Team:Paris Bettencourt/Notebook/Eliminate Smell

From 2014.igem.org

(Difference between revisions)

Revision as of 10:45, 20 August 2014

Paris Bettencourt 2014

Eliminate Smell

Notebook

June

June 11th

Goal: Design plasmids that express agaA construct

Procedure:

Using Geneious, we first created the agaA construct:

Promoter BBa_J23108 from the Anderson's promoter collection
RBS from the RBS Calculator of Salis lab specific for E coli
BioBrick Prefix + Scar from the iGEM Parts webpage
agaA sequence codon optimized for E coli 12 (IDT online tool). We checked with Generious that there were no restriction sites for EcoRI, SpeI, ZbaI and PstI.
Histidine tag: 6 Histidines in C-terminal were added
Stop codon
BioBrick scar + BioBrick suffix from the iGEM Parts webpage

To amplify this construct, we created two oligos:

Name	Sequence (5'->3')	Notes	Binding position
oPB.001	TATAGAATTCGCGGCCGCTTCTAGAGTGACAGCTAGCTCAGTCCTAGG	agaA forward for BioBrick vector	1->23
oPB.002-BAD PRIMER	GAAGCATCATCACCATCACCACTGATACTAGTAGCGGCCGCTGCAGTTA	agaA REVERSE for BioBrick vector- NOT REVERSED	1272->1296
oPB.005	TTAACTGCAGCGGCCGCTACTAGTATCAGTGGTGATGGTGATGATGCTTC	agaA reverse for BioBrick vector	1272->1296

* We noticed the 16/06/2014 that oPB.002 was NOT reversed and we designed oPB.005

Tip: When creating oligos: we add 4 nt at the beginning and the end composed by AT, to make sure the enzyme will bind properly.

We chose two backbones for the construct:

pSB1C3 from the iGEM Parts to create a BioBrick.
pEC-XC99E, a E coli-C glutamicum shuttle plasmid

We designed two plasmids:

1. pPB.001: Biobrick submission of agaA expression construct

1) Plasmid pSB1C3: High copy BioBrick assembly plasmid. Constitutive expression. To use in E coli

2) agaA construct

2.pPB.002:agaA expression construct. Shuttle vector E coli-C glutamicum

1) Plasmid pEC-XC99E modified: Ptrc (IPTG inducible promoter) and lacI will be removed by PCR. Primers will be oPB.003 -that includes a PstI site- and oPB.004 -that includes a XbaI site.

oPB.003	5'-CTGCAGATGCAAGCTTGGCTGTTTTGGCG-3'	PstI site + agaA forward for pEC-XC99E
oPB.004	5'-TCTAGACACCACCCTGAATTGACTCTCTTC-3'	XbaI site + aga reverse for pEC-XC99E

2) agaA construct

June 16th

Goal: Design new reverse oligo for Biobrick construction

Procedure:

We noticed oPB.002 was NOT reverse and therefore could not be used. We created oPB.005 instead:

oPB.005

5'-TTAACTGCAGCGGCCGCTACTAGTATCAGTGGTGATGGTGATGATGCTTC-3'

agaA reverse for BioBrick vector

1272->1296

June 23rd

Goal: PCR agaA gBlock with oPB.001 and oPB.005

Procedure:

We are going to PCR using the DreamTaq polymerase protocol the agaA gBlock with the forward primer oPB.001 and the reverse primer oPB.005. These two oligos include the BioBrick prefix and suffix. The aim is to add the prefix and suffix to the agaA sequence and amplify it.

We will set the parameters in the machine and run the reaction overnight.

June 24th

Goal: PCR purification of the gBlock

Procedure:

We will purify the PCR product -agaA gBlock that contains prefix-agaA-suffix- obtained on June 23rd following the QIAquick PCR purification kit standard protocol .

We will run a 1% agarose gel with the purified DNA following the standard protocol . Gels were made by Ihab and Antonio the 23rd of June following the same protocol.

Results

After running the gel, we exposed it in UV light. We could see the Gene Ruler, but there was no band in our sample.

We think that PCR did not work. Things to change:

Use fusion polymerase, as it is more reliable than the DreamTaq we used. DreamTaq is more for colony PCR.
Final concentration of 200 uL, to have more DNA
When PCR does not work we look at:
- Annealing temperature: we start typically at 52ºC and can go down to 50ºC.
- DMSO concentration: typically 3%. Avoids missmatching
- Extension time, according to the manufacturer

Goal:PCR agaA gBlock with oPB.001 and oPB.005

Procedure:

We are going to PCR using the Fusion Polymerase for the agaA gBlock with the forward primer oPB.001 and the reverse primer oPB.005. These two oligos include the BioBrick prefix and suffix. The aim is to add the prefix and suffix to the agaA sequence and amplify it.

June 25th

Goal: PCR purification of the gBlock

Procedure:

We will purify the PCR product -agaA gBlock that contains prefix-agaA-suffix- obtained on June 24th following the QIAquick PCR purification kit standard protocol .

We will run a 1% agarose gel with the purified DNA following the standard protocol . Gels were made by Ihab and Antonio the 23rd of June following the same protocol.

Results:

- 1st raw: Gene Ruler 100 kb + 1uL Loading Dye

- 2nd and 3rd raw: purified PCR products + 1 uL of Loading Dye per 5 uL of sample. We saw the samples did not sink properly in the hole, so we tried using more Loading Dye (raw 2 is tube A, raw 3 is tube B)

- 4th and 5th raw: 2 uL of Loading Dye for 5uL of sample (raw 4 is tube A, raw B is tube B)

We can see our construct around the 300 bp line, so we know is the gBlock.

Me measured the DNA in the samples using the Nanodrop.

- Tube A: 100 ng/uL

- Tube B: 55 ng/uL. This is a little low. It is an unexpected result considering that we pepared both tubes at the same time and following the same protocol.

June 26th

Goal: Obtain pPB.001 (agaA gBlock digestion + ligation)

Procedure:

We will digest the purified agaA gBlock following the Thermo Fast Digestion Protocol for enzimes EcoRI and PstI. Then we will ligate it with the linearized vector pSB1C3. We want to obtain pPB.001 and transform E coli.

Digestion

1) We will use tube A (100 ng/uL). We added 20 uL of water + 5 uL Buffer + 20 uL DNA + 2.5 uL EcoRI + 2.5 uL PstI. We digested longer than indicated, around 40 minutes, as we have used these enzymes before and work better this way.

2) Then we put it at 37ºC at the Isotemp for 5 min.

3) We will repeat for PSB1C3

These tubes were called Digested gBlock and Digested PSB1C3

Purification

4) We will purify both tubes using the QIAquick kit .

These tubes were called Dig + Pur gBlock and Dig + Pur PSB1C3

Ligation

Following the Thermo T4 DNA Ligase protocol . Instead of leaving the tube at 22ºC for 10 min, we left it at room temperature for 45 min.

5) We will make a ligation. We will make a 1:3 proportion for the gBlock:vector. We added 3,3 uL of the linearized vector [25 ng/mL] and 2,5 uL of the insert DNA [100 ng/mL].

Purification

6) We will purify the product using the QIAquick kit .

This tube was called pPB.001

Goal: Transform E coli with pPB.001

Procedure:

We will transform competent E coli that were previously made by Jake following his own protocol. We will use pPB.001 .

We will follow this Heat Shock protocol .

We will plate them in LBA+Cm. We will add 250 uL of Cm for 250 mL of LBA.

Results:

No colonies grew after 12h. We will leave them in the incubator some more time and repeat the Heat Shock in the meanwhile

June 27th

Goal: E coli transformation with pPB.001

Procedure:

Because the plates cultured on June 26th have no colonies after 12h, we have decided to repeat the heat shock transformation. The mistake might be that we are using Cloroamphenicol, and we did not recover them for enough time. We recovered them during 50 min in the thermocycler.

Today we have repeated the same Heat Shock protocol , but we have recovered them during 2h in the incubator. The cells used were a new stock from Jake's competent E coli. The plasmid used is pPB.001 .

Then we will plate them in LBA+Cm

Results:

We still have no colonies in the plates.

What might not work:

- Enzimes (EcoRI and PstI) work, as Ihab and Antonio have tested them. However I am cutting a linearized plasmid, so if their efficiency is not very high, they might not work for me.

- Ligase.

- Transformation. I doubt it

- Primers are not well designed

June 29th

Goal: Start culture to extract plasmid

Procedure:

We will start a culture to extract the plasmid PSB6A1 (Matt's stock, 2013). The aim is to cut a circularized plasmid with EcoRI and PstI and check their efficiency.

We cultured the cells in LBA+Amp at 37ºC

June 30th

Goal: Miniprep to extract a plasmid (unfinished)

Procedure:

We started a culture on June 29th. We will make a mini prep following the Mini Prep protocol. The aim is to extract the plasmid PSB6A1 to cut it with EcoRI and PstI and see the efficiency of the cut.

Results:

We have found out that Antonio and Ihab have already tested PstI and EcoRI. They seem to work quite specifically .

Also, they haven't managed to construct the plasmid, or do the Golden Gate assembly . We believe this is due to the Ligase and/or the Ligation buffer.

Therefore, we will use a new enzyme and buffer, ligate and transform.

Most enzymes from last year do not seem to work. We shoud not use them and wait for the new ones.

July

July 1st

Goal: PCR purification of the gBlock

Procedure:

July 1st

** pEC-XC99E plasmids (Cm) from the Beilfield iGEM team arrived today. We stored them at 37ºC and Pierre-Luc will make a miniprep tomorrow **

Goal: Obtain pPB.001

Procedure:

We will use the digested agaA gBlock and PSB1C3 obtained on June 26th .

Ligation

We will use a new Ligase from Promega (Jake's stock) for this experiment, as the former one (from iGEM's 2013 stock, Thermo) did not seem to work.

We will follow the Promega T4 DNA Ligase protocol. It is recommended to leave the tubes at room temperature for 3h but instead we did it for 2h.

We will make a 1:3 proportion for the gBlock:vector. We added 3,3 uL of the linearized vector [25 ng/mL] and 2,5 uL of the insert DNA [100 ng/mL].

Purification

We will purify the product using the QIAquick kit .

Tip: It is better to purify with water, as the Ligase might be sensitive to the Elution Buffer (EB), that has a lot of salts on it. Last time (June 26th), we did use the EB Buffer.

This tube was called pPB.001

Goal: Transform E coli with pPB.001

Procedure:

We will transform competent NEB turbo E coli made following the standard protocol . In step 5, we did not incubate them for 4 hours, but only until the density was optimal (around 30-45 min).

We will use pPB.001 .

We will follow this Heat Shock protocol .

Tip (From Matt): At the last step when we recover the cells, plate most of the 200 uL and leave the rest recovering overnight. Then plate them the next day.

We will plate them in LBA+Cm. We will add 250 uL of Cm for 250 mL of LBA.

Results:

We are still not able to transform the cells. We went back to check the primers, and the oPB.001 that we have in the database and the one we commanded are not the same.

We will re-do this process with the good oPB.001 when it arrives. At least now we have learnt all the techniques. Always re-check your plasmids, many times.

July 2nd

Goal: Miniprep to extract pSEVA351 + Glycerol stock

Procedure:

We recieved a tube that contains pSEVA351 (sent by the CSIC).We cultured it the night before, and extract a colony. We put a mixture of this colony + 5ml of LB medium in 2 different tubes.

We will let it grow overnight at 37ºC.

- Tube 1: miniprep following the standard protocol. This tube will be pSEVA351 and it is in my own stock.

- Tube 2 : glycerol stock: 250 uL of glycerol 60% + 750 uL of the culture. We will have both a -20ºC and -80ºC stock.

This is the vector we will use to construct pPB.003 .

July 11th

Goal: PCR of agaA gBlock with oPB.001 and oPB.005

Procedure:

We are going to PCR using the

Fusion Polymerase

for the agaA gBlock with the forward primer

oPB.001

(the good one this time!) and the reverse primer

oPB.005.

These two oligos include the BioBrick prefix and suffix. The aim is to add the prefix and suffix to the agaA sequence and amplify it.

July 12th and 13th

Goal: PCR purification of the gBlock

Procedure:

We will purify the PCR product -agaA gBlock that contains prefix-agaA-suffix- obtained on July 11th following the QIAquick PCR purification kit standard protocol .

We will run a 1% agarose gel at 50V with the purified DNA following the standard protocol .

The gel was put in a solution of Ethidium Bromide for 10 minutes.

Results:

-

1st raw:

Ready-to-use Gene Ruler (includes Loading Dye) 100 kb (5 uL)*

- 2nd raw: 5 uL purified PCR products + 1 uL of Loading Dye per 5 uL of sample (PCR product obtained the 11th of July and purified the 12th of July).

This is strange. I am confident that my PCR product is fine. I will repeat it with a different Gene

-

1st raw:

Ready-to-use Gene Ruler (includes Loading Dye) 100 kb (5 uL)*

- 2nd raw: 4uL Gene Ruler + 1 uL Loading Dye 100 kb*

- 3rd raw: 5 uL purified PCR products + 1 uL of Loading Dye per 5 uL of sample (PCR product obtained the 11th of July and purified the 12th of July).

*We used these two because Ready-to-Use seems not to work fine.

We see that it was the 'Ready-to-Use Gene Ruler' that did not work properly. Our PCR worked fine and our construct is about 300 bp. Even if this is not at all a good image, as we are only trying to check if the PCR runned properly I will not repeat it. We saw in the other gel that there is a clear band. In this gel we can see that this band is 300 bp.

Goal:Obtain pPB.001

Procedure:

We will digest the purified agaA gBlock following the Thermo Fast Digestion Protocol for enzimes EcoRI and PstI. Then we will ligate it with the linearized vector pSB1C3. We want to obtain pPB.001 and transform E coli.

We measured the purified aga gBlock in the nanodrop, the concentration was 50 ng/mL. This is low. I do not know if it is low because I am measuring the purification product instead of the direct PCR product.

Digestion

1) We added 20 uL of water + 5 uL Buffer + 20 uL DNA + 2.5 uL EcoRI + 2.5 uL PstI.

2) Then we put it at 37ºC at the Isotemp for 5 min.

This tubes was named Digested agaA gBlock

Purification

4) We will purify the tube using the QIAquick kit .

This tube was called Dig + Pur agaA gBlock

Ligation

We ligated Dig+Pur PSB1C3 (June 26th) and Dig+Pur agaA gBlock (July 12th)

Following the Thermo T4 DNA Ligase protocol . Instead of leaving the tube at 22ºC for 10 min, we left it at room temperature for 45 min.

5) We will make a ligation. We will make a 1:3 proportion for the gBlock:vector. We added 3,3 uL of the linearized vector [25 ng/mL] and 7 uL of the insert DNA [50 ng/mL].

The protocol says to leave the ligation for 10 min, but we left if for 20 min at room temperature. The tube is called Ligation pPB.001.

Goal: Transform E coli with pPB.001

Procedure:

We will transform competent E coli that were previously made by Jake following his own protocol. We will use pPB.001.

We will follow this Heat Shock protocol . We made two transformations (two tubes following the same protocol)

We will plate one of the tubes in an LBA+Cm plate. We will leave the other tube in the incubator overnight and plate it the day after. For each tube, we always plate 20 uL in one plate and 200 uL in another one.

Results:

On July 13th we can see what seems a colony in one of the plates. We will see tomorrow.

On July 14th we see colonies.

July 14th

Goal:Culture Corynebacterium glutamicum and Corynebacterium striatum

Procedure:

We will open the flask that arrived and culture Corynebacterium in Tryptophan Soy liquid medium at 37ºC overnight. After, we will plate them and culture single colonies to make competent cells and transform them. Corynebacterium glutamicum is sPB.006 and Corynebacterium striatum is sPB.007.

Goal:Obtain pPB.001 (Digest pSEVA351 + ligate with agaA gBlock)

Procedure:

We will digest pSEVA351 following the Thermo Fast Digestion Protocol for enzimes EcoRI and PstI. Then we will ligate it with the agaA gBlock. We want to obtain pPB.003 and transform Corynebacterium glutamicum and Corynebacterium striatum.

We measured the purified aga gBlock in the nanodrop, the concentration was 50 ng/mL. This is low. I do not know if it is low because I am measuring the purification product instead of the direct PCR product.

Digestion

1) We added 20 uL of water + 5 uL Buffer + 20 uL DNA + 2.5 uL EcoRI + 2.5 uL PstI.

2) Then we put it at 37ºC at the Isotemp for 5 min.

This tube was named Digested pSEVA351

Purification

4) We will purify the tube using the QIAquick kit .

This tube was called Dig + Pur pSEVA351

Ligation

We ligated Dig+Pur agaA gBlock (July 12th) and Dig+Pur pSEVA351(July 14th)

Following the Thermo T4 DNA Ligase protocol . Instead of leaving the tube at 22ºC for 10 min, we left it at room temperature for 45 min.

5) We will make a ligation. We will make a 1:3 proportion for the gBlock:vector. We added 3,3 uL of the linearized vector [25 ng/mL] and 7 uL of the insert DNA [50 ng/mL].

The protocol says to leave the ligation for 10 min, but we left if for 20 min at room temperature. The tube is called Ligation pPB.003.

July 16th

Goal: Colony PCR: Check pPB.001 transformation

Procedure:

Yesterday July 15th Juanma runned a colony PCR with oPB.001 and oPB.005 using the

Phusion Polymerase protocol

. Today we will run a 1% agarose gel with the purified DNA following the

standard protocol

.

Results:

There are no bands on the gel. This might happen with Colony PCR. To double-check, we will do a MiniPrep to extract pPB.001 and run a PCR with oPB.001 and oPB.005.

Goal:Make competent Corynebacterium

Procedure:

We will use the eppendorf protocol ( https://docs.google.com/file/d/0By8yVXC0fFVRMTlDd3BxQXM2Y1U/edit ) for making competent cells, but when growing them overnight, we will follow Haynes and Britz protocol (The effect of growth conditions of Corynebacterium glutamicum on the transformation frequency obtained by electroporation). We did this because its been proven that adding glycine to the medium overnight increases the electrotransformation efficiency. This is the different part of the protocol:

Procedure:

Cells were grown for approximately 18 h at 30ºC in a rotary shaker at 200 r.p.m. in 400 ml LB supplemented with kanamycin (50 pg ml-l) and glycine (2.5%).

July 17th

Goal:Check transformation of E coli with pPB.001 (MiniPrep + PCR + Gel)

Procedure:

MiniPrep

We will extract pPB.001 by making a MiniPrep of the 8 colonies following the standard protocol.

PCR

We will run a PCR with oPB.001 and oPB.005 following the Phusion Polymerase protocol . And we will run a 1% agarose gel with the purified DNA following the standard protocol .

Results:

Again, no bands.

Goal:Make competent Corynebacterium + Transform Corynebacterium with pSEVA

Procedure:

We will use the eppenforf protocol (https://docs.google.com/file/d/0By8yVXC0fFVRMTlDd3BxQXM2Y1U/edit)

Results:

There are a lot of colonies for sPB.007. In both plates. We will check that there is an insert. for that, we have started a culture (July 20th) and we will PCR it tomorrow.

July 18th

Goal:Check transformation of E coli with pPB.001

Procedure:

Using the MiniPrep we got on July 17th, we will do a digestion analysis: (Jake's recipe)

- 5 uL plasmid

- 2 uL Fast Digest Green (has LD in it)

- 1 uL NotI or EcoRI+PstI. We used EcoRI+PstI as it was impossible to find NotI.

- 13uL of H2O

(Final volume of 20 uL)

We will incubate for 15-30 min at 37ºC. Then we will run 10 uL (our Fast Digest Green buffer already has Loadyng Dye in it, so no need to add more) in an agarose 1% gel.

Results:

The gel is empty. We cannot even see the vector.

July 20th

Goal: Ligate pPB.001 + E coli transformation

Procedure:

Ligation

We will use the digested agaA gBlock and PSB1C3 obtained on June 26th .

We will follow the Thermo T4 DNA Ligase protocol . I think last ligation did not work because it was too hot in the lab. This time, I will leave the ligation product for 30 min in the dark room (20ºC).

E coli transformation

We will transform competent NEB turbo E coli made following the standard protocol . In step 5, we did not incubate them for 4 hours, but only until the density was optimal (around 30-45 min).

We will use pPB.001 obtained today.

We will follow this Heat Shock protocol .

Tip (From Matt): At the last step when we recover the cells, plate most of the 200 uL and leave the rest recovering overnight. Then plate them the next day.

We will plate them in LBA+Cm.

Results:

There were no colonies 48h after.

Date 2

Text

Text

August

Date 1

Text

Text

Date 2

Text

Text

September

Date 1

Text

Text

Date 2

Text

Text

October

Date 1

Text

Text

Date 2

Text

Text

Back to the top

Retrieved from "http://2014.igem.org/Team:Paris_Bettencourt/Notebook/Eliminate_Smell"

@@ Line 1,510: / Line 1,510: @@
 </br>
-<h5 id="date">July 1st</h5>
+<h5 id="date">July 14th</h5>
-<h6>Goal: PCR purification of the gBlock</h6>
+<h6>Goal:Culture <i>Corynebacterium glutamicum</i> and <i>Corynebacterium striatum</i></h6>
 </br>
 <h6>Procedure:</h6>
 </br>
+	<p>We will open the flask that arrived and culture Corynebacterium in Tryptophan Soy liquid medium at 37ºC overnight. After, we will plate them and culture single colonies to make competent cells and transform them. <i>Corynebacterium glutamicum</i> is sPB.006 and <i>Corynebacterium striatum</i> is sPB.007.
+</p>
+</br>
+<h6>Goal:Obtain pPB.001 (Digest pSEVA351 + ligate with agaA gBlock)</h6>
+</br>
+<h6>Procedure:</h6>
+</br>
+<div>
+    <br/>
+</div>
+<div>
+We will digest pSEVA351 following the    <a href="http://www.thermoscientificbio.com/uploadedFiles/Resources/fast-digestion-dna.pdf" target="_blank" shape="rect">Thermo Fast Digestion Protocol</a>
+    for enzimes <strong>EcoRI and PstI.</strong> Then we will ligate it with <strong>the agaA gBlock</strong>. We want to obtain
+    <a
+        href="https://www.evernote.com/Home.action#b=596d48d5-2edd-48b4-b5e9-dc81ce1b9aab&amp;st=p&amp;n=c411c8c1-73e6-4f3f-835c-edc7b8826530"
+        target="_blank"
+        shape="rect"
+    >
+        pPB.003
+    </a>
+    and transform <em>Corynebacterium glutamicum</em> and <em>Corynebacterium striatum</em>.
+    <br clear="none"/>
+    <div>
+        <br clear="none"/>
+    </div>
+    <div>
+        We measured the purified aga gBlock in the nanodrop, the concentration was 50 ng/mL. This is low. I do not know if it is low because I am measuring the
+        purification product instead of the direct PCR product.
+    </div>
+    <div>
+        <br clear="none"/>
+    </div>
+    <div>
+        <strong>Digestion</strong>
+    </div>
+    <div>
+        <br clear="none"/>
+    </div>
+    <div>
+) We added 20 uL of water + 5 uL Buffer + 20 uL DNA + 2.5 uL EcoRI + 2.5 uL PstI.
+    </div>
+    <div>
+        <br clear="none"/>
+    </div>
+    <div>
+) Then we put it at 37&#186;C at the Isotemp for 5 min.
+    </div>
+    <div>
+        <br clear="none"/>
+    </div>
+    <div>
+        This tube was named Digested pSEVA351
+        <br clear="none"/>
+    </div>
+    <div>
+        <br clear="none"/>
+    </div>
+    <div>
+        <br clear="none"/>
+    </div>
+    <div>
+        <strong>Purification</strong>
+    </div>
+    <div>
+        <br clear="none"/>
+    </div>
+    <div>
+) We will purify the tube using the
+        <a
+            href="https://www.evernote.com/Home.action?__fp=ZloDp4AdW-c3yWPvuidLz-TPR6I9Jhx8&amp;amp;username=iGEM-PB2014&amp;amp;login=true&amp;amp;_sourcePage=L90YhFqIo3HiMUD9T65RG_YvRLZ-1eYO3fqfqRu0fynRL_1nukNa4gH1t86pc1SP#b=60f448df-afb5-4a4d-9310-6dea624f7ab3&amp;amp;st=p&amp;amp;n=9dd0d893-9195-4ae2-9bbb-3748ecff72c9"
+            target="_blank"
+            shape="rect"
+        >
+            QIAquick kit
+        </a>
+        .
+    </div>
+    <div>
+        <br clear="none"/>
+    </div>
+    <div>
+        This tube was called Dig + Pur pSEVA351
+    </div>
+    <div>
+        <br clear="none"/>
+    </div>
+    <div>
+        <strong>Ligation</strong>
+    </div>
+    <div>
+        <br clear="none"/>
+    </div>
+    <div>
+        We ligated Dig+Pur agaA gBlock (July 12th) and Dig+Pur pSEVA351(July 14th)
+    </div>
+    <div>
+        <br clear="none"/>
+    </div>
+    <div>
+Following the        <a href="http://www.thermoscientificbio.com/uploadedfiles/resources/el001-product-information.pdf" target="_blank" shape="rect">Thermo</a>
+        <strong>
+            <a href="http://www.thermoscientificbio.com/uploadedfiles/resources/el001-product-information.pdf" target="_blank" shape="rect">
+                T4 DNA Ligase protocol
+            </a>
+            .
+        </strong>
+        Instead of leaving the tube at 22&#186;C for 10 min, we left it at room temperature for 45 min.
+    </div>
+    <div>
+        <br clear="none"/>
+    </div>
+    <div>
+) We will make a ligation. We will make a <strong>1:3</strong> proportion for the gBlock:vector. We added 3,3 uL of the linearized vector [25 ng/mL]
+        and 7 uL of the insert DNA [50 ng/mL].
+    </div>
+    <div>
+        <br clear="none"/>
+    </div>
+    <div>
+        The protocol says to leave the ligation for 10 min, but we left if for 20 min at room temperature. The tube is called Ligation pPB.003.
+    </div>
+</div>
+</br>
+<h5 id="date">July 16th</h5>
+<h6>Goal: Colony PCR: Check pPB.001 transformation</i></h6>
+</br>
+<h6>Procedure:</h6>
+</br>
+<p>
+    Yesterday July 15th Juanma runned a colony PCR with oPB.001 and oPB.005 using the
+</p>
+<a
+    href="https://www.evernote.com/Home.action#b=60f448df-afb5-4a4d-9310-6dea624f7ab3&amp;st=p&amp;n=9df680b8-ce02-4c4c-be03-91cdbc73224b"
+    target="_blank"
+    shape="rect"
+>
+    Phusion Polymerase protocol
+</a>
+<p>
+    . Today we will run a 1% agarose gel with the purified DNA following the
+</p>
+<a
+    href="https://www.evernote.com/Home.action?__fp=avuu_OOUw8I3yWPvuidLz-TPR6I9Jhx8&amp;username=iGEM-PB2014&amp;login=true&amp;_sourcePage=dd1SVp2N6cjiMUD9T65RG_YvRLZ-1eYO3fqfqRu0fynRL_1nukNa4gH1t86pc1SP#b=60f448df-afb5-4a4d-9310-6dea624f7ab3&amp;st=p&amp;n=228cf621-87a8-43ca-9aa9-7e11f82d83d0"
+    target="_blank"
+    shape="rect"
+>
+    standard protocol
+</a>
+<p>
+    .
+</p>
+</br>
+<h6>Results: </h6>
+</br>
+     There are no bands on the gel. This might happen with Colony PCR. To double-check, we will do a MiniPrep to extract pPB.001 and run a PCR with oPB.001 and oPB.005.
+</br>
+<h6>Goal:Make competent Corynebacterium</i></h6>
+</br>
+<h6>Procedure:</h6>
+</br>
+<div>
+    <strong> </strong>
+    We will use the eppendorf protocol (
+    <a href="https://docs.google.com/file/d/0By8yVXC0fFVRMTlDd3BxQXM2Y1U/edit" target="_blank" shape="rect">
+        https://docs.google.com/file/d/0By8yVXC0fFVRMTlDd3BxQXM2Y1U/edit
+    </a>
+    ) for making competent cells, but when growing them overnight, we will follow Haynes and Britz protocol (The effect of growth conditions of Corynebacterium
+    glutamicum on the transformation frequency obtained by electroporation). We did this because its been proven that adding glycine to the medium overnight
+    increases the electrotransformation efficiency. This is the different part of the protocol:
+    <br clear="none"/>
+</div>
+<div>
+    <br clear="none"/>
+</div>
+<div>
+    <em>Procedure:</em>
+</div>
+<div>
+    <em>
+        Cells were grown for approximately 18 h at 30&#186;C in a rotary shaker at 200 r.p.m. in 400 ml LB supplemented with kanamycin (50 pg ml-l) and glycine
+        (2.5%).
+    </em>
+    <strong>
+        <br clear="none"/>
+    </strong>
+</div>
+<div>
+    <em>
+        <br/>
+    </em>
+</div>
+</br>
+<h5 id="date">July 17th</h5>
+<h6>Goal:Check transformation of E coli with pPB.001 (MiniPrep + PCR + Gel)</i></h6>
+</br>
+<h6>Procedure:</h6>
+</br>
+<div>
+    <strong>MiniPrep</strong>
+</div>
+<div>
+    We will extract pPB.001 by making a MiniPrep of the 8 colonies following the
+    <a
+        href="https://www.evernote.com/Home.action?__fp=ZloDp4AdW-c3yWPvuidLz-TPR6I9Jhx8&amp;username=iGEM-PB2014&amp;login=true&amp;_sourcePage=L90YhFqIo3HiMUD9T65RG_YvRLZ-1eYO3fqfqRu0fynRL_1nukNa4gH1t86pc1SP#b=60f448df-afb5-4a4d-9310-6dea624f7ab3&amp;st=p&amp;n=7103fd59-762f-4792-bb1a-280f7b7af3a3"
+        target="_blank"
+        shape="rect"
+    >
+        standard protocol.
+    </a>
+</div>
+<div>
+    <br clear="none"/>
+</div>
+<div>
+    <strong>PCR</strong>
+</div>
+<div>
+    We will run a PCR with oPB.001 and oPB.005 following the
+    <a
+        href="https://www.evernote.com/Home.action#b=60f448df-afb5-4a4d-9310-6dea624f7ab3&amp;st=p&amp;n=9df680b8-ce02-4c4c-be03-91cdbc73224b"
+        target="_blank"
+        shape="rect"
+    >
+        Phusion Polymerase protocol
+    </a>
+    . And we will run a 1% agarose gel with the purified DNA following the
+    <a
+        href="https://www.evernote.com/Home.action?__fp=avuu_OOUw8I3yWPvuidLz-TPR6I9Jhx8&amp;username=iGEM-PB2014&amp;login=true&amp;_sourcePage=dd1SVp2N6cjiMUD9T65RG_YvRLZ-1eYO3fqfqRu0fynRL_1nukNa4gH1t86pc1SP#b=60f448df-afb5-4a4d-9310-6dea624f7ab3&amp;st=p&amp;n=228cf621-87a8-43ca-9aa9-7e11f82d83d0"
+        target="_blank"
+        shape="rect"
+    >
+        standard protocol
+    </a>
+    .
+</div>
+<div>
+</div>
+</br>
+<h6>Results:</h6>
+</br>
+<p>Again, no bands. </p>
+</br>
+<h6>Goal:Make competent <i>Corynebacterium</i> + Transform <i>Corynebacterium</i> with pSEVA</i></h6>
+</br>
+<h6>Procedure:</h6>
+</br>
+<p>     We will use the eppenforf protocol (https://docs.google.com/file/d/0By8yVXC0fFVRMTlDd3BxQXM2Y1U/edit) </p>
+</br>
+<h6>Results:</h6>
+</br>
+<p>There are a lot of colonies for sPB.007. In both plates. We will check that there is an insert. for that, we have started a culture (July 20th) and we will PCR it tomorrow.</p>
+</br>
+<h5 id="date">July 18th</h5>
+<h6>Goal:Check transformation of <i>E coli</i> with pPB.001 </h6>
+</br>
+<h6>Procedure:</h6>
+</br>
+<div>
+    <strong> </strong>
+</div>
+<div>
+    Using the MiniPrep we got on July 17th, we will do a <strong>digestion analysis: </strong>(Jake's recipe)
+    <br clear="none"/>
+</div>
+<div>
+    - 5 uL plasmid
+</div>
+<div>
+    - 2 uL Fast Digest Green (has LD in it)
+</div>
+<div>
+    - 1 uL NotI or EcoRI+PstI. We used EcoRI+PstI as it was impossible to find NotI.
+</div>
+<div>
+    - 13uL of H2O
+</div>
+<div>
+    <br clear="none"/>
+</div>
+<div>
+    (Final volume of 20 uL)
+</div>
+<div>
+    <br clear="none"/>
+</div>
+<div>
+    We will incubate for 15-30 min at 37&#186;C. Then we will run 10 uL (our Fast Digest Green buffer already has Loadyng Dye in it, so no need to add more) in
+    an agarose 1% gel.
+</div>
+</br>
+<h6>Results:</h6>
+</br>
+<p>The gel is empty. We cannot even see the vector.</p>
+</br>
+<h5 id="date">July 20th</h5>
+<h6>Goal: Ligate pPB.001 + <i>E coli<i> transformation</h6>
+</br>
+<h6>Procedure:</h6>
+</br>
+<div>
+    <strong>
+        Ligation
+        <br clear="none"/>
+    </strong>
+</div>
+<div>
+    <div>
+        We will use the digested agaA gBlock and PSB1C3 obtained on
+        <a
+            href="https://www.evernote.com/Home.action#b=596d48d5-2edd-48b4-b5e9-dc81ce1b9aab&amp;st=p&amp;n=db4278a7-4436-4a96-83c8-a23d6c57c65b"
+            target="_blank"
+            shape="rect"
+        >
+            June 26th
+        </a>
+        .
+    </div>
+    <div>
+        <div>
+            <br clear="none"/>
+        </div>
+        <div>
+We will follow the            <a href="http://www.thermoscientificbio.com/uploadedfiles/resources/el001-product-information.pdf" target="_blank" shape="rect">Thermo</a>
+            <strong>
+                <a href="http://www.thermoscientificbio.com/uploadedfiles/resources/el001-product-information.pdf" target="_blank" shape="rect">
+                    T4 DNA Ligase protocol
+                </a>
+                .
+            </strong>
+            I think last ligation did not work because it was too hot in the lab. This time, I will leave the ligation product for 30 min in the dark room
+            (20&#186;C).
+        </div>
+        <div>
+            <br clear="none"/>
+        </div>
+        <div>
+            <strong>E coli transformation</strong>
+        </div>
+        <div>
+            <div>
+                <div>
+                    We will transform competent NEB turbo E coli made following the
+                    <a
+                        href="https://www.evernote.com/Home.action#b=60f448df-afb5-4a4d-9310-6dea624f7ab3&amp;st=p&amp;n=b4939a60-0f83-446a-a111-39d63eb7589c"
+                        target="_blank"
+                        shape="rect"
+                    >
+                        standard protocol
+                    </a>
+                    . In step 5, we did not incubate them for 4 hours, but only until the density was optimal (around 30-45 min).
+                </div>
+                <div>
+                    <br clear="none"/>
+                </div>
+                <div>
+                    We will use
+                    <a
+                        href="https://www.evernote.com/Home.action#b=596d48d5-2edd-48b4-b5e9-dc81ce1b9aab&amp;st=p&amp;n=c359be34-a042-4d01-a0bd-ebb7b81f3166"
+                        target="_blank"
+                        shape="rect"
+                    >
+                        pPB.001
+                    </a>
+                    obtained today.
+                </div>
+                <div>
+                </div>
+                <div>
+                    We will follow this
+                    <a
+                        href="https://www.evernote.com/Home.action?__fp=ZloDp4AdW-c3yWPvuidLz-TPR6I9Jhx8&amp;username=iGEM-PB2014&amp;login=true&amp;_sourcePage=L90YhFqIo3HiMUD9T65RG_YvRLZ-1eYO3fqfqRu0fynRL_1nukNa4gH1t86pc1SP#b=60f448df-afb5-4a4d-9310-6dea624f7ab3&amp;st=p&amp;n=b48f12a9-a15f-45a2-a179-095516e07b3e"
+                        target="_blank"
+                        shape="rect"
+                    >
+                        Heat Shock protocol
+                    </a>
+                    .
+                    <br clear="none"/>
+                </div>
+                <div>
+                    <br clear="none"/>
+                </div>
+                <div>
+                    <em>
+                        <strong>Tip</strong>
+                        (From Matt): At the last step when we recover the cells, plate most of the 200 uL and leave the rest recovering overnight. Then plate
+                        them the next day.
+                        <br clear="none"/>
+                    </em>
+                </div>
+            </div>
+            <div>
+            </div>
+            <div>
+                We will plate them in LBA+Cm.
+            </div>
+            <div>
+                <br/>
+            </div>
+        </div>
+    </div>
+</div>
+</br>
+<h6>Results:</h6>
+</br>
+<p>There were no colonies 48h after.</p>
+</br>