Team:Hannover/Notebook/Heavy Metal

From 2014.igem.org

Revision as of 09:42, 14 October 2014 by Örbse (Talk | contribs)

Notebook / Heavy metal

Here you can find a list of lab work concerning our main project "heavy metals". This includes the stable transformation of Arabidopsis thaliana (A. thaliana), the heterologous expression and the quantitative analysis of our T4MBP.

date

coworkers

lab

activity

short summary

08-Oct-2014 Alina, Lisa Inorganic chemistry ICP-OES analysis sample preparation with high pressure, heat and 2.5 % HNO3 / half-quantitative analysis: using calibration curves with defined heavy metal concentrations but only estimated sample volumina / detection via ICP-OES
07-Oct-2014 Anke Botany selection of transformed A. thaliana potting transformed plants (without chlorosis) into substrat
06-Oct-2014 Alina, Andreas IPG E. coli preparation for MS analysis E. coli Origami 2 cultures were precipitated by centrifuging them for 15 min at 4500 x g and 4 °C/ precipitates were dissolved in isoosmotic buffer/ after five washing steps with the same buffer, the precipitates were dried for 48 h at 70 °C
03-Oct-2014 Fabian, Katharina, Björn IPG preparation of new large scale E. coli cultures (zn, cu, cd) for MS preparation of two repetitions of 500 ml: Origami 2_pASK with and without T4MBP and 0.25 mM cadmium, Origami 2_pASK with and without T4MBP and copper, Origami 2_pASK with and without T4MBP and zinc, Origami 2_pASK with and without T4MBP without heavy metals are used as controls/ all in all 16 flasks with 500 ml cultures/ induction of proteinexpression with anhydrotetracycline/ growing at 20 °C for 4 d to reach a high OD
02-Oct-2014 Fabian, Melanie IPG analysis of lethal concentration of copper and zinc usage of copper-nitrate and zinc-nitrate/ analyses of growth rates of E. coli Origami 2 within media containing different heavy metal concentrations
25-Sept-2014 Fabian Inorganic chemistry ICP-MS analysis sample preparation with high pressure, heat and 2.5 % HNO 3 / quantitative analysis: using calibration curves with defined heavy metal concentrations/ detection via ICP-MS
22-Sept-2014 Björn IPG pellitizing the E. coli cultures for MS pellitizing the 2 l Origami 2 with pASK_T4MBP and 0.25 mM cadmium etc./ five washing steps with isoosmotic buffer/ drying the three pellets for 24 h and notation of dry weight
19-Sept-2014 Fabian IPG preparation of large scale E. coli cultures for MS preparation of 2 l Origami 2 with pASK_T4MBP and 0.25 mM cadmium/ Chassis Origami 2 with and without cadmium (2 l each) are used as controls/ induction of proteinexpression with anhydrotetracycline/ growing at 25 °C for 3 d to reach a high OD
19-Sept-2014 Fabian IPG transformation of pASK (no insert) into Origami 2 analyses: a comparable expression system for pASK_T4MBP is needed/ chemical competent cells were made/ transformation via heat shock, incubation over weekend at 16 °C
19-Sept-2014 Steffen IPG plasmidpreparation/ sequencing plasmidpreparation of ONC (red/white colony pSB1C3) and colony T4MBP/ sequencing with primer 16; T4MBP sequenced with primer 16 and 17
18-Sept-2014 Fabian IPG physiological test of T4MBP activity Origami 2 with pASK_T4MBP at different cadmium concentrations (0 - 1 mM) were analyzed/ at 0.2 mM high grow rates were observed/ in comparison to Origami 2 without T4MBP no significant effect of TMBP was seen/ problem: induction of proteinexpression reduces growth rates: another inducible protein in Origami 2 is needed for comparison
18-Sept-2014 Steffen IPG colony-PCR colony-PCR using E. coli colonies and primer 16 and 17: detection of 1 positive T4MBP-clone/ growth of red and white colonies (pSB1C3): colony-PCR
17-Sept-2014 Fabian, Steffen IPG immunostain immunostaining blotted PVDF-membranes: use of Strep-tag- and His-tag-antibody (positive control): Strep shows specific signal at 37 kD, His shows signal at 37 kD as well/ Anti-Strep obviously works/ protein is found in inclusion bodies and supernatant
16-Sept-2014 Fabian, Steffen IPG SDS-PAGE/ Western Blot testing of new Strep-tag-antibody/ use of pASK_T4MBP in Origami 2 to produce protein/ harvesting via ultrasound sonification/ test of protein pellet and supernatant/ run of discontinuous SDS-PAGE/ blotting proteins on PVDF/ transfer-check via Ponceau-stain/ membrane-blocking over night with Roti-Block
16-Sept-2014 Steffen IPG saving linearized pSB1C3 into E. coli / transformation of E. coli ligation reactions with/without ligase: ligation for 1h at RT/ transformation of XL1-Blue Competent Cells via heat-shock using 10 µl ligation reaction/ selection on chloramphenicol/ transformation of XL1-Blue Competent Cells via heat-shock using 5 µl ligation reaction (11-Sept-2014)/ selection on chloramphenicol
15-Sept-2014 Fabian Botany selection of transformed A. thaliana seeds sterilization of harvested A. thaliana seeds (09-Sept-2014) with ethanol/ plating of seeds on MSO-media with 2 % sucrose and 15 µg/ml phosphinothricin for selection/ stored for 2 days at 4 °C/ put at 20 °C until germination
12-Sept-2014 Steffen IPG colony-PCR/ sequencing results colony-PCR using E. coli colonies (11-Sept-2014) and primer 16 and 17: 0 positive clone Expansin/T4MBP, results of expansin and CBD are positive
11-Sept-2014 Steffen, Anke IPG growth curves of Origami 2 pASK/ cloning T4MBP/ CBD into pSB1C3 (shipping vector)/ plasmidpreparation/ sequencing growth of Origami 2 pASK in media containing five different concentrations of cadmium/ measurement of OD 600 over a period of 7 hours (1 per h)/ purification of PCR-products (10-Sept-2014)/ restriction digest of PCR-product and pSB1C3 with FastDigest EcoRI and PstI/ purification of digested products/ ligation for 1 h at RT/ transformation of XL1-Blue Competent Cells via heat-shock using 5 µl ligation reaction/ selection on chloramphenicol/ plasmidprep (glystocks prepared before) of ONC of positive colonies Expansin/CBD: sequencing with primer 16
10-Sept-2014 Steffen IPG colony-PCR colony-PCR using E. coli colonies (09-Sept-2014) and primer 16 and 17: 1 positive Expansin-clone/ ONC of positive colonies CBD/Expansin
09-Sept-2014 Steffen IPG colony-PCR colony-PCR using E. coli colonies (08-Sept-2014) and primer 16 and 17: 1 positive CBD-clone/ transformation of XL1-Blue Competent Cells via heat-shock using 5 µl ligation reaction (05-Sept-2014)/ selection on chloramphenicol
08-Sept-2014 Fabian, Steffen Botany harvesting of transgenic seeds from A. thaliana harvesting of mature seeds of transformed plants (transformation date: 31-July-2014)
08-Sept-2014 Steffen IPG transformation of E.coli XL1-blue with pSB1C3 transformation of XL1-Blue Competent Cells via heat-shock using 5 µl ligation reaction (05-Sept-2014)/ selection on chloramphenicol
05-Sept-2014 Steffen IPG cloning T4MBP, Expansin, CBD into pSB1C3 (shipping vector) test of FastDigest enzymes: expansin digested/not digested on 2.5% gel: digestion was positive/ purification of PCR-product (04-Sept-2014)/ restriction digest of PCR-product and pSB1C3 with FastDigest EcoRI and PstI/ purification of digested products/ ligation for 1 h at RT
03-Sept-2014 Steffen IPG colony-PCR colony-PCR using E. coli colonies (02-Sept-2014) and primer 16 and 17: 0 positive clones
02-Sept-2014 Steffen IPG cloning T4MBP, Expansin, CBD into pSB1C3 (shipping vector) purification of PCR-product (01-Sept-2014)/ restriction digest of PCR-product and pSB1C3 with NEB EcoRI and PstI/ purification of digested products/ ligation for 1 h at RT/ transformation of XL1-Blue Competent Cells via heat-shock/ selection on chloramphenicol
20-Aug-2014 Katharina, Björn IPG insertion of T4MBP in pASK sequencing confirms the insertion of T4MBP in pASK
19-Aug-2014 Melanie IPG sequencing.v2 (same primer) sequencing with primer 1261 (IPG) again stopped 10 bp before BglII-site: no definite result: again
18-Aug-2014 Katharina, Björn IPG insertion of T4MBP in pASK sequencing of pASK with T4MBP not long enough
14-Aug-2014 Katharina IPG insertion of T4MBP in pASK plasmid isolation: shipping to Seqlab
13-Aug-2014 Katharina IPG insertion of T4MBP in pASK colony-PCR with primers 729 and 734: 1 positive colony: ONC
12-Aug-2014 Katharina, Björn IPG insertion of T4MBP in pASK preparation of XL1-Blue Competent Cells/ transformation of XL1-Blue Competent Cells with ligation mixture
11-Aug-2014 Katharina IPG insertion of T4MBP in pASK amplification of T4MBP with primers 8 and 9/ addition of EcoRI und NcoI sites via primer/ purification of PCR reaction mixture via kit/ digestion of pASK and amplificate with EcoRI and NcoI/ ligation over night (16 h, 16°C)
11-Aug-2014 Katharina, Björn IPG insertion of T4MBP in pASK amplification of T4MBP by adding EcoRI and NcoI sites with the primers 8 and 9/ digestion of amplificate and pASK vector with EcoRI and NcoI/ simultaneous dephosphorylation of pASK/ ligation of pASK and T4MBP (16 h, 16 °C)
10-Aug-2014 Andreas IPG immunostain.v2 still no difference between control and samples/ 9 min are enough for the final incubation of substrate buffer
09-Aug-2014 Andreas IPG colony-PCR/ SDS-PAGE.v2 colony-PCR with primer 729 and 734 (IPG),T A = 48 °C (1:30 min)
08-Aug-2014 Andreas IPG pASK-transformation.v2 transformation of freshly prepared heatshock competent BL21 (DE3) pLyss cells with Katharina's and Björn's ligation-product
08-Aug-2014 Katharina, Björn IPG insertion of T4MBP in pASK isolation of pASK from ONC
07-Aug-2014 Andreas IPG immunostain/ ONC polyclonal anti-flag-antibody (primary antibody) and anti-rabbit alkaline phosphatase (secondary antibody); both 1:2000 diluted/ after incubation with substrate buffer for 13 min: same signals (all over the lanes, very unspecific) in samples and control: maybe problems in sample handling: repetition/ ONC of pORE-E3
07-Aug-2014 Katharina, Björn IPG insertion of T4MBP in pASK only colonies on positive control: again inoculation of ONC
06-Aug-2014 Anke, Andreas IPG SDS-PAGE/ Coomassie-stain/ blotting volume of cellulose-bound protein samples were reduced by direct application of „Polyethylenglykol 6000“ on top of the tube: all samples loaded into a 12 % SDS-PAGE
06-Aug-2014 Katharina, Björn IPG insertion of T4MBP in pASK amplification of CDS (without His-tag) with primer 8 and 9 (Botany) via Phusion/ purification of the product with „Wizard-PCR and Gel Kit“/ double digestion of PCR product and pASK vector with EcoRI and NcoI for 30 min/ purification of both samples: poor results/ ligation of insert and pASK for 2 h (22 °C)/ transformation over night (37 °C)
05-Aug-2014 Andreas IPG cellulose-bound-protein GFP_in_pMA_EMP2 dialysis (four times) to remove urea from the cellulose samples (1x overnight, 2x during the day, 1x overnight)
05-Aug-2014 Katharina, Björn IPG insertion of T4MBP in pASK isolation (pORE_E3_2x35S_Expa_T4MBP_CBD) from E. coli ONC via plasmidpreparation (MiniKit)/ amplification of CDS (without His-tag) with primer 8 and 9 (Botany) via Phusion: did not work: again
04-Aug-2014 Anke, Andreas IPG isolation of transient expressed protein from N. tabacum isolation of cellulose-bound and unbound protein from N. tabaccum : cooling via liquid nitrogen, automatically maceration by „Precellys“ and resuspendation in 1 x SDS-sample buffer (one sample for each plant)/ debris-pellet from centrifugation washed with dd H 2 0 two times/ incubation in 1 ml 8 M urea overnight
31-July-2014 Steffen, Fabian Botany floral dip transformation of A. thaliana transformation of A. thaliana via floral dip by using A. tumefaciens as vector: used construct: pORE_E3_2x35S_Expa_T4MBP_CBD
31-July-2014 Anke, Björn IPG transient transformation of N. tabacum with pORE_E3_2x35S_Expa_T4MBP_CBD transient transformation of 5 N. tabacum plants: used construct: pORE_E3_2x35S_TMBP in GV1301 and 4 plants without GV1301/ use of 1ml per leave and two leaves per plant
21-July-2014 Fabian Botany colony-PCR of Agrobacterium -transformation colony-PCR with primer 11 (Botany) and 1484: poor results: proabably too high annealing temperature/ new colony-PCR with primer 11 and 1261/ preparation of 2 day cultures for Arabidopsis transformation
18-July-2014 Fabian Botany transformation of Agrobacterium with pORE_E3_2x35S_Expa_T4MBP_CBD using electrocompetent GV3101 cells
17-July-2014 Steffen, Fabian Botany plasmidpreparation/ sequencing use of ONC of E. coli with pORE and insert/ plasmidpreparation via Thermo Kit/ sequencing from both directions with primer 11 (Botany) and 1261: poor results for reverse direction/ resequencing of reverse sequence with primer 1484
15-July-2014 Steffen, Fabian Botany colony-PCR of pORE with insert Taq-PCR of 27 colonies using primer 11 (Botany, binds 35S) and 1012: poor results: wrong reverse primer used/ new colony-PCR with other reverse primer 1261 (binds NOS-terminator): result fine/ ONC
14-July-2014 Steffen, Fabian Botany cloning of CDS (Expa_T4MBP_CBD) into pORE2x35S purification of Phusion-PCR (11-July-2014) to get rid of disturbing enzymes/ double digest of purified PCR-product and vector with MluI and BamHI for 1 h/ preparative gelelectrophoresis: cutting of specific bands/ gelextraction/ ligation of digested insert and vector for 1 h/ transformation of chemical competent E. coli DH5alpha with ligated DNA via heatshock
11-July-2014 Fabian Botany amplification of CDS from polyprotein Phusion-PCR: using Geneart-shipping vector with insert as template, primer 106 and 859
03-July-2014 Katharina IPG negative colony-PCR continued by Fabian and Steffen
02-July-2014 Katharina IPG repetition of 27-June-2014: transformation of XL1–blue Competent Cells with T4MBP in pORE-E3 with 35S-Promotor.v2
01-July-2014 Katharina IPG ligation of T4MBP with pORE-E3 with 35S-Promotor.v2 digestion of pASK with T4MBP and pORE-E3 with 2x35S promotor with MluI and BamHI/ overnight ligation
30-June-2014 Andreas IPG sequencing Bielefelder-CBDs sequencing (Seqlab/ Microsynth) with primer 611 (GCTGGCCTTTTGCTCAGATGTTCTTTCCTGCGTTATC): optained sequencing result matches the (online) given sequence
30-June-2014 Katharina IPG negative colony-PCR
27-June-2014 Katharina IPG transformation of XL1-Blue with T4MBP in pORE-E3 with 35S-Promotor.v1
26-June-2014 Katharina IPG ligation of T4MBP with pORE-E3 with 35S-Promotor.v1 digestion of pASK with T4MBP and pORE-E3 with 2x35S promotor with Mlu1 and BamHI/ overnight ligation
26-June-2014 Katharina IPG plasmidpreparation of pASK digestion of pASK with T4MBP and pORE-E3 with 2x35S promotor with Mlu1 and BamHI/ overnight ligation
25-June-2014 Katharina IPG colony-PCR of transformated XL1blue with T4MBP in pASK primer for colony PCR: T7 and BackSeq-pGII
24-June-2014 Katharina IPG back-up-transformation of synthesised T4MBP located in pASK transformation of XL1-Blue Competent Cells
24-June-2014 Melanie IPG linearization of Bielefelder-CBDs linearizing BBa_K863101 & BBa_K863111
24-June-2014 Melanie, Andreas IPG isolation of Bielelfelder-CBDs isolation of BBa_K863101 & BBa_K863111 with PeqGOLD Plasmid Miniprep Kit by PeqLab GmbH and selfmade solutions
20-June-2014 Andreas IPG ONC of Bielefelder-CBDs culturing XL1 containg pSB1C3 plasmid with parts BBa_K863101 & BBa_K863111 in 10 ml LB medium and 10 µl chloramphenicol
19-June-2014 Fabian Botany plasmidpreparation.v2 preparation of the 3 E. coli clones which were expected to have the right insert (using Thermo Mini-Prep Kit)/ sequencing of all 3 clones using Primer 1011 (IPG): fine result: all 3 clones have the insert at the right position
18-June-2014 Fabian Botany new colony-PCR new colony-PCR to detect transformed E. coli clones using primers 1011 and 1012 (IPG): 3 positive clones which were used for ONC
16-June-2014 Fabian Botany plasmidpreparation.v1
preparation of 2 E. coli clones which were expected to have the right insert (using Thermo Mini-Prep Kit)/ sequencing of one clone using Primer 962 (IPG): poor results: probably Primer 962 isn't working (even without 2x35S insertion sequencing should have worked)
13-June-2014 Fabian Botany colony-PCR colony-PCR for detecting transformed E. coli clones using amplification primer 1 and 2 AND 1011 (IPG): poor results were interpreted wrongly: false clones were used for ONC
12-June-2014 Fabian Botany digest/ ligation/ transformation of 2x35S into pORE gelextraction of 2x35S (using Qiagen-Kit)/ digest of 2x35S and pORE with XhoI and BamHI (37 °C for 1 h)/ gelelectophoresis for separation of cutted pORE, using the large fragment (gelextraction)/ ligation of 2x35S and pORE (using T7-Ligase)/ transformation of chemical competent E. coli DH5alpha / plating on LB-plates with kanamycin
10-June-2014 Fabian Botany amplification of 2x35S Promotor use of primer 1 and 2 to amplify 2x35S promotor from template DNA/ separation of fragments via gelelectophoresis/ preparation of fragments from the gel
21-May-2014 Fabian Botany BamHI, MluI-digest analysis whether both enzymes (BamHI and MluI) cut: double digest of pORE E3
19-May-2014 Anke IPG - preparation of a glystock
19-May-2014 Steffen, Fabian Botany - plasmid isolation of pORE-E3
16-May-2014 Steffen, Andreas IPG „over-weekend“- culture pORE-E3 culturing JM109 bacteria cells containing pORE-E3 (250 µM from Glystock) in 10 ml LB media including 10 µM kanamycin over weekend at 27 °C