Team:UCL/Lab AzoReducateCloning Portal

From 2014.igem.org

Revision as of 12:46, 29 May 2014 by Adamdenyer (Talk | contribs)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

Goodbye Azo Dye : iGEM 2014 - University College London

Skip to navigation
Skip to content

BioBrick and Primer Design

Two Azoreductase enzymes will be cloned from Bacilus subtilis (strain 168) and Pseudomonas Aeruginosa (PA01) using DNA PCR amplification.

Suitable forward and reverse primers were designed for each enzymes using the following strategy.

The protein coding sequences for each enzyme were obtained from ?.

The standard BioBrick prefix for protein coding sequences and suffix sequences used in Standard Assembly and belonging to BioBrick RFC 10 were appended to the forward and reverse primers respectively.

BioBrick CDS Prefix

5' GAATTCGCGGCCGCTTCTAG '3

BioBrick Suffix

5' TACTAGTAGCGGCCGCTGCAG '3

back to top