"
Team:Paris Bettencourt/Project/TMAU
From 2014.igem.org
Something Fishy
| BACKGROUND Trimethylamine (TMA) is naturally produced in the gut by the intestinal flora and it is degraded in the liver by an enzyme called FMO3. Trimethylaminuria (TMAU), commonly called Fish Odor Syndrom, is a rare genetic disease occurring in patients that have the fmo3 gene mutated. TMA is then excreted in sweat, saliva and urine, causing a strong fish odor. |
AIMS The tmm (trimethylamine monooxygenase) gene is found in the bacteria Ruegeria pomeroyi and it is similar to the human fmo3 gene. The aim of this project is to clone tmm into Corynebacterium striatum, a bacteria commonly found in the skin. This strain would be incorporated in a cosmetic cream in order to remove the fish odor in trimethylaminuria patients. |
RESULTS TMM activity was measured in TMM-expressing E.coli. |
| Aims and Achievement | Introduction | Results | Methods | References |
Aims and Achievement
Ruegeria pomeroyi, a bacteria member of the Rhodobacteraceae genus, produces an enzyme called trimethylamine monooxygenase thanks to the tmm(trimethylamine mono-oxygenase) gene. As FMO3, this enzyme degrades trimethylamine into trimethylamine-N-oxide but is adapted to a bacterial expression. The project aims at cloning tmm into E.coli and then into Corynebacterium striatum, one of the most common bacteria of the skin. The new strain would be integrated to the skin microbiome and would suppress the fish odor.
Introduction
Trimethylamine (TMA) is produced in the intestine by Desulfovibrio desulfuricans by fermentation of choline. In healthy patients, the fmo gene allows the degradation of TMA in the liver into a non-volatile compound, TMA oxide. But a mutation in the fmo3 sequence is most of the time the cause of TMAU: TMA is not degraded and is then excreted in sweat, saliva and urine leading to a strong fish odor. The patients are otherwise healthy but the disease affect their social relationships and can lead to depression. There is currently no cure for this metabolic disorder. Some treatments, often focused on restricting diet, tend to lower the symptoms.
Results
After cloning tmm into a Biobrick vector (pSB1C3), the construct was successfully expressed in E. coli. TMM activity was found in E. coli pSB1C3-TMM (tmm+) but not in E. coli pSB1C3 (tmm-). TMM does not only degrade trimethylamine into trimethylamine-N-oxide, but also converts indole into indigo. To measure the activity of TMM, the growth medium was supplemented with tryptophan, a precursor of indole, which is the substrate of TMM. After 14h of culture, cells were pelleted, washed twice with sterile water, resuspended in DMSO and sonicated. TMM activity was determined by measuring the absorbance spectrum of bacterial extractions. Peaks at 620 nm were found in tmm+ cultures supplemented with tryptophan, which was identified as indigo according to absorbance spectrum analysis.
Methods
tmm was cloned in a standard biobrick vector (pSB1C3) using XbaI and HindIII restriction sites. The set of primers used for PCR (Forward: CTTCTAGAGCTGACAGCTAGCTCAGTCC Reverse: TACTAGTATCAGTGGTGATGGTGATGATG) allowed us to use BLABLABLA as restriction enzymes. The vector and the PCR product were digested for 2h at 37°C and ligated 1h at 22°C, and overnight at 4°C using a 1:3 vector:insert ratio. Chemically competent NEB turbo strain of E.coli was transformed using Heat Shock transformation protocol. TMM does not only degrade trimethylamine into trimethylamine-N-oxide, but also converts indole into indigo. Thus, TMM-expressing E.coli are blue. Analytical digestion was performed using Thermo Scientific GeneJET Plasmid Miniprep Kit after overnight culture in LB/medium, digestion with BLA and BLABLA and electrophoresis using 0.5X TBE and 1% agarose gels. The presence of bands at 1.5kb (the length of tmm) confirmed the presence of tmm in the new strain. Another strain of E.coli was also created using pSEVA315 plasmid which is a shuttle vector that can be cloned in other genders of bacteria. Measurement of TMM activity was performed on TMM-expressing E.coli using the isolation of indigo protocol inspired of Choi H.S., Kim J.K et al. (2003).
References
- ref1- ref2
+33 1 44 41 25 22/25
paris-bettencourt-igem@googlegroups.com 
