"
Team:Hong Kong HKUST/pneumosensor/results
From 2014.igem.org
Pneumosensor Results
Detection Module
Overview
|
The two-component regulatory system in S. pneumoniae, consisting of the receptor ComD and its response regulator ComE was to be used in detecting the autoinducer molecule, competence-stimulating peptide (CSP) and so detect S. pneumoniae populations correspondingly. The activity of the comCDE operon promoter (PcomCDE) is induced by phosphorylated ComE. In order to facilitate characterization of PcomCDE, we use the phosphorylmimetic ComE mutant, ComED58E, in the pKHS plasmid which was kindly sent to us by Martin et al., from the Université de Toulouse. The characterization of PcomCDE is for the purpose of linkage to the σx promoters module by regulating expression of the sigma factor. |
Construct
|
Bacterial Strain ComD Tag Protein We engineered in a FLAG protein tag in the 3’ end of ComD by including the sequence in comD extraction primer. comD forward primer: TCTGGAGAATTCGCGGCCGCTTCTAGATGGATTTATTTGGATTTGGGACGG [6’cap][20’ RFC10 prefix][25’ Streptoccocus pneumoniae/NCTC7465/comD] comD reverse primer with FLAG tag: GCCGGACTGCAGCGGCCGCTACTAGTATTATTACTTGTCGTCATCGTCTTTGTAGTCTCATTCAAATTCCCTCTTAAATCTAATGAT [6’ cap][21’ RFC10 suffix][6’ reverse complement stop codon][25’ reverse complement FLAG protein ][30 reverse complement Streptoccocus pneumoniae/NCTC7465/comD] comD sequence contained two illegal EcoRI sites, so we designed a set of partially overlapping primers for site-directed mutagenesis: 1st site Mutagenesis forward primer: GACCTTCTTTGCAATGAACTCTCATAAAG 1st site Mutagenesis reverse primer: CCATTTGAACTTTATGAGAGTTCATTGC 2nd site Mutagenesis forward primer: GAAACAGTTATTGTGATTCAAAATTCATG 2nd site Mutagenesis reverse primer: CGTCATTTTACATGAATTTTGAATCAC However, site-directed mutagenesis attempts were unsuccessful, so the gene was extracted in three parts using (i) comD forward primer & 1st site mutagenesis reverse primer; (ii) 1st site forward primer & 2nd site reverse primer; (iii) comD reverse primer & 2nd site mutagenesis forward primer. The two fragments were then ligated with the pSB1C3 backbone through Gibson Assembly. comE (BBa_K1379051) comE was extracted from pKHS-comE kindly sent to us by Dr. Don Morrison (Université de Toulouse, UPS, Laboratoire de Microbiologie et Génétique Moléculaires). Extraction was done using the following primers: comE forward primer: TCTGGAGAATTCGCGGCCGCTTCTAGATGAAAGTTTTAATTTTAGAAGATG [6’ cap][20’ RFC10 prefix][25’ Streptoccocus pneumoniae/NCTC7465/comE] comE reverse primer: GCCGGACTGCAGCGGCCGCTACTAGTATCACTTTTGAGATTTTTTCTCTAA [6’ cap][21’ RFC10 suffix][24’reverse complement Streptoccocus pneumoniae/NCTC7465/comE] comE sequence contained an illegal SpeI site, so we designed a set of overlapping primers for site-directed mutagenesis: Mutagenesis forward primer: CGCTATTATCGTCTTTATCACTAGCCGATCAGAGTTTGCGACTCTAAC Mutagenesis reverse primer: GTTAGAGTCGCAAACTCTGATCGGCTAGTGATAAAGACGATAATAGCG However, site-directed mutagenesis attempts were unsuccessful, so the gene was extracted in two parts using (i) comE forward primer & mutagenesis reverse primer; (ii) comE reverse primer & mutagenesis forward primer. The two fragments were then ligated with the pSB1C3 backbone through Gibson Assembly. PcomCDE The promoter region of the comCDE operon only contains 67bp. By estimating the position of the transcription start site of PcomCDE, the total size of the promoter region should be 89bp. We obtain the promoter region by oligo annealing. In designing the forward and reverse oligos, we added the XbaI cut site to the prefix and SpeI cut site to the suffix at the two ends of the oligos respectively. The backbone pSB1C3 was used. PcomCDE was ligated with GFP generator (BBa_E0240), which contains a RBS (BBa_B0032), GFP (BBa_E0040) and double terminator (BBa_B0015). The purpose of this construct is to measure the functionality of PcomCDE in the presence and absence of phosphorylated ComE by green fluorescence. BBa_E0240 was obtained from 2014 iGEM distribution kit. The bacterial strain of E.coli used was DH10B. We have tried to ligate PcomCDE with BBa_E0240, but unfortunately due to time limitation, we were not able to verify the sequence of our ligated products. PcomCDE forward oligo: CTAGAGAAAAAGTACACTTTGGGAGAAAAAAATGACAGTTGAGAGAATTTTATCTAAAACGAAATTCCATTTTGTATAATGGTTTTTGTAA GTTATA [6'XbaI prefix][89'PcomCDEregion][2'SpeI suffix] PcomCDE reverse oligo: CTAGTATAACTTACAAAAACCATTATACAAAATGGAATTTCGTTTTAGATAAAATTCTCTCAACTGTCATTTTTTTCTCCCAAAGTGTACTTT TTCT [6'SpeI suffix][89'PcomCDEregion][2'XbaI prefix] ComED58E The phosphorylmimetic comE mutant, comED58E was sent by Martin et al., the pKHS plasmid. pKHS is an expression vector, which contains a T7 promoter and kanamycin resistance gene. T7 promoter is induced by isopropyl β-D-1-thiogalactopyranoside (IPTG). |
S. pneumoniae σx Promoters Module
Overview
|
The activity of Com-Box promoter is turned on by a specific sigma factor that is produced by a regulatory gene comX. The σx will bind to the Com-Box promoter region and activate gene expression. σx serve as an inducer with high specificity as it binds to an area of several specific 8 base pairs (TACGAATA) on the Com-Box promoter. This σx-Com-Box system could be used as a highly specific reporting system in our S.pneumonia detection platform.
However in nature, ComX protein will be degraded by ClpXP enzyme which exists in E. coli and some other bacteria. Hence, to ensure the induction of Com-Box promoter by σx, ComW protein is needed as it functions to protect σx from being degraded by ClpXP. ComW protein will be degraded instead, increasing the amount of σx produced.
|
Construct |
σx Generator construct (BBa_K1379006) and comW construct
|
Backbone pSB1C3 was used for σx generator construct and comW construct. comX gene / comW gene were fused with BBa_K880005 which contains a constitutive promoter (BBa_J23100) and strong RBS (BBa_B0034). The purpose of this strong constitutive promoter and strong RBS is to unsure the large production of σx and ComW protein throughout time. Then, a double terminator (BBa_B0015) is fused with the promoter, RBS, and comX. BBa_K880005 and BBa_B0015 were obtained from 2014 iGEM distribution kit.
ComX Tag Protein We engineered a C-myc protein tag in the 3’ ends of comX by including the sequence in comX extraction primer. 3’ primer to extract comX with engineered C-myc tag gene sequence: GCCGGA CTGCAGCGGCCGCTACTAGTA TTATTA CAGATCCTCTTCTGAGATGAGTTTTTGTTC GTGGGTACGGATAGTAAACTCCTTAAACAC [6’ Cap] [21’ SpeI and PstI restriction site] [6’ terminator sequence] [30’ C-myc protein] [30' reverse complementary of 3’ comX] ComW Tag Protein We engineered a FLAG protein tag in the 3’ ends of comW by including the sequence in comW extraction primer.3’ primer to extract comW with engineered FLAG tag gene sequence: GCCGGA CTGCAGCGGCCGCTACTAGTA TTATTA CTTGTCGTCATCGTCTTTGTAGTC ACAAGAAATAAAACCCCGATTCATTACCAATT [6’ Cap] [21’ SpeI and PstI restriction site] [6’ terminator sequence] [24’ FLAG protein] [32' reverse complementary of 3’ comW] |
PcelA (BBa_ K1379002) and PcomFA (BBa_ K1379003) construct
|
Backbone pSB1C3 was used for PcelA and PcomFA construct. PcelA / PcomFA gene was fused with BBa_E0240, which contains a medium RBS (BBa_B0034), GFP (BBa_E0040) and double terminator (BBa_B0015). The purpose of this GFP generator is to indicate the functionality of PcelA and PcomFA in the presence and absence of σx. BBa_E0240 was obtained from 2014 iGEM distribution kit. The bacterial strain of E. coli used is DH10B.
PCelA / PcomFA gene Identifying the Possible Promoter Regions To date (12 Oct 2014), the core/minimal promoter region of PcelA has not yet been experimentally defined. In locating the promoter region required to initiate transcription, iGEM 2014 Hong_Kong_HKUST team attempted in making educated guesses based on relevant information available from the literature. The Com-Box promoter consensus sequence “TACGAATA” was BLASTed for targets in the Streptococcus pneumoniae genomes of strains R6, D39, ATCC7699 and NCTC7465 in the NCBI database. Genome of strain NCTC7465 was particularly given attention because its gDNA was available for manipulation. A list of loci with annotated genes returned. σx was known to turn on late competence gene and therefore loci containing any of those genes documented were favored and filtered for. Those loci were then manually checked for consensus among the 4 genomes mentioned above. A sequence of 67 base pairs stood out as a promising target because it was 1) upstream of a late competence genes celA (encodes competence protein CelA), and 2) was identical across the 4 genomes. This 67 bp region has varying upstream sequences and the potential promoter region can reach as far as 200bp. Different truncations (67, 100, 150, 180, 249, 300 bp) were planned for deciding the minimal promoter region, but in the course of construction, only the 100bp version could be finished in time. It was tested to be functional and therefore submitted as PcelA. PcelA and PcomFA gene were both cloned from the genomic DNA of S. pneumoniae strain NCTC7465 by PCR using Vent Polymerase. The difference between these two promoters is the whole sequence of PcomFA was obtained from Wellcome Trust Sanger Institute, a British genomics and genetics research institute. (https://www.sanger.ac.uk/) PcelA Forward primer: TTTCTGTCTAGAGTTGACCAAGGAAGACTATTTTGC PcelA Reverse primer: GCCGGACTGCAGCGGCCGCTACTAGTAATTTTCTCCTCTCTTAGATTATTCGTAAGAGG PcomFA Forward primer: TTTCTGTCTAGAGTGGACTTGGCCGTCCTCT PcomFA Reverse primer: GCCGGACTGCAGCGGCCGCTACTAGTAGACGTTCTTCTTCTGTTAATTCATTCTCAG |
Assembly and Characterization
|
Assembly |
Home |
Pneumosensor |
Riboregulator |
Human Practice |
Team |
WetLab |
Achievement |
