

B C1+C3 0 823bp 59,5°C

C C4+C2 0 969bp 57,5-59,5°C

D C1+C5 500bp 0 59,5°C

--> Annealing Temperature: 57°C PCR-Assay

- 1x Mastermix 15x

nuc.free H₂O 14,4µl 216µl

10x Dream Taq Buffer 2µl 30µl

50mM MgCl₂ 0,6µl 9µl

10mM dNTPs 0,5µl 7,5µl

10mM Primer Combination 1µl

10µl nuc.free H₂O+ picked colony 1µl + 18,4ml Mastermix

Taq Polymerase 0,5µl

PCR-Program

Temperature Time

95°C 7'

30 cycles

95°C 30"

57°C 30"

72°C 2'40"

72°C 5'

12°C hold

Gel-Electrophoresis
1% Agarose-Gel + 1µl GelRed; 90V; 30min

10/14 Tuesday - Iron-Assay
1. Day: inoculation of 5ml LB Media (+ Antibiotics)
* 37°C or 30°C/ON

2.Day:inoculation of 10ml LB (1:10)
* 30°C or 37°C
* grow until OD₆₀₀ 0,6
* take 1ml
* centrifuge 2min at max. speed
* discard the supernatant
* wash with 1X M9 Media

* 1XM9:
:500µL 2X M9+
:500µL sterile water
* wash 2x and recover 1mL 1XM9 Media
* diluted 1:1000 with 1X M9
* plate 20µL per well 24well plate without Antibiotics
*A:MG1655 wt *B:Nissel 1917 wt *C:RV308 wt *D:DH10b
concentration of Fe-citrat
0 0,5 1 2 5 10mM

Sponsors

Müller-Breslau-Str. 10
10623 Berlin

Phone: +49 1778800244
Mail: mail@igem.berlin

Home |

Project |

Team |
Safety |
Workshop |

Blog

©2014 iGem Berlin, Layout/Umsetzung: Valerian Blos, Marius Wessel

Retrieved from "http://2014.igem.org/Team:Berlin/Project"

Recent changes

What links here

Related changes

Special pages

My preferences

Printable version

Permanent link

Privacy policy

Disclaimers

	1x	5x Mastermix	pQE_80L
H2O nucfree	23,1µl	115,5µl	2µl
10x green FD buffer	2µl	10µl	2µl
DNA	2,89µl	14,5µl	14µl
BamHI	1µl	0µl	1µl
SacI	1µl	0µl	1µl

Volume [µl]	Chemicals
13,7	nucl.free H₂O
2	10x Dream Taq Buffer
1,2	25mM MgCl₂
0,5	10mM dNTPs
0,5	10µM fwd Primer
0,5	10µM rev Primer
1	Sample (Colony)
0,6	Dream Taq DNA Polymerase
20µl Total Volume

PCR-step	Temperature [°C]	Time [sec]
Denaturating	95	180
30 cycles start
Denaturating	95	30
Annealing	55	30
Elongation	72	120
30cycles stop
Final Elongation	72	600
Store	12

stain	colonies on plate	cells in culture
Nissle1 + RFP	3	Yes
Nissle2 + RFP	19	Yes
WM110 1 + RFP	0	Yes
WM110 2 + RFP	n.d.	Yes
RV308 1 + RFP	0	Yes
RV308 2 + RFP	87	Yes
Nissle[ferritin]1 + RFP	10⁸	No
Nissle[ferritin]2 + RFP	0	No
RV308[ferritin] 1 + RFP	330	Yes
RV308[ferritin] 2 + RFP	300	Yes

pcr preparation	FUR (25µl)	FieF (50µl)
Os High Fedility 2x Mastermix	12,5 µl	25 µl
forward primer 10mM	1,25 µl	2 µl
reverse primer 10mM	1,25 µl	2,5 µl
pkD4 plasmid DNA 1 ng/µl	1 µl	1 µl
nuclease-free H₂O	to 25 µl	to 50 µl

step	T [°C]	t [sec]
initial denaturation	98	30
5 cycles	98/ 63/ 72	8/ 25/ 45
25 cycles	98/ 72	8/ 70
final elongation	72	120

	RV308 (RFP)				RV308 (RFP + Ferritin)
Induced 1 mM IPTG	+	-	+	-	+	-	+	-
Fe/Mn each 1 mM*	+	+	-	-	+	+	-	-

Ratio	02:01	03:01	05:01
Amount Insert	4,04 ng	6,06 ng	10,1 ng

'	BamHI_PPMT_GS	GS_ATPCS_HindIII	BamHI_HuFerritin_HindIII
Q5 2x Mastermix	12,5	12,5	25
10 µM Primer fw	1,25	1,25	1,25
10 µM Primer rev	1,25	1,25	1,25
template (1ng)	0,30	0,5	1
nucfree H2O	9,7	9,5	19

'	3x GS_ATPCS_HindIII
Q5 2x Mastermix	12,5
10 µM Primer fw	1,25
10 µM Primer rev	1,25
template (1ng)	0,5
nucfree H2O	9,5

'	BamHI_PPMT_GS_ATPCS_HindIII
Q5 2x Mastermix	25
100 µM Primer fw	0.25 (not added till later to second PCR run)
100 µM Primer rev	0.25 (not added till later to second PCR run)
template (1ng)	1,750 µl ATPCS + 0.208 µl PPMT
nucfree H2O	18.042

1. PCR BamHI_PPMT_GS_ATPCS_HindIII	'	'
98	30

98	10
68	30	5
72	55

72	1'
8	end

2. PCR BamHI_PPMT_GS_ATPCS_HindIII	'	'
98	30

98	10
68	30	30
72	55

72	2'
8	end

Inserts PCR Pur	JBH1 PPMT_GS_ATPCS 1	JBH2 PPMT_GS_ATPCS 2	JBH3 Ferritin	JSH ATPCS
PCR Fragment	20	20	8	20
Buffer	3	3	3	3
FD BamHI /FD SacI	1	1	1	1
FD Hind III	1	1	1	1
nuclease free H₂O	5	5	17	5

Vector	VBH pQE_80L	VSH pQE_80L SacI	2x PJS_418	2x P_Mac_PPMT
Vector	5.5	5.5	1.9	3.2
Enzyme 1	1 BamHI	1 SacI	1 FDxBa	1 FDxBa
Enzyme 2	1 HindIII	1 HindIII	1 FD PST	1 FD PST1
Buffer	3	3	2	2
Fast AP	1	1	0	0
nuclease free H₂O	18.5	18.5

Ligation 5:1	JBH1 in VBH	JBH2 in VBH	JBH3 in VBH	JSH in VSH	PPMT in PJS_418
10x T4 DNA ligase Buffer	1μl	1μl	1μl	1μl	1μl
Vector	1.42	1.42	1.42	1.33	1.29
Insert	3.29	7.08	1.36	7.17	1.03
Nuclease free H₂O	3.79	0	5.72	0	6.18
T4 DNA ligase (NEB)	0.5	0.5	0.5	0.5	0.5

Mastermix	1x	35x	10x
nuclease free H₂O	14	490	140
10 dreamtaq	1	70	20
25µM MgCl₂	1.2	42	12
10mM dNTPs	0.5	17.5	5
10mM Forward Primar	0.5	17.5	5
10mM Reverse Primar	0.5	17.5	5
Taq	0.3	10.5	3

PCR Programm
95°C	3 mins
95°C	30 secs
55°C	30 secs
72°C	60 secs
72°C	10 min
8°C	Store

Überschrift	component
2 µL	10x Pfu Buffer (MgSO4)
0,6 µL	10µM forward Primer
0,6 µL	10µM reverse Primer
x µL	30ng Template
0,4 µL	dNTPs
0,6 µL	Pfu Polymerase
to 20 µL	PCR Wasser

labeling	Template	Annealing Temp.
17	D2 (144ng/µL)	71°C
15	D2 (144ng/µL)	55°C
67	A4 (66ng/µL)	71°C
65	A4 (66ng/µL)	55°C

Temp	time
95°C	30sec
________	______
16 Cyclen
95°C	30sec
55/71°C	1min
68°C	5min
________	______
68°C	10sec
4°C	finale

Clone	Name	Construct present	concentration after isolation
A	pQE_80L_PPMT GS ATPCS	yes	388ng/µL
B	pQE_80L_PPMTGSATPCS	yes	373ng/µL
C	pQE_80L_PPMTGSATPCS	yes	442ng/µL
D	pQE_80L_PPMTGSATPCS	no	389 ng/µL
E	pQE_80L_huFerritin	yes	490ng/µL
F	pQE_80L_huFerritin	no	402ng/µL
G	pQE_80L_ATPCS	yes	497ng/µL
H	pQE_80L_ATPCS	yes	443 ng/µL
I	pJS418_PPMT	yes	596 ng/µL

Überschrift	Überschrift
0.017A	10 µg/ml
0.105A	50 µg/ml
1.076A	100 µg/ml
2.095A	150 µg/ml
2.747A	200 µg/ml

pQE80L_ATPCS digest	1x	3x
pQE_80L_ATPCS	2 µl	7 µl
FD HindIII	1 µl	3 µl
10x FD Buffer	2µl	7 µl
FastAP (Thermo)	1 µl	3 µl
nucfree H2O	14 µl	51 µl

compound	V/µl (50µl total)
Q5 2xMM	25.0
10µM P_fv	2.5
10µM P_rev	2.5
DNA (template 1ng)	2.0 (of diluted plasmid)
nuc.-free H2O	28.0

Reaction	fw Primer	rev. Primer	TmTm/°C	Template	bp
BB0	BBa_K1438000_fw	BBa_K1438000_rev	62	pQE80L_BFR	507
BB1	BBa_K1438000_fw	BBa_K1438000_rev	62	pQE80L_BFR M52H	507
BB2	BBa_K1438002_fw	BBa_K1438002_rev	68	pQE80L_Hu-Fer	1000

T/°C	t/min	cycles
98	0:30	30
98	0:10	30
68	0:30	30
72	0:40	30 (probably too long since ~1000bp and not 1408bp however worked well as seen on gel)
72	2:00	30
8	infinity	30

component	µL
NEB Xba1	2 µL
NEB Pst1	2 µL
NEB Buffer 3.1	20 µL
nucleasefree H₂O	151 µL
PSB1C3 Feriitin	25 µL
total volume	200µL

	1x in µl	12x in µl	10x in µl
nuclease free H₂O	14	168	140
10x DreamTaq buffer	2	24	20
25mM MgCl₂	1.2	14.4	12
10mM dNTPs	0.5	6	5
10mM FW Primar HindIII-lac-prom-fw	0.5	6	5
10mM RW Primar PB17 (T7 term_rev)	0.5	6	5
Taq Polymerase	0.3	3.6	3

Programm colony PCR	Temp	Time
Denaturing	95°C	7 min
Denaturing	95°C	30
Annealing	69°C	30
Elongation	72°C	1 min
Final Elongation	72°C	10 min
Store	8°C