"

From 2014.igem.org

Notebook / Heavy metal

date	coworkers	lab	activity	short summary
08-Oct-2014	Alina, Lisa	Inorganic chemistry	ICP-OES analysis	sample preparation with high pressure, heat and 2.5 % HNO 3 / half-quantitative analysis: using calibration curves with defined heavy metal concentrations but only estimated sample volumina / detection via ICP-OES
07-Oct-2014	Anke	Botany	selection of transformed A. thaliana	potting transformed plants (without chlorosis) into substrat
06-Oct-2014	Alina, Andreas	IPG	E. coli preparation for MS analysis	E. coli Origami 2 cultures were precipitated by centrifuging them for 15 min at 4500 x g and 4 °C/ precipitates were dissolved in isoosmotic buffer/ after five washing steps with the same buffer, the precipitates were dried for 48 h at 70 °C
03-Oct-2014	Fabian, Katharina, Björn	IPG	preparation of new large scale E. coli cultures (zn, cu, cd) for MS	preparation of two repetitions of 500 ml: Origami 2_pASK with and without T4MBP and 0.25 mM cadmium, Origami 2_pASK with and without T4MBP and copper, Origami 2_pASK with and without T4MBP and zinc, Origami 2_pASK with and without T4MBP without heavy metals are used as controls/ all in all 16 flasks with 500 ml cultures/ induction of proteinexpression with anhydrotetracycline/ growing at 20 °C for 4 d to reach a high OD
02-Oct-2014	Fabian, Melanie	IPG	analysis of lethal concentration of copper and zinc	usage of copper-nitrate and zinc-nitrate/ analyses of growth rates of E. coli Origami 2 within media containing different heavy metal concentrations
25-Sept-2014	Fabian	Inorganic chemistry	ICP-MS analysis	sample preparation with high pressure, heat and 2.5 % HNO 3 / quantitative analysis: using calibration curves with defined heavy metal concentrations/ detection via ICP-MS
22-Sept-2014	Björn	IPG	pellitizing the E. coli cultures for MS	pellitizing the 2 l Origami 2 with pASK_T4MBP and 0.25 mM cadmium etc./ five washing steps with isoosmotic buffer/ drying the three pellets for 24 h and notation of dry weight
19-Sept-2014	Fabian	IPG	preparation of large scale E. coli cultures for MS	preparation of 2 l Origami 2 with pASK_T4MBP and 0.25 mM cadmium/ Chassis Origami 2 with and without cadmium (2 l each) are used as controls/ induction of proteinexpression with anhydrotetracycline/ growing at 25 °C for 3 d to reach a high OD
19-Sept-2014	Fabian	IPG	transformation of pASK (no insert) into Origami 2	analyses: a comparable expression system for pASK_T4MBP is needed/ chemical competent cells were made/ transformation via heat shock, incubation over weekend at 16 °C
19-Sept-2014	Steffen	IPG	plasmidpreparation/ sequencing	plasmidpreparation of ONC (red/white colony pSB1C3) and colony T4MBP/ sequencing with primer 16; T4MBP sequenced with primer 16 and 17
18-Sept-2014	Fabian	IPG	physiological test of T4MBP activity	Origami 2 with pASK_T4MBP at different cadmium concentrations (0 - 1 mM) were analyzed/ at 0.2 mM high grow rates were observed/ in comparison to Origami 2 without T4MBP no significant effect of TMBP was seen/ problem: induction of proteinexpression reduces growth rates: another inducible protein in Origami 2 is needed for comparison
18-Sept-2014	Steffen	IPG	colony-PCR	colony-PCR using E. coli colonies and primer 16 and 17: detection of 1 positive T4MBP-clone/ growth of red and white colonies (pSB1C3): colony-PCR
17-Sept-2014	Fabian, Steffen	IPG	immunostain	immunostaining blotted PVDF-membranes: use of Strep-tag- and His-tag-antibody (positive control): Strep shows specific signal at 37 kD, His shows signal at 37 kD as well/ Anti-Strep obviously works/ protein is found in inclusion bodies and supernatant
16-Sept-2014	Fabian, Steffen	IPG	SDS-PAGE/ Western Blot	testing of new Strep-tag-antibody/ use of pASK_T4MBP in Origami 2 to produce protein/ harvesting via ultrasound sonification/ test of protein pellet and supernatant/ run of discontinuous SDS-PAGE/ blotting proteins on PVDF/ transfer-check via Ponceau-stain/ membrane-blocking over night with Roti-Block
16-Sept-2014	Steffen	IPG	saving linearized pSB1C3 into E. coli / transformation of E. coli	ligation reactions with/without ligase: ligation for 1h at RT/ transformation of XL1-Blue Competent Cells via heat-shock using 10 µl ligation reaction/ selection on chloramphenicol/ transformation of XL1-Blue Competent Cells via heat-shock using 5 µl ligation reaction (11-Sept-2014)/ selection on chloramphenicol
15-Sept-2014	Fabian	Botany	selection of transformed A. thaliana seeds	sterilization of harvested A. thaliana seeds (09-Sept-2014) with ethanol/ plating of seeds on MSO-media with 2 % sucrose and 15 µg/ml phosphinothricin for selection/ stored for 2 days at 4 °C/ put at 20 °C until germination
12-Sept-2014	Steffen	IPG	colony-PCR/ sequencing results	colony-PCR using E. coli colonies (11-Sept-2014) and primer 16 and 17: 0 positive clone Expansin/T4MBP, results of expansin and CBD are positive
11-Sept-2014	Steffen, Anke	IPG	growth curves of Origami 2 pASK/ cloning T4MBP/ CBD into pSB1C3 (shipping vector)/ plasmidpreparation/ sequencing	growth of Origami 2 pASK in media containing five different concentrations of cadmium/ measurement of OD 600 over a period of 7 hours (1 per h)/ purification of PCR-products (10-Sept-2014)/ restriction digest of PCR-product and pSB1C3 with FastDigest EcoRI and PstI/ purification of digested products/ ligation for 1 h at RT/ transformation of XL1-Blue Competent Cells via heat-shock using 5 µl ligation reaction/ selection on chloramphenicol/ plasmidprep (glystocks prepared before) of ONC of positive colonies Expansin/CBD: sequencing with primer 16
10-Sept-2014	Steffen	IPG	colony-PCR	colony-PCR using E. coli colonies (09-Sept-2014) and primer 16 and 17: 1 positive Expansin-clone/ ONC of positive colonies CBD/Expansin
09-Sept-2014	Steffen	IPG	colony-PCR	colony-PCR using E. coli colonies (08-Sept-2014) and primer 16 and 17: 1 positive CBD-clone/ transformation of XL1-Blue Competent Cells via heat-shock using 5 µl ligation reaction (05-Sept-2014)/ selection on chloramphenicol
08-Sept-2014	Fabian, Steffen	Botany	harvesting of transgenic seeds from A. thaliana	harvesting of mature seeds of transformed plants (transformation date: 31-July-2014)
08-Sept-2014	Steffen	IPG	transformation of E.coli XL1-blue with pSB1C3	transformation of XL1-Blue Competent Cells via heat-shock using 5 µl ligation reaction (05-Sept-2014)/ selection on chloramphenicol
05-Sept-2014	Steffen	IPG	cloning T4MBP, Expansin, CBD into pSB1C3 (shipping vector)	test of FastDigest enzymes: expansin digested/not digested on 2.5% gel: digestion was positive/ purification of PCR-product (04-Sept-2014)/ restriction digest of PCR-product and pSB1C3 with FastDigest EcoRI and PstI/ purification of digested products/ ligation for 1 h at RT
03-Sept-2014	Steffen	IPG	colony-PCR	colony-PCR using E. coli colonies (02-Sept-2014) and primer 16 and 17: 0 positive clones
02-Sept-2014	Steffen	IPG	cloning T4MBP, Expansin, CBD into pSB1C3 (shipping vector)	purification of PCR-product (01-Sept-2014)/ restriction digest of PCR-product and pSB1C3 with NEB EcoRI and PstI/ purification of digested products/ ligation for 1 h at RT/ transformation of XL1-Blue Competent Cells via heat-shock/ selection on chloramphenicol
20-Aug-2014	Katharina, Björn	IPG	insertion of T4MBP in pASK	sequencing confirms the insertion of T4MBP in pASK
19-Aug-2014	Melanie	IPG	sequencing.v2 (same primer)	sequencing with primer 1261 (IPG) again stopped 10 bp before BglII-site: no definite result: again
18-Aug-2014	Katharina, Björn	IPG	insertion of T4MBP in pASK	sequencing of pASK with T4MBP not long enough
14-Aug-2014	Katharina	IPG	insertion of T4MBP in pASK	plasmid isolation: shipping to Seqlab
13-Aug-2014	Katharina	IPG	insertion of T4MBP in pASK	colony-PCR with primers 729 and 734: 1 positive colony: ONC
12-Aug-2014	Katharina, Björn	IPG	insertion of T4MBP in pASK	preparation of XL1-Blue Competent Cells/ transformation of XL1-Blue Competent Cells with ligation mixture
11-Aug-2014	Katharina	IPG	insertion of T4MBP in pASK	amplification of T4MBP with primers 8 and 9/ addition of EcoRI und NcoI sites via primer/ purification of PCR reaction mixture via kit/ digestion of pASK and amplificate with EcoRI and NcoI/ ligation over night (16 h, 16°C)
11-Aug-2014	Katharina, Björn	IPG	insertion of T4MBP in pASK	amplification of T4MBP by adding EcoRI and NcoI sites with the primers 8 and 9/ digestion of amplificate and pASK vector with EcoRI and NcoI/ simultaneous dephosphorylation of pASK/ ligation of pASK and T4MBP (16 h, 16 °C)
10-Aug-2014	Andreas	IPG	immunostain.v2	still no difference between control and samples/ 9 min are enough for the final incubation of substrate buffer
09-Aug-2014	Andreas	IPG	colony-PCR/ SDS-PAGE.v2	colony-PCR with primer 729 and 734 (IPG),T A = 48 °C (1:30 min)
08-Aug-2014	Andreas	IPG	pASK-transformation.v2	transformation of freshly prepared heatshock competent BL21 (DE3) pLyss cells with Katharina's and Björn's ligation-product
08-Aug-2014	Katharina, Björn	IPG	insertion of T4MBP in pASK	isolation of pASK from ONC
07-Aug-2014	Andreas	IPG	immunostain/ ONC	polyclonal anti-flag-antibody (primary antibody) and anti-rabbit alkaline phosphatase (secondary antibody); both 1:2000 diluted/ after incubation with substrate buffer for 13 min: same signals (all over the lanes, very unspecific) in samples and control: maybe problems in sample handling: repetition/ ONC of pORE-E3
07-Aug-2014	Katharina, Björn	IPG	insertion of T4MBP in pASK	only colonies on positive control: again inoculation of ONC
06-Aug-2014	Anke, Andreas	IPG	SDS-PAGE/ Coomassie-stain/ blotting	volume of cellulose-bound protein samples were reduced by direct application of „Polyethylenglykol 6000“ on top of the tube: all samples loaded into a 12 % SDS-PAGE
06-Aug-2014	Katharina, Björn	IPG	insertion of T4MBP in pASK	amplification of CDS (without His-tag) with primer 8 and 9 (Botany) via Phusion/ purification of the product with „Wizard-PCR and Gel Kit“/ double digestion of PCR product and pASK vector with EcoRI and NcoI for 30 min/ purification of both samples: poor results/ ligation of insert and pASK for 2 h (22 °C)/ transformation over night (37 °C)
05-Aug-2014	Andreas	IPG	cellulose-bound-protein GFP_in_pMA_EMP2	dialysis (four times) to remove urea from the cellulose samples (1x overnight, 2x during the day, 1x overnight)
05-Aug-2014	Katharina, Björn	IPG	insertion of T4MBP in pASK	isolation (pORE_E3_2x35S_Expa_T4MBP_CBD) from E. coli ONC via plasmidpreparation (MiniKit)/ amplification of CDS (without His-tag) with primer 8 and 9 (Botany) via Phusion: did not work: again
04-Aug-2014	Anke, Andreas	IPG	isolation of transient expressed protein from N. tabacum	isolation of cellulose-bound and unbound protein from N. tabaccum : cooling via liquid nitrogen, automatically maceration by „Precellys“ and resuspendation in 1 x SDS-sample buffer (one sample for each plant)/ debris-pellet from centrifugation washed with dd H 2 0 two times/ incubation in 1 ml 8 M urea overnight
31-July-2014	Steffen, Fabian	Botany	floral dip transformation of A. thaliana	transformation of A. thaliana via floral dip by using A. tumefaciens as vector: used construct: pORE_E3_2x35S_Expa_T4MBP_CBD
31-July-2014	Anke, Björn	IPG	transient transformation of N. tabacum with pORE_E3_2x35S_Expa_T4MBP_CBD	transient transformation of 5 N. tabacum plants: used construct: pORE_E3_2x35S_TMBP in GV1301 and 4 plants without GV1301/ use of 1ml per leave and two leaves per plant
21-July-2014	Fabian	Botany	colony-PCR of Agrobacterium -transformation	colony-PCR with primer 11 (Botany) and 1484: poor results: proabably too high annealing temperature/ new colony-PCR with primer 11 and 1261/ preparation of 2 day cultures for Arabidopsis transformation
18-July-2014	Fabian	Botany	transformation of Agrobacterium with pORE_E3_2x35S_Expa_T4MBP_CBD	using electrocompetent GV3101 cells
17-July-2014	Steffen, Fabian	Botany	plasmidpreparation/ sequencing	use of ONC of E. coli with pORE and insert/ plasmidpreparation via Thermo Kit/ sequencing from both directions with primer 11 (Botany) and 1261: poor results for reverse direction/ resequencing of reverse sequence with primer 1484
15-July-2014	Steffen, Fabian	Botany	colony-PCR of pORE with insert	Taq-PCR of 27 colonies using primer 11 (Botany, binds 35S) and 1012: poor results: wrong reverse primer used/ new colony-PCR with other reverse primer 1261 (binds NOS-terminator): result fine/ ONC
14-July-2014	Steffen, Fabian	Botany	cloning of CDS (Expa_T4MBP_CBD) into pORE2x35S	purification of Phusion-PCR (11-July-2014) to get rid of disturbing enzymes/ double digest of purified PCR-product and vector with MluI and BamHI for 1 h/ preparative gelelectrophoresis: cutting of specific bands/ gelextraction/ ligation of digested insert and vector for 1 h/ transformation of chemical competent E. coli DH5alpha with ligated DNA via heatshock
11-July-2014	Fabian	Botany	amplification of CDS from polyprotein	Phusion-PCR: using Geneart-shipping vector with insert as template, primer 106 and 859
03-July-2014	Katharina	IPG	negative colony-PCR	continued by Fabian and Steffen
02-July-2014	Katharina	IPG	repetition of 27-June-2014: transformation of XL1–blue Competent Cells with T4MBP in pORE-E3 with 35S-Promotor.v2
01-July-2014	Katharina	IPG	ligation of T4MBP with pORE-E3 with 35S-Promotor.v2	digestion of pASK with T4MBP and pORE-E3 with 2x35S promotor with MluI and BamHI/ overnight ligation
30-June-2014	Andreas	IPG	sequencing Bielefelder-CBDs	sequencing (Seqlab/ Microsynth) with primer 611 (GCTGGCCTTTTGCTCAGATGTTCTTTCCTGCGTTATC): optained sequencing result matches the (online) given sequence
30-June-2014	Katharina	IPG	negative colony-PCR
27-June-2014	Katharina	IPG	transformation of XL1-Blue with T4MBP in pORE-E3 with 35S-Promotor.v1
26-June-2014	Katharina	IPG	ligation of T4MBP with pORE-E3 with 35S-Promotor.v1	digestion of pASK with T4MBP and pORE-E3 with 2x35S promotor with Mlu1 and BamHI/ overnight ligation
26-June-2014	Katharina	IPG	plasmidpreparation of pASK	digestion of pASK with T4MBP and pORE-E3 with 2x35S promotor with Mlu1 and BamHI/ overnight ligation
25-June-2014	Katharina	IPG	colony-PCR of transformated XL1blue with T4MBP in pASK	primer for colony PCR: T7 and BackSeq-pGII
24-June-2014	Katharina	IPG	back-up-transformation of synthesised T4MBP located in pASK	transformation of XL1-Blue Competent Cells
24-June-2014	Melanie	IPG	linearization of Bielefelder-CBDs	linearizing BBa_K863101 & BBa_K863111
24-June-2014	Melanie, Andreas	IPG	isolation of Bielelfelder-CBDs	isolation of BBa_K863101 & BBa_K863111 with PeqGOLD Plasmid Miniprep Kit by PeqLab GmbH and selfmade solutions
20-June-2014	Andreas	IPG	ONC of Bielefelder-CBDs	culturing XL1 containg pSB1C3 plasmid with parts BBa_K863101 & BBa_K863111 in 10 ml LB medium and 10 µl chloramphenicol
19-June-2014	Fabian	Botany	plasmidpreparation.v2	preparation of the 3 E. coli clones which were expected to have the right insert (using Thermo Mini-Prep Kit)/ sequencing of all 3 clones using Primer 1011 (IPG): fine result: all 3 clones have the insert at the right position
18-June-2014	Fabian	Botany	new colony-PCR	new colony-PCR to detect transformed E. coli clones using primers 1011 and 1012 (IPG): 3 positive clones which were used for ONC
16-June-2014	Fabian	Botany	plasmidpreparation.v1	preparation of 2 E. coli clones which were expected to have the right insert (using Thermo Mini-Prep Kit)/ sequencing of one clone using Primer 962 (IPG): poor results: probably Primer 962 isn't working (even without 2x35S insertion sequencing should have worked)
13-June-2014	Fabian	Botany	colony-PCR	colony-PCR for detecting transformed E. coli clones using amplification primer 1 and 2 AND 1011 (IPG): poor results were interpreted wrongly: false clones were used for ONC
12-June-2014	Fabian	Botany	digest/ ligation/ transformation of 2x35S into pORE	gelextraction of 2x35S (using Qiagen-Kit)/ digest of 2x35S and pORE with XhoI and BamHI (37 °C for 1 h)/ gelelectophoresis for separation of cutted pORE, using the large fragment (gelextraction)/ ligation of 2x35S and pORE (using T7-Ligase)/ transformation of chemical competent E. coli DH5alpha / plating on LB-plates with kanamycin
10-June-2014	Fabian	Botany	amplification of 2x35S Promotor	use of primer 1 and 2 to amplify 2x35S promotor from template DNA/ separation of fragments via gelelectophoresis/ preparation of fragments from the gel
21-May-2014	Fabian	Botany	BamHI, MluI-digest	analysis whether both enzymes (BamHI and MluI) cut: double digest of pORE E3
19-May-2014	Anke	IPG	-	preparation of a glystock
19-May-2014	Steffen, Fabian	Botany	-	plasmid isolation of pORE-E3
16-May-2014	Steffen, Andreas	IPG	„over-weekend“- culture pORE-E3	culturing JM109 bacteria cells containing pORE-E3 (250 µM from Glystock) in 10 ml LB media including 10 µM kanamycin over weekend at 27 °C