"
Team:Imperial/EColi
From 2014.igem.org
E. coli
Overview
Escherichia coli is the organism of choice for synthetic biology. It is thoroughly characterised, easy to engineer and has numerous parts, control circuits and complex constructs tested in this host.
Some E. coli strains have evolved to produce low amounts of cellulose but the machinery under specific regulatory control (its secretion is generally linked to biofilm formation and stress situations). In order to expand the use of bacterial cellulose as a functional biomaterial that is cost effective to produce, it is desirable for its production machinery to be implemented in an organisms that is easy to engineer and has proven success in large scale bioreactors.
Here, we confirm that the high output cellulose production machinery of Gluconacetobacter Xylinus can be transferred into other organisms. We have proven function of the Acs cellulose producing operon in Escherichia coli using Congo Red binding assays.
Key Achievements
- Contributed an optimised Asc cellulose production operon to Registry of Standard Parts.
- Proved the portability of Gluconacetobacter xylinus operon.
- Assembled a fully synthetic, functional, cellulose-producing system in Escherichia coli
- Demonstrated the synthesis operon in a two plasmid system for separate induction of genes
Aims
By transferring the cellulose production operon from its native organism Gluconacetobacter xylinus into the lab and industrially friendly host Escherichia coli, we aim to improve cellulose production per unit time to achieve more cost effective pellicle growth and to encourage further synthetic biology with microbial cellulose. E. coli grows considerably faster plus tolerates higher temperatures and more vigorous aeration. The ease of genetic engineering and the wealth of other characterized Biobricks increases the potential for exciting future projects
Engineering
The cellulose production operon in Gluconacetobacter xylinus is a 10kb genomic region, consisting of four main elements:
- acsAB, known as cellulose synthase, is made up of two domains: acsA being the catalytic domain, and acsB being the cyclic-di-GMP-binding domain. This modular enzyme requires the second messenger cyclic-di-GMP in order to carry out efficient catalysis.
- acsC codes for an oligomeric element that gets embedded in the extracellular membrane and allows transport of the growing polymer across the cell membrane into the extracellular environment.
- acsD is believed to be a non-essential element, although it is a key player in the control of cellulose crystallinity and required for maximal cellulose productivity.
The native operon is highly regulated at transcriptional, translational and post-translational levels. Cellulose production responds to a wide set of internal signals and environmental cues. The native ribosomal binding sites (RBS) are predicted to be weak by translation rate calculators (The Salis Lab RBS calculator and Postech UTR designer ). This is perhaps to reduce noise in gene expression (strong promoter, weak RBS is less noisy that weak promoter strong RBS). The promoter region has not yet been characterized in Gluconacetobacter xylinus, however.
The first step of our computational design engineering was to identify the coding sequences and extract them from NCBI. We removed some native regulation by codon-optimizing the sequences for expression in E.coli and replaced the native RBS’s with the strong B0034 sequence. The 6 base pairs either side of the B0034 RBS were edited with the Salis Lab RBS calculator design function to tune RBS strength output to better preserve the natural stoichiometry.
Finally, in order to allow for even more customizable fine-tuning of the system, the operon was divided and cloned into two separate expression vectors: the AcsAB element was cloned under the control of the inducible pBAD promoter contained within pSB1C3, a high copy plasmid that would contribute to higher expression of Cellulose Synthase. Alternatively, AcsC and AcsD, believed to be expressed at lower levels in G.xylinus, was put under the control of the pLAC promoter and was transferred into a low copy plasmid, pSB3K3 so as to maintain lower levels of expression. This approach provided the following advantages:
- Reducing the size of the final expression vector avoids complications during assembly and vector take-up, and it also prevents a large construct from becoming a burden for cell growth and vector propagation.
- By expressing the cellulose production machinery from two separate expression vectors, the following levels of control become available to us: the first being the changes in vector copy number, which directly affects gene expression levels throughout induction, and the second being the ability to activate the system using two different inducers. These key features of our system allow for a larger scope for fine-tuning and optimization of cellulose production levels.
With this approach, we allow for our system to be implemented in new range of hosts because a larger set of growth conditions, inducer concentrations and growth phases can be tested in order to achieve the required stoichiometry for the system to become functional.
In order to ease synthesis, the operon sequence was split into 4 fragments of similar sizes. We took advantage of the presence of two restriction sites: An NcoI present within the AcsAB sequence, and a PvuII site contained within AcsC. Furthermore, the BioBrick prefix and suffix were included and any additional sites removed elsewhere.
By standard cloning, these fragments could easily be put together to yield the following constructs:
Gene Designer served as a very useful tool for assembling constructs and predicting cloning outcomes before proceeding with the experimental procedure. Find above the plasmid maps of our resulting constructs, and refer to Materials and Methods for a deeper insight into the assembly process.
Materials and Methods
1.0 Cell Strains and Media Components
Escherichia coli strain DH10B were made chemically competent following a standard protocol and were used to clone the pSB-AraC-pBAD and pSB-LacI-pLAC elements. Additionally, High Efficiency chemically competent DH10B Escherichia coli were purchased from New England Biolabs for assembly of the Acs cellulose-producing operon, which was codon-optimized for expression in E.coli and synthesized by GeneArt. Both strains were grown overnight in liquid cultures (supplemented with specific antibiotics), or on semi-solid LB-Agar plates, provided with the specific antibiotic, as listed on the table below.
Luria Broth Miller (LB) and LB Agar were purchased from VWR, prepared using standard protocols and used throughout the experimental procedure. During characterization, Acs-containing strains were supplemented with 1% D-glucose, 0.1% Arabinose and 0.5mM IPTG.
| Plasmid name | Vector backbone | Antibiotic concentration (ug/ml) |
|---|---|---|
| pSB-AraC-pBAD | pSB1C3 | Chloramphenicol 50 |
| pSB-LacI-pLAC | pSB3K3 | Kanamycin 25 |
| pSB-AcsAB | pSB1C3 | Chloramphenicol 50 |
| pSB-AcsCD | pSB1C3 | Chloramphenicol 50 |
| pSB-AraC-pBAD-AcsAB | pSB1C3 | Chloramphenicol 50 |
| pSB-LacI-pLAC-CD | pSB3K3 | Kanamycin 25 |
2.0 Chemicals
Congo Red was purchased from Sigma Aldrich (Steiheim, Germany) and diluted in 1x PBS to a concentration of 350 uM. The final Congo Red concentration used during system characterization steps was 20 uM. This was also used, also at a concentration of 20 uM, to make LB Agar Congo Red Assay plates.
3.0 Construct Assembly
3.1 Cloning of pSB-AraC-pBAD
The AraC and pBAD elements were obtained by PCR, using the Biobricks BBa_K325108, BBa_K325218 and BBa_K325219 as DNA templates, all of which follow the standard structure showed on figure 7. The primers used during this procedure were as follows:
- Forward: TACTAGTAGCGGCCGCTGCAG
- Reverse: GCTAGCCCAAAAAAACGGGTATGGAG
The amplified elements were DpnI-treated following a standard procedure (New England Biolabs), and were subsequently submitted to a purification step (Qiaquick PCR clean up, Qiagen) prior to self-ligation. Three different template concentrations were tested during ligation (specifically 3 ng, 7.5 ng and 15 ng), and were incubated at room temperature for 1h+. The ligation mix was then transformed into chemically competent DH10B Escherichia coli using a standard chemical transformation protocol and plated out on Chloramphenicol-specific LB plates.
3.2 Cloning of pSB-LacI-pLAC
3.3 Assembly of AcsAB and AcsCD
The AcsABCD operon was designed in silico as described in the previous section. It was ordered for synthesis at GenArt in the form of four separate elements of similar sizes, named AcsA, AcsB, AcsC and AcsD, respectively. After synthesis, the constructs were directly transformed into DH10B E.coli using a standard chemical transformation protocol and plated overnight supplied with 50 ug/ml Kanamycin. 5ml LB were inoculated with a freshly growing colony and grown overnight at 37 C, under shaking conditions. Glycerol stocks were produced prior to proceeding with the assembly process.
In order to meet the Registry standards, we aimed to clone these elements into pSB1C3. To do so, we proceeded as described on figure 8. Two separate rounds of digestion were carried out using EcoRI, NcoI, PvuII and PstI to, and the resulting fragments (AcsA, AcsB, AcsC and AcsD and linearized pSB1C3) were submitted to a three-part ligation after dephosphorylation of the vector backbone (rAPid desphosphorylation, Roche). An equimolar ratio amongst all three parts was established during the ligation procedure, which in turn proceeded at 4 degrees overnight. The NEB High Efficiency Transformation protocol was used on NEB 10B cells (New England Biolabs) to propagate the resulting plasmid. Transformed cells were plated and incubated overnight at 37 C. 5 ml LB supplied with 50 ug/ml Chloramphenicol were inoculated with a selection of colonies for further analysis (refer to Results for additional information).
3.4 Assembly of pSB-AraC-pBAD-AcsAB
AcsAB was cloned into pSB-AraC-pBAD by Biobrick cloning. The destination vector was linearized using SpeI and PstI (New England Biolabs), and AcsAB (previously digested with XbaI and PstI, and gel extracted using the Minelute Gel Extraction Kit, by Qiagen) was ligated at a 1:1 ratio throughout an overnight ligation at room temperature. The resulting part was transformed into chemically competent DH10B Escherichia coli and plated on LB Agar+Chloramphenicol plates, grown overnight at 37 C. 5 ml LB falcons supplied with 50 ug/ml Chloramphenicol were inoculated with a selection of freshly grown colonies for further restriction analysis (refer to Results for additional information)
3.5 Assembly of pSB-LacI-pLAC-CD
Similarly to 3.4, AcsCD was cloned by BioBrick cloning into the pSB3K3 low copy expression vector containing the LacI-pLAC regulatory elements. Vector and insert were ligated at a 1:1 ratio overnight at room temperature. After transformation and plating on LB Agar+Kanamycin (25 ug/ml), colonies were screened by Greentaq colony PCR, and were further confirmed during the Congo Red Assay.
Electroporation of pSB-pLAC-CD into electrocompetent AcsAB-containing DH10B cells
DH10B E.coli already containing the AcsAB construct were made electrocompetent using a standard protocol, which can be found in the Protocols section. A second round of transformation was carried to insert pLAC-AcsCD. 5ul of miniprepped pSB-pLAC-CD (diluted in ddH2O) were added into 50ul electrocompetent DH10B cells already containing the pBAD-inducible AcsAB element. Electroporation was carried out in in 10mm electrocuvettes at 1.8 kV, 200 Ohm resistance and 25 mF capacitance. 500ul SOC medium was added to the electroporated samples and these were recovered at 37 °C for 1h before plating on Kanamycin25 + Chloramphenicol 50 LB Agar plates.
Congo Red Characterization
LB Agar Congo Red assay plates were prepared with a final Congo Red concentration of 20uM, and they were supplied with 0.1% Arabinose, 0.5mM IPTG, 50 ug/mL Chloramphenicol, 25 ug/mL Kanamycin and 1% Glucose. Transformed cells containing both AcsAB and AcsCD were plated on Congo Red assay plates and incubated at 37 °C. They were qualitatively assayed after 24h and 48h for cellulose production. Finally, 5 mL LB supplied with 0.1% Arabinose, 0.5mM IPTG, 50 ug/mL Chloramphenicol, 25 ug/mL Kanamycin and 1% Glucose were inoculated with freshly grown, cellulose-producing colonies and were grown for 16h at 30 °C, 180 rpm. An empty vector control was also grown overnight for comparative analysis. These liquid cultues were supplied with Congo Red, to yield a final concentration of 20uM. They were incubated under static conditions for 2h at room temperature, and were later pelleted down to allow for qualitative analysis of Congo Red binding.
AcsAB functionality was assayed by inducing AcsAB-containing cells with 0.1% Arabinose in 5mL LB supplied with 1% Glucose and Chloramphenicol. Overnight incubations were set up at 30 °C and 37 °C, and both empty vector controls and un-induced controls were also assayed. Cells were pelleted at 4000rpm for 10 minutes and the supernatant was kept for further analysis. Cells were resuspended in 1xPBS and sonicated for 3 minutes as on/off cycles of 15 seconds. Both the membrane and soluble samples produced after centrifugation were kept for further analysis. Congo Red was then added to the LB, soluble and membrane samples up to a final concentration of 20uM, and no Congo Red samples were also kept for further inspection. Samples were incubated for 2h at static conditions and at room temperature to allow for Congo Red binding. 96-well plates were inoculated for further absorbance measurements at 490nm.
Results
Constructs
All constructs were assembled as described in Materials and Methods. As a preliminary verification step, restriction analyses were carried out using the corresponding restriction enzymes (refer to figure legends for more details) and results were visualized on 0.7-1% agarose gels. Final confirmation was obtained by gene sequencing, during which the BioBrick Verification Primers and walking primers were used. These are shown on the table below, please refer to the Registry for further information.
| pSB-AraC-pBAD | Forward: TACTAGTAGCGGCCGCTGCAG
Reverse: GCTAGCCCAAAAAAACGGGTATGGAG |
| BioBrick Verification Primers | Forward: TGCCACCTGACGTCTAAGAA
Reverse: ATTACCGCCTTTGAGTGAGC |
| Walking Primer 1 | TCT GAA TTA TGC CAT TGG TCA TAC CG |
| Walking Primer 2 | ATA TGT TTC ATG CAG TTG GCA CC |
| Walking Primer 3 | GAT GCA TGG GTT GAT TGG GG |
| Walking Primer 4 | ATC CAG CAC ATC CGA CCT TTG |
| Walking Primer 5 | GTT ACC GCA AGT AAA CTG CAA G |
| Walking Primer 6 | GAT GGT CTG ATT CGT CTG GTT A |
| Walking Primer 7 | ACG CAG CAC AGG TCA GAC CGG TGA A |
| Walking Primer 8 | ATA TTG ATC TGA CCA CCG AACA |
| Walking Primer 9 | TGC ACC GCC TGG TGA AAA TGG TT |
| Walking Primer 10 | GTG GCT ATG CAA TTC AGA CAG GT |
| Walking Primer 11 | TTC ATT CCC AGC GGT CGG TCG AT |
| Walking Primer 12 | GTT TGC GTG GTG ATC TTT TT |
Characterising Cellulose Production
Future Work
References
