Team:Paris Bettencourt/Notebook/TMAU

From 2014.igem.org

Revision as of 09:19, 10 September 2014 by Psatin (Talk | contribs)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

@iGEM_Paris

Notebook

Trimethylaminuria

July

July 3rd

We made a PCR of our tmm gBlock using this protocol:

Reagent	Volume
	1X	4X
5X Phusion HF Buffer	20uL	80uL
10mM dNTPs	2uL	8uL
oPB.010 (forward primer)	1uL	4uL
oPB.012 (reverse primer)	1uL	4uL
DNA	1uL	4uL
DMSO	3uL	12uL
Phusion polymerase	1uL	4uL
Nuclease Free Water	71uL	284uL

We used this thermocycle:

	Temperature	Time
Start	98°C	30s
Cycle x35	98°C	10s
Cycle x35	52°C	30s
Cycle x35	72°C	30s
Finish	72°C	5min
Blind	10°C	-

After gel migration, we got this:

The PCR worked.

July 10th

1) Mini prep to extract plasmids (Qiagen)

I used this protocol. I made 2 tubes and got 163.2 and 242 ng/uL as concentrations.

2) Digestion of miniprep product with EcoR1 & Pst1

	Tube 1 (163ng/uL)	Tube 2 (242ng/uL)
pSB1C3 from miniprep	22uL	30uL
10X FD Buffer	5uL	5uL
PstI	2.5uL	2.5uL
EcoRI	2.5uL	2.5uL
NF Water	18uL	10uL

3) Gel migration

I had the digested pSB1C3 run on a gel using 0.5X TBE (2H-50V). We clearly saw a band at 2kb corresponding to pSB1C3. I cut the gel and stored it at 4°C.

July 11th

1) Gel purification of digested pSB1C3

I used this protocol

Result: I got concentrations of 59.6 and 55.1 ng/uL.

2) Ligation of digested tmm and digested pSB1C3

I used NEBiocalculator to calculate the mass of insert and vector I had to put (Insert length: 1488 bp, Vector length: 2037 bp, Vector DNA mass: 0,3 ug, Ratio insert:vector: 2:1). I need to put 450ng of insert and 300 ng of vector.

	Volume
Insert (tmm)	20uL of 10.1 ng/uL and 20uL of 13.7 ng/uL
Vector (pSB1C3)	5uL of 59.6ng/uL
T4 Ligase	3uL
T4 Ligase Buffer	6uL
NF Water	6uL

I incubated overnight at room temperature

July 12th

We transformed NEB and MG1655 with our ligation product according to this protocol

We finally had no colonies.

July 14th

July 15th

1) Gel extraction of pSB1C3 digested plasmid

I used this protocol. I finally got 2 tubes with 13.9 and 19.8ng/uL concentrations.

2) PCR purification

I purified the PCR product of July 14th using this protocol.

3) Ligation of tmm PCR product and pSB1C3

I used NEBiocalculator to to calculate the needed amount of insert and vector with the values:

Insert length: 1488 bp
Vector length: 2037 bp
Vector DNA mass: 50 ng
Ratio insert: I made 1 ligation of ratio 1:1, 2:1 and 3:1 (insert:vector).

I made the ligation with the 13.9 ng/uL concentrated insert tube. I used this protocol:

	1:1	2:1	3:1
Digested tmm (insert)	1.5uL	3uL	4uL
Digested pSB1C3 (vector)	4uL	4uL	4uL
T4 Ligase	1uL	1uL	1uL
T4 Ligase Buffer	4uL	4uL	4uL
Nuclease Free water	9.5uL	8uL	7uL

I incubated the tubes at 24°C for 30min.

4) Transformation into NEB and MG1655

I used the Heat Shock transformation protocol to transform NEB and MG1655 with each one of the ligation products with ratios 1:1, 2:1 and 3:1 (I got 6 plates).

July 16th

1) Results of the transformations

We got no colonies in MG1655, big and small colonies for 1:1 and 2:1 ratios and only big colonies with 3:1 ratios. I prepared 5 liquid cultures in LB+Chloramphenicol: 1 for each type of colony for 1:1 and 2:1 ratios, and 1 for big colonies for 3:1 ratio. I incubated them at 37°C.

2) PCR colony

To check if the colonies developped in my plates have tmm gene, I made a PCR with this protocol and I ran a gel. I got nothing on it. I will do miniprep and digestion on July 17th to identify tmm construct into pSB1C3.

July 17th

1) Miniprep using each liquid culture of NEB+tmm-pSB1C3

I used this protocol.

2) Digestion of the plasmids by EcoRI

Then I digested the miniprep product by EcoRI in order to get a linearised plasmid before running it on a gel.

Reagent	Volume
Nuclease free water	12uL
10X Fast Digest Buffer	2uL
plasmid DNA	5uL
EcoRI	1uL
TOTAL	20uL

I incubated the tubes at 37°C during 30min.

3) Gel

I ran on a gel each one of the tubes (small and big colonies from 1:1 and 2:1 ratios and big colony from 3:1 ratio). But the plasmids may have not been digested enough because I got many bands.

July 18th

I will try again to identify tmm gene in my transformed bacteria.

1) Digestion of plasmids with EcoRI and PstI.

This time I digested by EcoRI and PstI to be able to directly identify tmm gene on the gel. I nanodroped the miniprep product from 17th. We need 1ug of DNA for the digestion.

	Concentration (ng/uL, given by Nanodrop)	Needed volume (uL)
big 1:1 ratio colony	316.4	3.5
small 2:1 ratio colony	156.9	7
big 2:1 ratio colony	207.6	5
big 3:1 ratio colony	207.6	4

Digestion protocol:

Reagent	big 1:1 ratio colony	small 2:1 ratio colony	big 2:1 ratio colony	big 3:1 ratio colony
Nuclease free water	13.5uL	10uL	12uL	13uL
10X Fast Digest Buffer	2uL	2uL	2uL	2uL
plasmid DNA	3.5uL	7uL	5uL	4uL
EcoRI	0.5uL	0.5uL	0.5uL	0.5uL
PstI	0.5uL	0.5uL	0.5uL	0.5uL
TOTAL	20uL	20uL	20uL	20uL

1)Gel

I ran all the samples on a gel but I did not get the bands I expected. We have to try a new cloning.

July 22nd

I had prepared liquid cultures to be able to do minipreps.

1) Miniprep of liquid cultures to get pSB1C3

I used this protocol. The Nanodrop gave me a concentration of 317ng/uL.

2) Digestion of pSB1C3 and tmm PCR product by EcoRI and PstI.

pSB1C3:

Reagent Volume

Nuclease free water 25uL

10X Fast Digest Buffer 5uL

plasmid DNA 14uL

EcoRI 2.5uL

PstI 2.5uL

Fast AP (phosphatase) 1uL

TOTAL 40uL

tmm PCR product

Reagent Volume

Nuclease free water 27uL

10X Fast Digest Buffer 5uL

plasmid DNA 13uL

EcoRI 2.5uL

PstI 2.5uL

TOTAL 50uL

3)Gel

For pSB1C3 we can see two bands corresponding to 900bp and 2000bp (backbone) fragments. I will be able to extract the 2000bp fragment. But I got nothing for tmm.

4)Gel extraction

I used this protocol.

July 29th

We need tmm PCR product to be able to do a new cloning.

1) PCR of tmm gBlock

Reagent	Volume
	1X
5X Phusion HF Buffer	10uL
10mM dNTPs	1uL
oPB.010 (forward primer)	0.5uL
oPB.012 (reverse primer)	0.5uL
DNA	1uL
DMSO	1.5uL
Phusion polymerase	0.5uL
Nuclease Free Water	35uL

We used this thermocycle:

	Temperature	Time
Start	98°C	30s
Cycle x35	98°C	10s
Cycle x35	56°C for tube 1, 51°C for tubes 2 and 3	30s
Cycle x35	72°C	1min
Finish	72°C	5min
Blind	10°C	-

2) Gel

No bands were visible, even for the ladder. I tried a new one and got a few tiny bands for tube 3, particularly at 1500bp. I tried a gel extraction using this protocol and got 4.7ng/uL (unusable). I tried otherwise:

3) PCR purification

I puridied tube 3 according to this protocol and got a concentration of 11ng/uL which was not enough to do a digestion.

4) New PCR

Reagent	Volume
	1X
5X Phusion HF Buffer	10uL
10mM dNTPs	1uL
oPB.010 (forward primer)	0.5uL
oPB.012 (reverse primer)	0.5uL
DNA	1uL
DMSO	1.5uL
Phusion polymerase	0.5uL
Nuclease Free Water	35uL

We used this thermocycle:

	Temperature	Time
Start	98°C	30s
Cycle x35	98°C	10s
Cycle x35	55°C	30s
Cycle x35	72°C	1min
Finish	72°C	5min
Blind	10°C	-

3) PCR purification

I puridied tube 3 according to this protocol.

August

August 1st

1)Digestion of purified PCR product

Reagent	Volume
Nuclease free water	20uL
10X Fast Digest Buffer	20uL
plasmid DNA	7uL
EcoRI	0.5uL
PstI	0.5uL
TOTAL	50uL

I incubated the digestion at 37°C during 1h.

2) Purification of digested tmm

I used this protocol and got a really low concentration, unusable for ligation.

3) New PCR

I prepared 4 tubes according to this protocol:

Reagent	Volume
	1X
5X Phusion HF Buffer	10uL
10mM dNTPs	1uL
oPB.010 (forward primer)	0.5uL
oPB.012 (reverse primer)	0.5uL
DNA	1uL
DMSO	1.5uL
Phusion polymerase	0.5uL
Nuclease Free Water	35uL

We used this thermocycle:

	Temperature	Time
Start	98°C	30s
Cycle x35	98°C	10s
Cycle x35	51°C	30s
Cycle x35	72°C	1min
Finish	72°C	5min
Blind	10°C	-

4) Gel

Nothing was visible on the gel.

5) New PCR

Reagent	Volume
	1X
5X Phusion HF Buffer	20uL
10mM dNTPs	2uL
oPB.010 (forward primer)	5uL
oPB.012 (reverse primer)	5uL
DNA	1uL
DMSO	3uL
Phusion polymerase	2uL
Nuclease Free Water	53uL

We used this thermocycle:

	Temperature	Time
Start	98°C	30s
Cycle x35	98°C	10s
Cycle x35	50°C	30s
Cycle x35	72°C	45s
Finish	72°C	5min
Blind	10°C	-

6) Gel

There was a diffused band next to 200bp. Maybe there is a problem of specificity of the primers. We will try a PCR with the very first protocol which worked.

August 5th

1) PCR of tmm gBlock

Reagent	Volume
	1X
5X Phusion HF Buffer	20uL
10mM dNTPs	2uL
oPB.010 (forward primer)	1uL
oPB.012 (reverse primer)	1uL
tmm DNA	1uL
DMSO	3uL
Phusion polymerase	1uL
Nuclease Free Water	71uL

We used this thermocycle:

	Temperature	Time
Start	98°C	30s
Cycle x35	98°C	10s
Cycle x35	52°C	30s
Cycle x35	72°C	30s
Finish	72°C	5min
Blind	10°C	-

We still got nothing. We decided to design new primers.

August 6th

We think that that the reverse primer (oPB012) might have a strong secondary structure and that it may prevent the PCR to work as expected. We designed modified versions of oPB010 and oPB012 respectively called oPB056 and oPB057, shorter then the first ones. We removed the first restriction site at each end making sure the other enzyme would still have enough nucleotides to bind. We also shortened the bind part to have a melting temperature around 52°C.

oPB.010 TATAGAATTCGCGGCCGCTTCTAGAGCTGACAGCTAGCTCAGTCCTAG
-> oPB.056 CTTCTAGAGCTGACAGCTAGCTCAGTCC

oPB.012 TTAACTGCAGCGGCCGCTACTAGTATCAGTGGTGATGGTGATGATGGTTA
-> oPB.057 TACTAGTATCAGTGGTGATGGTGATGATG

Note:The digestion should now use XbaI and SpeI as EcorI and PstI were removed from the PCR product.

August 13th

We received our new primers (oPB.056 and oPB.057).

1) New PCR with different combinations or primers

We used this protocol:

Reagent	Tube 1	Tube 2	Tube 3	Tube 4
5X Phusion HF Buffer	20uL	20uL	20uL	20uL
10mM dNTPs	2uL	2uL	2uL	2uL
tmm DNA	10L	10L	10L	10L
DMSO	3uL	3uL	3uL	3uL
Phusion polymerase	2uL	2uL	2uL	2uL
Nuclease Free Water	53uL	53uL	53uL	53uL
oPB.010	5uL	-	5uL	-
oPB.012	5uL	-	-	5uL
oPB.056	-	5uL	-	5uL
oPB.057	-	5uL	5uL	-
TOTAL	100uL	100uL	100uL	100uL

We used this thermocycle:

	Temperature	Time
Start	98°C	30s
Cycle x35	98°C	10s
Cycle x35	52°C	30s
Cycle x35	72°C	30s
Finish	72°C	5min
Blind	10°C	-

Date 2

Text

September

Date 1

Text

Date 2

Text

October

Date 1

Text

Date 2

Text