Transposon

Transposons, known as mobile elements or transposable elements, are DNA sequences able to move randomly within the genome. This phenomenon is based on different transposition mechanisms. One of them, the cut-and-paste mechanism, requires an enzyme named transposase. Transposases bind to the end of transposons sequences, which consist of inverted repeats and then catalyze the excision and insertion of the transposons into the genome.

Fig. 1 General transposon mechanism
1. The transposable element, surrounded by IS sequence is "cut-and-paste" from a locus to another thanks to the transposase (arrow). 2. Insertion of the transposon occurs randomly in the genome

Transposase Tn10 / IS10

The complex Tn10/IS10 is involved in the non-replicative cut-and-paste mechanism. The transposable segment is excised at its ends and is then re-inserted randomly in a DNA site.

The Tn10 transposase protein is made of 402 amino-acids, which recognises inverted repeats insertion sequence; Is10-right and Is10-left. The Tn10 protein expression is strongly regulated by various positive and negative regulation mechanisms.

IS 10 is an insertion sequence composing the transposon Tn10. The two IS10 elements, IS10-Right and IS10-Left, contain all of the Tn10 encoded genetic determinants; as the coding region of the transposase protein Tn10. The two ends of IS-10 have a similar terminal inverted repeat of 23 bp, corresponding to the transposase binding site. However, some genetic drifts occurring between both of these sequences caused variation in their functionality. Indeed, IS10-right is fully functional while IS10-left is partially functional.

Our project

We tested different plasmids and methods to transform Pseudovibrio denitrificans but yet unsuccessfully. Thus, the integration in the genome was tested. Doctor Brian Jester gave us the pNK2 plasmid and DH5α pir cells. In fact, the plasmid pNK2 contains a particular origin of replication OriVR6Kgamma. This ORI VR6K gamma is controlled by the pi protein, which is encoded by the pir gene. Indeed, the pi protein allows the replication of the plasmid by binding a particular site in the ORI sequence. Hence, the oriVR6K gamma can only be replicated in a bacterial strain producing the pi protein. This ori was already used in the iGEM competition in 2009 by a french team. The gamma origin is adjacent to the pi protein binding site and other sites bounded by the host cell proteins involved in its own reproduction.

Fig. 2 Plasmid map of pNK2-CRPIIh
The plasmid is 6,356 bp long and annotated. It contains the transposase Tn10 and the origin of replication oriVR6K. The sequence including the antibiotic resistance cassette kanR, and the mGFP gene is surrounded by IS sites. Restriction sites used by the registry are encircled by red rectangle.

Insertion of transposon

1. Transformation Pseudovibrio denitrificans with pNK2
   
   We tested pNK2 by transforming Pseudovibrio denitrificans bacteria with the plasmid by electroporation. The selection of cells was performed in 1X marine broth medium supplemented with kanamycine 50µg/mL. In fact, Pseudovibrio denitrificans can grow on medium with kanamycine 25µg/mL. (Sensitivity to antibiotics)
   
   
   
2. Phenotypic verification
   
   
   
   Fig. 3 Image of Pseudovibrio denitrificans colonies in a petri dish containing kanamycin. Pseudovibrio denitrificans were previously transformed with the pNK2-CRPIIh plasmid.
   
   
   
   
   
   Fig. 4 Growth curve of Pseudovibrio denitrificans in M9 supplemented with casamino acids and 3% NaCl
   
   
3. Genotypic verification
   
   
   a) Amplification of transposon
   
   The kanamycin gene is included in the transposon sequence of pNK2 and we thus amplify this gene for our verification PCR.
   We successfully obtained an amplicon corresponding to the kanamycin gene in our transformed cells. Considering the plasmids are not able to be replicated in an other strain than pir cells, we assumed the amplification we obtained were from ADNg and not from plasmids.
   Fig. 5 Picture of an electrophorese gel samples come from the PCR which amplify the kanamycineR cassette. All clones have the insertion of teh transposon. The Control, Pseudovibrio denitrificans, do not the insertion as expected.
   
   As a first verification, we obtained this gel for 15 colonies of Pseudovibrio denitrificans.
   
   
   
   b) Sequencing of 16S
   
   The amplification of transformed cells' DNA with primers 16S, which amplify the sequence of the ribosome 16S, were purified and sent to sequencing.
   The sequence we obtained proves that we transformed actual Pseudovibrio bacteria with an integrated transposon.
   c) Amplification of specific sequence of Pseudovibrio denitrificans
   After the results of sequencing of Pseudovibrio denitrificans' genome, a sequence specific of this strain has been discovered.
   This sequence is the following (read of 1000 bp):
   
   
   GACGGTGTCATTGATCTGGATAATGTCAACGAGCAGACCGGATCTTATCAGTTTGTCGGTGATGATGGGTTTGATACGGCAGGGCGCAGTATCTCTTCAGCTGGTGATG
   TTGATGGTGATGGTAAGGATGATCTGCTCATCGGTGCTGCGAATGCTAATGGTAGTGGTGCCAACCAAGGATCCGCTTCAGGGGCTGCTTATCTGATGACGGCTTCTGCACTA
   GCAGCCGCTGATGCCGCTGACGGCACCACTGATGGTGTTATTGATTTGGGTAATGTCAATGAGCAGACTGGATCTTATCAGTTCAATGGTACAGAAGTAATGGACCAAGCCGG
   AACTCGTGTAACATCTGCAGGCGATGTGGATGGCGATGGCAAAGATGATGTCTTTATCAGCAGCATTTTTGCAGATGATGGCGGCTCCAGTTCTGGTGAAGCATATTTGCTGA
   CAGCTGCTGCTATGGCTTCAGCTGATGCCGCTGACGGCACTACTGACGGCATCATTGATTTGGACAATGTCAATGAGCAAACCAACTCTTATCAGTTTGTTGGCACCCAAGCA
   GATGACCTGGCCGGCATTGATATCTCAGCTGCTGGTGATGTTGATGGCGATGGCAAAAATGACTTCTTGATCGGTGCTCGGGCAGCAGATGGTGGCGGCGCTGGCTCGGGTGA
   GGCCTATCTGTTGACTGCAGCAGCACTTGCTTCAGCTGATGCAGCTGATGGCACCACTGATGGGATTATCGATCTAGATAATGTCAATGAGCAGACTAACTCTTATCAGTTCG
   TTGGTACGGAAGTTGGCGATGATGCGGGAATTAGCGTGTCATTTGTCGGTGATGTTGACAATGATGGTAAGGACGATCTGTTGATTGGTGCACGTAATGCTGACGGCGGTGGC
   TCCAACTCTGGTGAAGCCTATCTAATGTCTATTGCTTCACTGGCGACTGCTGATGCAGCTGATGGCACCATTGATGGTGTTATCGATTTGGAT
   
   
   
   d) Integration of transposons in Pseudovibrio denitrificans
   Here, we tried to proved that there was actually a random integration of the transposon in the strain's genome. To achieve this, we performed a reverse PCR.
   
   
   
   
   In order to verify both number and frequency of insertion per transformation we set up the following protocol:
   Thanks to the genome assembly we were able to digest the genomic DNA in silico and find a restriction enzyme that would not cut in our insert but cut enough times in the genome to be able to recircularize pieces of DNA.
   HindIII cuts (demande a cécile si tu peux elle a le tableau du coupage par les enzymes) which is enough to generate small fragment ready for religation.
   After the recircularization we looked for and enzyme that could cut in our insert but with the least number of knacks in the genome sequence in order to cut only once the circular DNAs.
   XbaI exhibits the lowest number of cut in the gene and does not cut our insert.
   With the relinearize fragment we can perform a PCR to find:
   How many bands appear ? A question which relates to the number of inserts in the genome. What is the size and numbers of bands between genomic DNA samples? A question which relates to potential discovery of favourable spots of integration in the genome and the randomness of the number of insertions in the genome.
   One clone clearly displayed numerous insertions, while the others having fewer bands tend to show band sof the same size, which could prefigure the existence of favourite spot, as can be seen in E.coli.
   With further experiments and sequencing run we will be able to precisely locate the insertions and the better define how many times an insertion event can occur at a given concentration of plasmid electroporated.
   
   
   The transformation of Pseudovibrio denitrificans has been verified by the study of its phenotype and its genotype. We therefore confirm the efficiency of the transposon system in our bacteria. c
   
   
   

   Creation of Transposon Plasmid

   The second part of our work consisted in introducing our construction in this plasmid. A problem we had to face though was the presence of biobrick restriction sites in our plasmid. We decided to modify our Transposon plasmid so it would no longer have those restriction sites.
   Here is the schema of our project.
   Our aim was to merged pSB1C3 and pNK2 into a single plasmid, in order to have a plasmid that would replicate in non-pir cells. Also, our goal was to have a plasmid matching the requirements of the biobrick format. Here we used the pSB1C3 plasmid as the backbone.
   To isolate the two plasmids it would be possible to digeste the merged plasmid with BglII and then extract by gel eletrophoresis our Transposon plasmid, which only contains the core elements needed for the transposition. Between the two transposable elements iS10 we will eventually integrate the biobrick prefix and suffix to be able to integrate any biobrick in a genome.
   
   As a first step, we have to amplify and assemble each element by the Golden Gate assembly method.
   
   1. Mutation of oRiVR6Kgamma The first issue we encountered was the presence of XbaI restriction sites in the OriVR6Kgamma sequence. Thus, before amplifying it with Golden Gate overhangs, we had to induce mutations in that site of the plasmid using PCR mutagenesis.
      pNK2 plasmid was amplified with primers allowing us to modify the XbaI site : 5' TCTAGA 3' en 5' ACTAGA 3'.
      After amplification of the plasmid, we purified the PCR products obtained and transformed several colonies we got. Many colonies were inoculated in liquid cultures supplemented with kanamycin (50µg/mL) and the pNK2 plasmid was finally extracted. Those plasmids were digested by XbaI in order to verify the mutation of the XbaI site.
      1) Mutation of OriVR6Kgamma The initial Pnk2 plasmid is digested into three fragments by XbaI.
      
      The XbaI site successfully modified we obtained was used as the template of the origin of replication amplified for the Golden Gate and Biobrick. 2) Plasmid biobrick : Two biobricks were sent to the Registry. The first being the origin of replication oriVR6Kgamma and the second being the transposase Tn10. To obtain those biobricks into the pSB1C3 (RFC 92) plasmid, which contains the essential BsaI restriction site, we used the Golden Gate assembly method. White and red colonies grew on the plate. Red colonies contain the initial pSB1C3 plasmid bearing a mRFP gene. White cells could be either cells transformed with an empty vector or with our expected construction.
      
      
      
      Fig Picture of electrophoresis gel, samples come from pCR which amplify Tn10 and oriVR6Kgamma
      BBa_K1413041 orivr6kgamma
      BBa_K1413043 transposas Tn10
      
      3) Plasmid transposas : Each element of the plasmid transposas was amplified with Golden Gate overhangs.
      Fig Picture of electrophoresis gel of each elements of Transposon Plasmid
      Golden gate Golden Gate was performed with the pSB1C3 (RFC 92) plasmid. We then used the Golden Gate product to transform DH5α cells.
      Fig Picture of electrophoresis gel of Transposon plasmid isolated to pSB1C3
      

      References

      
      

      Bender, J., & Kleckner, N. (1988). Genetic Evidence That TnlO Transposes by a Nonreplicative Mechanism, 45, 801–815.
      Biology, C. (1996). Two Classes of TnlO Transposase Mutants That Suppress Mutations i n, (1972).
      Chalmers, R. M. (1995). Identification characterization pre-cleavage complex early transposition, 14(17), 4374–4383.
      Crellin, P., & Chalmers, R. (2001). Protein±DNA contacts and conformational changes in the Tn 10 transpososome during assembly and activation for cleavage, 20(14).
      Foster, T. J., Davis, M. A., Roberts, D. E., Takeshita, K., Kleckner, N., & Laboratories, T. B. (1981). Genetic Organization of Transposon TnlO,23(January), 201–213.
      Humayun, S., Wardle, S. J., Shilton, B. H., Pribil, P. a, Liburd, J., & Haniford, D. B. (2005). Tn10 transposase mutants with altered transpososome unfolding properties are defective in hairpin formation. Journal of Molecular Biology, 346(3), 703–16. doi:10.1016/j.jmb.2004.12.009
      Ross, J. a, Wardle, S. J., & Haniford, D. B. (2010). Tn10/IS10 transposition is downregulated at the level of transposase expression by the RNA-binding protein Hfq. Molecular Microbiology, 78(3), 607–21. doi:10.1111/j.1365-2958.2010.07359.x
      R. (2010). Recent advances in the Biodegradation of Phenol: A review, 1(2), 219–234.
      J.C Blouzard, O. Valette, C.Tardif, P. de Philipp (2010) Random Mutagenesis of Clostridium cellulolyticum by Using a Tn1545 Derivative, applied and environmental microbiology,