"
Team:Hannover/Notebook
From 2014.igem.org
Notebook
| date | coworkers | lab | activity | short summary | ||
| 22.09.2014 | Lisa, Kathi | IPG | insertion of rcf21 | colony-PCR –> only negative controls –> consultation of TR → modification of the protocol | ||
| 19.09.2014 | Fabian | IPG | preparation of large scale E. coli cultures | For mass spectometric analyses, large amounts of bacteria with T4MBP are needed. Therefore 2 l of Origami 2 with pASK_T4MBP and 0,25 mM cadmium were prepared. The chassis Origami 2 with and without cadmium are used as controls (2 l each). Induction of proteinexpression with anhydrotetracycline. Growing at 25 °C for 3 d to reach a high OD | ||
| 19.09.2014 | Fabian | IPG | transformation of pASK (no insert) into Origami 2 | Analyses showed that a comparable expression system for pASK_T4MBP is needed. Therefore chemical competent cells were made. Transformation via heat shock, incubation over weekend at 16 °C | ||
| 19.09.2014 | Kathi | IPG | insertion of rcf21 | plasmid isolation from ONC; digestion of pORE-E3 (without XhoI and BglII-site) with MluI and BamHI; Annealing two primers (3 and 4) to build the rcf; phosphorylation of primer construct; dephosphorylation of digested vector. ligation of vector and insert; transformation of XL1-Blue Competent Cells. incubation over night (25 °C) | ||
| 19.09.2014 | Steffen | IPG | plasmidpreparation and sequencing | -plasmidprep of ONC (red/white colony pSB1C3) and colony T4MBP -sequencing with primer 16, T4MBP sequenced with primer 16/17 | ||
| 18.09.2014 | Fabian | IPG | physiological test of T4MBP activity | Origami 2 with pASK_T4MBP at different cadmium concentrations (1-0 mM) were analyzed. At 0.2 mM high grow rates were observed. In comparison to Origami 2 without T4MBP no significant effect of TMBP was seen. Problem: induction of proteinexpression reduces growth rates. Another inducible protein in Origami 2 is needed for comparison. | ||
| 18.09.2014 | Kathi | IPG | insertion of rcf21 | digestion of pORE-E3 (without XhoI- and BglII-site). There was no DNA → inoculation of an ONC | ||
| 18.09.2014 | Steffen | IPG | colony-PCR | -colony-PCR using E. coli colonies (16.09.2014). Using Primer 16 and 17. Detection of 1 positive clone TMBP -red and white colonies growed (pSB1C3) colony-PCR | ||
| 17.09.2014 | Fabian, Steffen | IPG | immunostain | Immunostaining blotted PVDF-membranes. Using Strep-Tag antibody and His-Tag antibody. Anti-Strep shows specific signal at 37 kD. Anti-His show signal at 37 kD as well. His was used as positive controll. Anti-Strep obviously works. Wanted protein is found in inclusion bodies and supernatant. | ||
| 17.09.2014 | Kathi, Björn | IPG | insertion of rcf21 | colony-PCR with primer 1261 and 488 → all 60 colonies were negative → digestion went probably wrong. isolation of plasmid form another overnight culture via handprep | ||
| 16.09.2014 | Fabian, Steffen | IPG | SDS-PAGE, Western Blot | Testing new Strep-Tag antibody. Using pASK_T4MBP in Origami2 to produce protein. Harvesting protein via ultrasound sonification. Testing protein pellet and supernatant. Runs discontinuous SDS-PAGE. Blotting porteins on PVDF. Checking transfer via Ponceau-stain. Blocking membrane over night with Roti-Block | ||
| 16.09.2014 | Kathi, Björn | IPG | insertion of rcf21 | plasmid isolation from ONC; digestion of pORE-E3 (without XhoI and BglII-site) with MluI and BamHI; Annealing two primers (3 and 4) to build the rcf; phosphorylation of primer construct; dephosphorylation of digested vector. ligation of vektor and insert; transformation of XL1-Blue Competent Cells. | ||
| 16.09.2014 | Steffen | IPG | saving linearized pSB1C3 into E. coli and transformation of E. coli | -1.) ligation reactions with/without ligase 2.) ligation for 1h at room temperature 5.) Transformation of XL1-Blue Competent Cells via heat-shock using 10 µl ligation reaction 6.) selection on chloramphenicol –1.)Transformation of XL1-Blue Competent Cells via heat-shock using 5 µl ligation reaction 11.09.2014 2.) selection on chloramphenicol | ||
| 15.09.2014 | Kathi, Björn | IPG | insertion of rcf21 | digestion of pORE-E3 (without XhoI and BglII-site). There was no DNA → inoculation of an overnight culture | ||
| 15.09.2014 | Fabian | Botany | selection of transformed A. thaliana seeds | Sterilized the harvested A. thaliana seeds (09.09.2014) with ethanol. Plated the seed on Murashige & Skoog media with 2 % sucrose and 15 µg/ml phosphinothricin as selection. Stored them for 2 days at 4 °C. Put at 20 °C until germination | ||
| 12.09.2014 | Steffen | IPG | colony-PCR and sequencing results | -Colony-PCR using E. coli colonies (11.09.2014). Using Primer 16 and 17. Detection of 0 positive clone Expansin/TMBP -results of expansin and CBD are positive | ||
| 11.09.2014 | Anke, Lisa | IPG | plasmidpreparation and sequencing | |||
| 11.09.2014 | Steffen, Anke | IPG | growth curves of Origami 2 pASK, cloning T4MBP, CBD into pSB1C3 (shipping vector) and plasmidpreparation/sequencing | -Growth of Origami 2 pASK in media containing five different cadmium concentration, measured the OD600 over a period of 7 hours (7 measurements) -1.) PCR-Purification of PCR-products (10.09.2014) 2.) Restriction digest of PCR-product and pSB1C3 with FastDigest EcoRI and PstI 3.) Purification of digested products 4.) Ligation for 1 h at room temperature 5.) Transformation of XL1-Blue Competent Cells via heat-shock using 5 µl ligation reaction 6.) selection on chloramphenicol -plasmidprep (before Glystocks prepared) overnigth culture positive colonies Expansin/CBD–>sequencing with primer 16 | ||
| 10.09.2014 | Steffen | IPG | colony-PCR | -Colony-PCR using E. coli colonies (09.09.2014). Using Primer 16 and 17. Detection of 1 positive clone Expansin -overnight culture positive colonies CBD/Expansin | ||
| 09.09.2014 | Fabian, Anke | Biophysics | confocal microscopy | Microscopy of transformed B. sinuspersici and N. tabacum from 04.09.2014. | ||
| 09.09.2014 | Steffen | IPG | colony-PCR | -Colony-PCR usingE. coli colonies (08.09.2014). Using Primer 16 and 17. Detection of 1 positive clone CBD -1.)Transformation of XL1-Blue Competent Cells via heat-shock using 5 µl ligation reaction 5.09.2014 2.) selection on chloramphenicol | ||
| 08.09.2014 | Fabian, Steffen | Botany | harvesting of transgenic seeds from A. thaliana | Harvesting of mature seeds of transformed plants (transformation date: 31.07.2014) | ||
| 08.09.2014 | Steffen | IPG | transformation of E.coli Xl1-blue with pSB1C3 | 1.)Transformation of XL1-Blue Competent Cells via heat-shock using 5 µl ligation reaction 5.09.2014 2.) selection on chloramphenicol | ||
| 05.09.2014 | Steffen | IPG | cloning T4MBP, Expansin, CBD into pSB1C3 (shipping vector) | FastDigest enzymes tested (expansin digested/not digested run on 2.5% gel)–>showed that digestion was positive 1.) PCR-Purification of PCR-product (4.09.2014) 2.) Restriction digest of PCR-product and pSB1C3 with FastDigest EcoRI and PstI 3.) Purification of digested products 4.) Ligation for 1 h at room temperature | ||
| 04.09.2014 | Fabian | Botany | transient plant transformation | A. tumefaciens mediated transformation of B. sinuspersici and N. tabacum. Used constructs: pORE_Expa~GFP~CBD, pEarley103_GFP, pEarley103_Plmamembranemarker. Using leaf infiltration for tobacco and vacuum ilfiltration for Bienertia. | ||
| 03.09.2014 | Steffen | IPG | colony-PCR | Colony-PCR using E. coli colonies (02.09.2014). Using Primer 16 and 17. Detection of 0 positive clones | ||
| 02.09.2014 | Steffen | IPG | cloning T4MBP, Expansin, CBD into pSB1C3 (shipping vector) | 1.) PCR-Purification of PCR-product (1.09.2014) 2.) Restriction digest of PCR-product and pSB1C3 with NEB EcoRI and PstI 3.) Purification of digested products 4.) Ligation for 1 h at room temperature 5.) Transformation of XL1-Blue Competent Cells via heat-shock and selection on chloramphenicol | ||
| 01.09.2014 | Fabian, Steffen, Anke, Andi | Biophysics | confocal microscopy | Microscopy of transformed B. sinuspersici and N. tabacum from 29.08.2014. | ||
| 29.08.2014 | Fabian | Botany | transient plant transformation | A. tumefaciens mediated transformation of B. sinuspersici and N. tabacum. Used constructs: pORE_Expa~GFP~CBD, pEarley103_GFP, pEarley103_Plmamembranemarker. Using leaf infiltration for tobacco and vacuum infiltration for Bienertia. | ||
| 27.08.2014 | Melanie, Lisa | IPG | plasmidpreparation and sequencing.v1 | plasmidprep with 12 colonies, double digest (XhoI and NcoI), all probes on gel, 7 might be without BglII AND XhoI → sequencing with primer ??? (IPG) positive → pORE_E3 2x35S (without T4MPB) and without BglII- and XhoI-site | ||
| 26.08.2014 | Melanie | IPG | ONC of 13 colonies (12+1 pos. control) | several colonies on each plate (including pos. control), pick of 3 to 4 per plate, ONC | ||
| 25.08.2014 | Melanie, Lisa | IPG | ligation, transformation of E. coli with pORE_E3 2x35S (without T4MBP and without BglII-site) ?without? XhoI-site | ligation, transformation of XL1-Blue Competent Cells via heat-shock, 3 x plating on Can | ||
| 22.08.2014 | Melanie | IPG | digest of pORE_E3 2x35S (without T4MBP and without BglII-site) with XhoI, proofreading PCR | digest of pORE_E3 2x35S (without T4MPB and without BglII-site) with XhoI for 1h 37 °C showed complete digestion; proofreading-PCR to avoid A-Tailing (Phusion) | ||
| 22.08.2014 | Fabian | Botany | colony-PCR | Colony-PCR using E. coli colonies (20.08.2014). Using Primer 11 (AG Offermann) and 1261. Detection of 15 positive clones. Using 3 colonies for ONC | ||
| 21.08.2014 | Fabian | Botany | cloning Expa~GFP~CBD into pORE | 1.) PCR-Purification of PCR-product (19.08.2014) 2.) Restriction digest of PCR-product and pORE E3 2x35S with BamHI and MluI 3.) Gelelectrophoresis 4.) Gelextraction of digested vector and PCR-product 5.) Ligation for 1h 6.) Transformation of XL1-Blue Competent Cells via heat-shock and selection on kanamycin | ||
| 20.08.2014 | Melanie | IPG | sequencing.v3 (new primer) | sequencing with primer 1356 was positive → BglII-site destroyed | ||
| 20.08.2014 | Kathi, Björn | IPG | insertion of T4MBP in pASK | sequencing confirms the insertion of T4-MBP in pASK | ||
| 19.08.2014 | Fabian | Botany | Phusion PCR | Phusion PCR using Expa~GFP~CBD-sequence from EMP as template | ||
| 19.08.2014 | Melanie | IPG | sequencing.v2 (same primer) | sequencing with primer 1261 (IPG) again stopped 10 bp before BglII-site, no definite result → again | ||
| 18.08.2014 | Kathi, Björn | IPG | insertion of T4MBP in pASK | sequencing of pASK with T4MBP not long enough | ||
| 15.08.2014 | Lisa | IPG | plasmidpreparation and sequencing.v1 | plasmidprep with 10 colonies, digest with BglI (twice), poor results, only 2 probes on gel, 1 might be without BglII → sequencing with primer 1261 (IPG) of this probe stopped 10 bp before BglII-site, no definite result → again | ||
| 14.08.2014 | Kathi | IPG | insertion of T4MBP in pASK | plasmid isolation → shipping to Seqlab | ||
| 13.08.2014 | Kathi | IPG | insertion of T4MBP in pASK | colony PCR with primers 729 and 734 → one positive colony → ONC | ||
| 13.08.2014 | Melanie, Lisa | IPG | ONC of 10 colonies (9+1 pos. control) | several colonies on each plate (including pos. control), pick of 3 per plate, ONC | ||
| 12.08.2014 | Melanie | IPG | transformation of E. coli with pORE_E3 2x35S (without T4MBP) ?without? BglII | via heat-shock, 3 x plating on Can | ||
| 12.08.2014 | Kathi, Björn | IPG | insertion of T4MBP in pASK | Preparations of XL1-Blue Competent Cells; transformation of XL1-Blue Competent Cells with ligation mixture | ||
| 11.08.2014 | Kathi | IPG | insertion T4MBP in pASK | amplification of T4MBP with primers 8 and 9. Addition of EcoRI und NcoI sites via Primers; puriciation of PCR reaction mixture via kit; digestion of pASK and amplificat with EcoRI and NcoI; ligation over night (16 h, 16°C) | ||
| 11.08.2014 | Melanie, Lisa | IPG | digest of pORE_E3 2x35S (without T4MBP) with BglII, proofreading PCR, ligation | digest of pORE_E3 2x35S (without T4MPB) with BglII for 1h 37 °C showed complete digestion; proofreading-PCR to avoid A-Tailing (Phusion), ligation | ||
| 11.08.2014 | Kathi, Björn | IPG | insertion of T4MBP in pASK | amplification of T4MBP by adding EcoRI and NcoI sites with the primers 8 and 9; digestion of amplificat and pASK vector with EcoRI and NcoI; simulatnous dephosphorlyation of pASK, ligation of pASK and T4-MBP (16 h, 16 °C) | ||
| 10.08.2014 | Andi | IPG | immunostain.v2 | see 07.08; still no difference between control and samples; 9 min are enough for the final incubation of substrate buffer | ||
| 09.08.2014 | Andi | IPG | colony-PCR, SDS-PAGE.v2 | with oligonucleotides 729, 734 (BCH) & Ta = 48 °C (1:30 Min) | ||
| 08.08.2014 | Andi | IPG | plasmid-isolation, pASK-traformation.v2 | Isolation of pORE-E3 for future cloning and EMP_in_pMA_Colony1 for sequencing. Transformation of Kathis and Björns ligation-product in freshly prepared heatshock competent BL21 (DE3) pLyss cells. | ||
| 08.08.2014 | Kathi, Björn | IPG | insertion of T4MBP in pASK | isolation of pASK from overnight culture | ||
| 07.08.2014 | Andi | IPG | immunostain, colony-PCR, ONC | polyclonal anti-Flag-antibody were used as primary, and anti-rabbit alkaline phosphatase as secondary antibody (both 1:2000 diluted). after incubating the substrate buffer for 13 min, the same signals (all over the lanes; very unspecific) were observed in the samples and control, respectively. We were not sure, if problems in the sample handling are the cause for that, and suggest a repetition. Although colony-PCR (F1+R1) confirmed the insertion of GFP, another primer set (BCH: 1101+625) targeting the backbone of pMA did not bind in the colony, but showed a not expected amplificate length of ~1200 bp in the negative control (expected for pMA: ~1600 bp) ONC of pORE-E3, | ||
| 07.08.2014 | Kathi, Björn | IPG | insertion of T4MBP in pASK | only colonies on positive control → again inoculation of overnight culture | ||
| 06.08.2014 | Anke, Andi | IPG | SDS-PAGE, Coomassie-stain & Blotting | The volume of cellulose-bound protein samples were reduced by direct application of „Polyethylenglykol 6000“ on top of the tube. All samples were loaded into a 12 % SDS-PAGE. | ||
| 06.08.2014 | Kathi, Björn | IPG | insertion of T4MBP in pASK | Amplification of CDS (without HIS-TAG) with primers 8 and 9 (Botany) via Phusion. Purification of the product with „Wizard-PCR and Gel Kit) Double digest of PCR product and pASK vector with EcoRI and NcoI for 30 min. Purification of both samples. Poor results. Ligation of insert and pASK for 2 h (22 °C); transformation over night (37 °C) | ||
| 05.08.2014 | Andi | IPG | cellulose-bound-protein GFP_in_pMA_EMP2 | Dialyzing four times to remove Urea from the cellulose samples (1x overnight, 2x during the day, 1x overnight). Repetion of EMP-PCR(2) reaction mix no. 2 (protocol of Anke). After an agarosegel confirmed the correct fragment length, the reaction mix was purfied using the „Wizard-Kit“ (BCH), phosphorylated and ligated overnight according to Ankes protocol. | ||
| 05.08.2014 | Kathi, Björn | IPG | insertion of T4MBP in pASK | Isolation of Plasmid (pORE_E3_2x35S_Expa_T4MBP_CBD) from E. coli overnight culture via Plasmidprep. MiniKit (Firma?). Amplification of CDS (without HIS-TAG) with Primers 8 and 9 (Botany) via Phusion. → did not work → again | ||
| 04.08.2014 | Anke, Andi | IPG | isolation of transient expressed protein from N. tabacum | Isolation of cellulose-bound and unbound protein from N. tabaccum. The material was cooled by liquid nitrogen, automatically macerated by „Precellys“ and resuspended in 1 x SDS-sample buffer. Per plant one sample was taken. The debris-pellet from centrifugation was washed with ddH20 two times and incubated in 1 ml 8 M Urea overnight. | ||
| 31.07.2014 | Steffen, Fabian | Botany | floral dip transformation of A. thaliana | Transformation of A. thaliana via Floral Dip by using A. tumefaciens as vector. Construct: pORE_E3_2x35S_Expa_T4MBP_CBD | ||
| 31.07.2014 | Anke, Björn | IPG | transient transformation of N. tabacum with pORE_E3_2x35S_Expa_TMBP_CBD | transient Transformation of 5 N. tabacum plants with pORE_E3_2x35S_TMBP in GV1301 and 4 plants without GV1301. Using 1ml / leave and two leaves / plant. | ||
| 25.07.2014 | Anke | IPG | colony-PCR of EMP2-transformation | Colony-PCR with primers 1011 and 625 (IPG) and 10 new colonies. Poor result… | ||
| 23.07.2014 | Anke | IPG | colony-PCR of EMP2-transformation | Colony-PCR with primers 1011 and 625 (IPG). Poor result…. | ||
| 22.07.2014 | Anke | IPG | transformation of E. coli with EMP2 | Transformation of XL1-Blue Competent Cells | ||
| 21.07.2014 | Anke, Andi | IPG | EMP 2 GfP | Screening the functional amount of megaprimer with and without F1: 20 ng Megaprimer + F1 + R2 | ||
| 21.07.2014 | Fabian | Botany | colony-PCR of Agor-Trafo | Colony-PCR with primer 11 (AG Offermann and 1484). Poor result, proabably of too high annealing temperature. New colony-PCR with 11 and 1261. Prepare 2 days cultures for Arabidopsis transformation | ||
| 18.07.2014 | Anke | IPG | EMP 1 GfP | EMP1 with F1, R2 and GFP-vector to genererate Megaprimer. Result is fine. | ||
| 18.07.2014 | Fabian | Botany | transformation of Agrobacterium with pORE_E3_2x35S_Expa_TMBP_CBD | Using electrocompetent GV3101 cells. | ||
| 17.07.2014 | Steffen, Fabian | Botany | plasmidpreparation and sequencing | Using ONC of E. coli with pORE and insert. Plasmidprep via Thermo Kit. Sequencing from both directions with primer 11 (AG Offermann) and 1261. Poor results for reverse direction. Resequencing of reverse sequence with 1484 | ||
| 15.07.2014 | Steffen, Fabian | Botany | colony-PCR of pORE with Insert | Taq-PCR of 27 colonies using primer 11 of AG Offermann (binds to 35S) and 1012. Poor result, wrong reverse primer used. Doing new colony PCR with other reverse primer 1261 (binds to NOS-terminator. Result is fine. ONC | ||
| 14.07.2014 | Steffen, Fabian | Botany | cloning of CDS (Expa_T4MBP_CBD) into pORE2x35S | 1. PCR-Purification of Phusion-PCR (11.7) to get rid of disturbing enzymes. 2.) double digest of purified PCR-product and vector with MluI and BamHI for 1 h. 3.) Preparative Gelelctrophoresis. Cutting out specific bands. 4.) Gelextraction. 5.) Ligation of digested insert and vector for 1 h. 6.) Transformation of chemical competent E. coli DH5alpha with ligated DNA via heatshock | ||
| 11.07.2014 | Fabian | Botany | amplification of CDS from polyprotein | Phusion-PCR. Using Geneart-Shipping vector with insert as template. Primers 106 and 859 | ||
| 03.07.2014 | Kathi | IPG | negative colony-PCR | (continued by Fabian and Steffen) | ||
| 02.07.2014 | Kathi | IPG | repetition of day 27.06.2014: Transformation of XL1blue with T4MBP in pORE-E3 with 35S-Promotor | |||
| 01.07.2014 | Kathi | IPG | due to unsuccessful transformation repetition of day 26.06.2014: ligation of T4MBP with pORE-E3 with 35S-Promotor | Digestion of pASK with T4MBP and pORE-E3 with 2x35S promotor with MluI and BamHI, overnight ligation | ||
| 30.06.2014 | Andi | IPG | sequencing Bielefelder-CBDs | Sequencing (Seqlab/ Microsynth) was done with primer no. 611 (GCTGGCCTTTTGCTCAGATGTTCTTTCCTGCGTTATC) and revealed that the obtained sequencing result matched the given sequence online | ||
| 30.06.2014 | Kathi | IPG | negative colony-PCR | |||
| 27.06.2014 | Kathi | IPG | transformation of XL1-Blue with T4MBP in pORE-E3 with 35S-Promotor | |||
| 26.06.2014 | Kathi | IPG | ligation of T4MBP with pORE-E3 with 35S-Promotor | Digestion of pASK with T4MBP and pORE-E3 with 2x35S promotor with Mlu1 and BamHI, overnight ligation | ||
| 26.06.2014 | Kathi | IPG | plasmidpreparation of pASK | Digestion of pASK with T4MBP and pORE-E3 with 2x35S promotor with Mlu1 and BamHI, overnight ligation | ||
| 25.06.2014 | Kathi | IPG | colony-PCR of transformated XL1blue with T4MBP in pASK | Primer for colony PCR: T7 and BackSeq-pGII | ||
| 24.06.2014 | Kathi | IPG | transformation to back up the synthesised T4MBP located in pASK vector | Transformation of XL1-Blue Competent Cells | ||
| 24.06.2014 | Melanie | IPG | linearization of Bielefelder-CBDs | linearizing BBa_K863101 & BBa_K863111 | ||
| 24.06.2014 | Melanie, Andi | IPG | isolation of Bielelfelder-CBDs | Isolating BBa_K863101 & BBa_K863111 with PeqGOLD Plasmid Miniprep Kit by PeqLab GmbH and selfmade solutions | ||
| 20.06.2014 | Andi | IPG | ONC of Bielefelder-CBDs | Culturing XL1 containg pSB1C3 plasmid with parts BBa_K863101 & BBa_K863111 in 10 ml LB medium and 10 µl Chloramphenicol | ||
| 19.06.2014 | Fabian | Botany | plasmidpreparation | Preparation of the 3 E. coli clones which were expected to have the right insert (using Thermo Mini-Prep Kit). Plasmids of one all 3 clones were send for sequencing, using Primer 1011 (IPG). Sequencing worked fine. All 3 clones have the insert at the right position | ||
| 18.06.2014 | Fabian | Botany | new colony-PCR | New Colony-PCR for detecting transformed E. coli clones. Using primers 1011 and 1012 (IPG). Detecting 3 positive clones wich were used for over-night cultures | ||
| 16.06.2014 | Fabian | Botany | plasmidpreparation | Preparation of 2E. coli clones wich were expected to have the right insert (using Thermo Mini-Prep Kit). Plasmid of one clone was send for sequencing, using Primer 962 (IPG). Sequencing didn't work (second sequncing trial by seqlab failed as well). Probably Primer 962 isn't working (even without 2x35S insertion sequencing should have work) | ||
| 13.06.2014 | Fabian | Botany | colony-PCR | Colony-PCR for detecting transformed E. coli clones. Using amplification primers 01 and 02 AND 1011 (IPG). Colony-PCR worked more or less, results were interpreted wrongly. False clones were used for over-night cultures | ||
| 12.06.2014 | Fabian | Botany | digest, ligation and transformation of 2x35S into pORE | 1) Gelextraction of 2x35S (using Qiagen-Kit). 2) Digest of 2x35S and pORE with XhoI and BamHI (37 °C for 1 h). 3) Gelelectophoresis for separation of cutted pORE, using the large fragment (Gelextraction). 4) Ligation of 2x35S and pORE (using T7-Ligase). 5) Transformation of chemical competent E. coli DH5-Alpha and plating on LB-plates with Kanamycin | ||
| 10.06.2014 | Fabian | Botany | amplification of 2x35S Promotor | Using Primer 01 and 02 to amplify 2x35S promotor from template DNA. Separation of fragments via gelelectophoresis and preparation on fragments from the gel | ||
| 21.05.2014 | Fabian | Botany | BamHI, MluI-digest | Analysing if both Enzymes (BamHI and MluI) cut while double digesting pORE E3 | ||
| 19.05.2014 | Anke | IPG | - | Preparing Glystock | ||
| 19.05.2014 | Steffen, Fabian | Botany | - | plasmid isolation pORE-E3 | ||
| 16.05.2014 | Steffen, Andi | IPG | „over-weekend“- culture pORE-E3 | Culturing JM109 bacteria cells containing pORE-E3 (250 µM from Glystock) in 10 ml LB media including 10 µM Kanamycin (Stock?) over weekend at 27 °C |
