Team:BYU Provo/Parts

From 2014.igem.org

Revision as of 00:48, 5 October 2014 by Jberg17 (Talk | contribs)


BYU 2014 Team Parts



Click here to edit this page!

Home Team Official Team Profile Project Parts Modeling Notebook Safety Attributions

Parts Submitted to the Registry

What information do I need to start putting my parts on the Registry?

An important aspect of the iGEM competition is the use and creation of standard biological parts. Each team will make new parts during iGEM and will submit them to the Registry of Standard Biological Parts. The iGEM software provides an easy way to present the parts your team has created. The "groupparts" tag will generate a table with all of the parts that your team adds to your team sandbox.

Note that if you want to document a part you need to document it on the Registry, not on your team wiki. Future teams and other users and are much more likely to find parts on the Registry than on your team wiki.

Remember that the goal of proper part documentation is to describe and define a part, so that it can be used without a need to refer to the primary literature. Registry users in future years should be able to read your documentation and be able to use the part successfully. Also, you should provide proper references to acknowledge previous authors and to provide for users who wish to know more.

When should you put parts into the Registry?

As soon as possible! We encourage teams to start completing documentation for their parts on the Registry as soon as you have it available. The sooner you put up your parts, the better recall you will have of all details surrounding your parts. Remember you don't need to send us the DNA to create an entry for a part on the Registry. However, you must send us the sample/DNA before the Jamboree. Only parts for which you have sent us samples/DNA are eligible for awards and medal requirements.

The information needed to initially create a part on the Registry is:

  1. Part Name
  2. Part type
  3. Creator
  4. Sequence
  5. Short Description (60 characters on what the DNA does)
  6. Long Description (Longer description of what the DNA does)
  7. Design considerations

We encourage you to put up much more information as you gather it over the summer. If you have images, plots, characterization data and other information, please also put it up on the part page. Check out part BBa_K404003 for an excellent example of a highly characterized part.

You can add parts to the Registry at our Add a Part to the Registry link.

2014 BYU iGem Parts Database
Part NameiGem Database Part IDGrose Lab Part IDPart typeCreatorSequenceDescriptionDesign considerations
Amylase Forward Primer (Signaling Sequence) BI347 Primer Jordan Berg ccctctagatgatccgcgcgagcaggggaaattgac ggaaaacctataccggccagcaacagg This is the first half of the forward primer used for overlap extension PCR for the alpha amylase BBa_K1195001 gene with a signaling sequence. This primer contains a ccc spacer, XbaI restriction site and, start codon, and then the first 52 base pairs of the signaling sequence.
Amylase Reverse Primer (Signaling Sequence) BI373 Primer Jordan Berg AAC AGC GTG GGA TTA CGC ATA TGA ATT TAC TGC GGC TGC TTA CGG CAT TCC TGT TGC TGG CCG GTA TAG G This is the reverse portion of the Signaling sequence forward primer to be used for extension overlap PCR for alpha Amylase BBa_K1195001. It is the reverse complement of the last 50 base pairs of the signaling sequence and then the first 20 base pairs of the alpha Amylase gene.
Amylase Reverse Primer BI348 Primer Jordan Berg ccccactagtattaaatcacctcttcgataaccc This is the reverse primer for the alpha Amylase BBa_K1195001. It contains a ccc spacer, SpeI restriction site, and then the reverse compliment of the last 23 base pairs of the a-Amylase gene.
Amylase PstI Site-Directed Mutagenesis Primer 1 BI369 Primer Jordan Berg gtttgatgcgccgctccagatgaaattccat This is the first primer for the point mutation of the PstI site in the BBa_K1195001 alpha Amylase. It contains 15 base pairs from the gene on either side of the base pair that will be mutated. The original PstI restriction site is ctgcag. We have changed it for this primer so that the site now reads ctccag.
Amylase PstI Site-Directed Mutagenesis Primer 2 BI370 Primer Jordan Berg ATG GAA TTT CAT CTG GAG CGG CGC ATC AAA C This is the second primer for the point mutation of the PstI site in the BBa_K1195001 alpha Amylase. It contains 15 base pairs from the gene on either side of the base pair that will be mutated. The original PstI restriction site is gacgtc. We have changed it for this primer so that the site now reads gaggtc. This primer is the reverse compliment of the first primer for the point mutation of the PstI site in BBa_K1195001 alpha Amylase.
Alpha Amylase Forward Primer (TolB signaling sequence) BI402 Primer Jordan Berg CCCTCTAGATGCGTAATTTTTTGTATTGTACTGGTGTG TTTCTGTTGTTATGGATGAATACACCGCTACAA GCTGCTATGCGTAATCCCACGCTGAT This forward primer for Alpha Amylase is contains a ccc spacer, the XbaI restriction sites, the 69 bases that make up the signaling sequence of the N. eutropha TolB protein, and the first 20 bases of Alpha Amylase. This signaling sequence should also be compatible with N. europaea and N. multiformis.
Alpha Amylase with Signaling Sequence and PstI Site Removed Plasmid Jordan Berg Please refer to part description found at parts.igem.org for full sequence and plasmid schematic This is the alpha amylase taken from part BBa_K1195001. Attached to it is a TolB signaling sequence meant to all the gene product to be expressed extracellularly in N. multiformis in the break down of biofilm in wastewater treatment plants. Additionally, the PstI site originally found in the BBa_K1195001 part was removed using site-directed mutagenesis. The restriction site was changed from "CTGCAG" to "CTCCAG". This gene is located in the standard iGem pSB1C3 plasmid backbone.




Retrieved from "http://2014.igem.org/Team:BYU_Provo/Parts"