"

From 2014.igem.org

BYU 2014 Notebook Edit July August

Home Team Official Team Profile Project Parts Modeling Notebook Safety Attributions

Week of July 11

July 7

(TR,CB) We began the cloning process over again with recreating the front and back halves of our insert via PCR using the Phusion polymerase.

July 8

(TR) Ran our PCR product out on a gel and found the PCR was unsuccessful yesterday. Will redo tomorrow.

July 9

(TR,CB) Again performed PCR to make our front and back halves, this time using q5 as our DNA polymerase. Running it on a gel afterward, we found we were successful. There was a band in both lanes at about the 500bp mark, just what we were looking for.

Week of July 18

July 14

Week of August 15

Aug 11

(TR,CB) The decision was made that, since we are probably not going to use N multiformis as our chassis any more, we will just focus on N eutropha for now.

Aug 13

(TR) I went ahead and designed primers to be used with N eutropha to knock out the SerB gene and hopefully make it auxotrophic for serine. Here they are;

Forward 1: overhang compatibility - bamHI - front of front 500 bp homology block

GAT - GGATCC - CGATACCTATGGGCATATTGCAG

Reverse 1: Reverse complement of ‘Forward 2’ primer (SOEing primer 2)

TCGAGACCGACGTGATTAAG - TGTATATCTGTACCTTGAAT

Forward 2: front and back of serB coding strand (SOEing primer 1)

ATTCAAGGTACAGATATACA - CTTAATCACGTCGGTCTCGA

Reverse 2: overhang compatibility - speI - reverse complement of back 500 bp homology block

ATC - ACTAGT - AGGAACGCCCCGTGATTATTGCG

Week of August 22

Aug 18

(TR,CB) We received the primers for our N eutropha auxotrophy insert, but are unable to start PCR on it because we have no template. We have decided that in the mean time, we are going to try and finish our cloning for N multiformis. We took template for N multiformis genomic DNA from a frozen stock to synthesize the 500bp front and back halves of our insert again. Then we used the Common Procedure for q5 high fidelity DNA Polymerase to do PCR.

Aug 20

(TR,CB) Ran a gel electrophoresis on Monday's PCR products. We saw that both, the front and back halves of our insert were present around the 500bp mark.

Week of August 29

Aug 25

(TR,CB) Performed SOEing PCR on the front and back halves of insert to go into pSR47s plasmid. We used the high fidelity q5 DNA polymerase.

Aug 26

(TR) Electrophoresed our SOEing PCR product. The gel came out with only a band around 500bp, so something didn't work correctly.

Aug 27

(TR,CB) Started another SOEing PCR to try and prepare the insert for cloning, using q5 DNA polymerase. Also started overnight cultures for some plasmid preps of the pSR47s plasmid, so that we have plenty of vector to work with.

Aug 28

(TR,CB) Performed a plasmid prep of the overnight cultures with pSR47s. Ran a gel electrophoresis of our PCR product and found that the SOEing didn't work again.