Team:UCL/Lab AzoReducateCloning Portal

From 2014.igem.org

Revision as of 12:53, 29 May 2014 by Adamdenyer (Talk | contribs)

Goodbye Azo Dye : iGEM 2014 - University College London

 

BioBrick and Primer Design Two Azoreductase enzymes will be cloned from Bacilus subtilis (strain 168) and Pseudomonas Aeruginosa (PA01) using DNA PCR amplification. Suitable forward and reverse primers were designed for each enzymes using the following strategy. The protein coding sequences for each enzyme were obtained from ?. ATG TCT ACA GTT TTA TTT GTA AAA TCA AGC GAC CGT ACA GCT GAA GAA GGC GTT TCA ACT AAA CTT TAC GAA GCT TTC TTA GCT GCT TAT AAA GAA AAC AAC CCT AAT GAT GAA GTG GTT GAA TTA GAT CTT CAT AAG GAA AAC CTT CCT TAC CTT GGC AGA GAT ATG ATT AAC GGA ACA TTT AAA GCA GGT CAA GGA ATG GAA ATG ACA GAA GAT GAG AAA AAA CAA GCA GCA ATT GCT GAC AAA TAT CTG AAC CAG TTT GTA AAA GCT GAC AAA GTT GTT TTC GCA TTC CCG CTT TGG AAC TTC ACA GTG CCA GCA GTG CTT CAT ACT TAT GTT GAT TAT CTG TCT CGC GCA GGC GTT ACA TTC AAA TAC ACA CAA GAA GGA CCA GTC GGT TTA ATG GGC GGC AAA AAA GTT GCG CTT CTT AAC GCT CGC GGC GGT GTC TAC TCA GAA GGA CCA ATG GCT GCA CTT GAA ATG TCA TTA AAC TTC ATG AAA ACA GTT CTT GGT TTC TGG GGT GTT CAA GAC TTG CAC ACA GTT GTC ATC GAA GGA CAT AAC GCA GCA CCT GAT CAA GCG CAA GAA ATC GTT GAA AAA GGT TTA CAA GAA GCA AAA GAT CTT GCT GCA AAA TTC TAA The standard BioBrick prefix for protein coding sequences and suffix sequences used in Standard Assembly and belonging to BioBrick RFC 10 were appended to the forward and reverse primers respectively. BioBrick CDS Prefix 5' GAATTCGCGGCCGCTTCTAG '3 BioBrick Suffix 5' TACTAGTAGCGGCCGCTGCAG '3

Contact Us

University College London - Gower Street - London - WC1E 6BT - Biochemical Engineering Department
phone: +44 (0)20 7679 2000
email: ucligem2014@gmail.com

Follow Us

Tweets

back to top