Team:Valencia UPV/Notebook wetlab.html

Biosynthesis

06/09/2014

The enzymes involved in the biosynthesis pathways are AtrΔ11, HarFAR, FAO1, EaDAcT.

The design of the GBlocks was performed taking into account the following considerations:

• Codon optimization
• Inner restriction sites eliminations by finding synonymous mutations
• Addition of GB endings

06/10/2014

Codes for IDT known. MEGAGEM2014 - 25% off one order, up to 800 USD

GBlocks designed to be compatible with BioBricks and GoldenBraid (GB).

06/11/2014

We ordered the following gBlocks and primers.

• EaDAcT: Eunymus alatus (adapted for GB) 1127 bp
• HarFAR: Helicoverpa armigera (adapted for GB) 1400 bp
• AtrΔ11: Amyelois transitella (order primers for GB) 1000 bp
• I14Jun03 AtrΔ11 F1
• I14Jun04 AtrΔ11 R1
• FAO1: N. benthamiana primers
• I14Jun01 FAO1 F1
• I14Jun02 FAO1 R1

Name	Sequence	Lenght	Tm (NTI)	Tm (Phusion)
I14Jun01_FAO1_F1	cgccgtctcgctcgaatggagaaaaagagccatcc	35	49.9	62.4
I14Jun02_FAO1_R1	cgccgtctcgctcgaagcttatcttgagaatttgccttcttttatc	46	54.5	63.7
I14Jun03Atr_D11_F1	gcgccgtctcgctcgaatggttcctaataag	31	54.5	65.3
I14Jun04Atr_D11_R1	gcgccgtctcgctcgaagctcaacgtttc	29	57	69.1

06/24/2014

We thought which parts of the GB collection could we use.

Strategy 1:

• pP35S, pT35s (x2)
• pAtUbq10, pTAtHSP18.2

Strategy 2:

• pP35S, pT35s
• pP35s, pTAtHSP18.2
• pAtUbq10, pTAtHSP18.2

Strategy 3:

• pP35S, pT35s
• pP35s, pTTctp
• pAtUbq10, pTAtHSP18.2

Pieces to take from GB2.0 colection:

pDGB2α1	GB0483	Kan
pDGB2α2	GB0484	Kan
pP35s	GB0030	Amp
pT35s	GB0036	Amp
pAtUbq10	GB0223	Amp
pTAtHSP18.2	GB0035	Amp
pTTctp	GB0081	Amp
pUPD	GB0317	Amp

Later we will need:

pDGB2Ω1	GB0487	Smp
pDGB2Ω2	GB0488	Smp

Prepare plaques with antibiotics Kan, Spm, Amp

06/25/2014

Grow the selected pieces from the GB collection in liquid medium (performed in laminar air flow cabinet).

06/26/2014

Culture in agar Petri dish. 2 plaques: Amp and Kan.

Minipreps with EZNA Plasmid DNA MiniKit I.

Expected digestions:

pP35s	GB0030	NotI	Buffer: Orange	2981, 1105
pT35s	GB0036	NotI	Buffer: Orange	2981, 304
pAtUbq10	GB0223	NotI	Buffer: Orange	2981, 714
pTAtHSP18.2	GB0035	NotI	Buffer: Orange	2981, 328
pTTctp	GB0081	NotI	Buffer: Orange	2981, 487

Electrophoresis analysis.

We got the expected bands in all cases.

07/01/2014

AtrΔ11 amplification by PCR with primers that contain extra nucleotides to introduce them in the sequence.

We made a PCR amplification using the AtrΔ11 gene as a template and the oligos: R +F

Reagents needed:

• 32.5 μL of H2O miliQ
• 10 μL HF buffer
• 2 μL dNTPs
• 2.5 μL Reverse primer
• 2.5 μL Forward primer
• 1 μL template (AtrΔ11 gene)
• 0.5 μL phusion (polimerase)

PCR parameters: The annealing temperature was 60ºC and the extension temperature was 65ºC.

Electrophoresis performed to check the PCR product, which was expected to be around 1 kb.

pUPD ligation of EaDAcT, HarFar and AtrΔ11

Reagents needed for the reaction of ligation:

• 1 μL pUPD
• 1 μL PCR product/gblock product
• 1.2 μL buffer 10x
• 1 μL BsmBI
• 1 μL T4 ligase
• 6.8 μL H2O miliQ

Vfinal= 12 μL

Termocycler parameters: The ligase temperature was 16ºC and the BsmBI temperature was 37ºC.

As a result, there are obtained three different pUPD plasmids containing the genes EaDAcT, HarFAR and AtrΔ11.

07/02/2014

E. coli transformation. This step is performed in a laminar air flow cabinet (LAF). We have used an electrocompetent E. coli strain (DH5α) and a sample from each product of ligation made in the previous step (three pUPD plasmids, each of them containing one of the three genes), so transformation is made three times.

Reagents needed:

• E. coli aliquot
• 1.5 μL of ligation in pUPD (for each gene: EaDAcT, HarFAR, AtrΔ11)

Each mix is introduced in a electroporation vial and electroporated at 1500 V, then 300 μL of SOC are added to each vial. All of them were incubated at 37ºC for 1 hour.

After incubation, culture in Petri plates (always in a LAF).

2 cell-culture dishes per transformation (with Ampicillin), one with 50 μL and the other with the remaining volume.

Petri plates are incubated at 37ºC for 16 h.

07/03/2014

Transformed colonies selection. The white ones are recultured in liquid medium. One colony of each transformation is picked and cultured in 3.5 mL LB and 7 μL Amp. This step is repeated three times:

• 3x 1 colony of EaDAcT in pUPD + LB + Amp
• 3x 1 colony of HarFAR in pUPD + LB + Amp
• 3x 1 colony of AtrΔ11 in pUPD + LB + Amp

All tubes are incubated at 37ºC overnight in agitation.

07/04/2014

Digestions in silico using Vector NTI to check after minipreps if ligations are correct.

EaDAcT	NotI	2981, 1167
	RsaI	1876, 1343, 532, 306, 91
HarFAR	NotI	2981, 1440
	PvuII	2564, 1394, 463
AtrΔ11	NotI	2981, 1056
	BanII	2570, 803, 351, 314

Digestion reagents:

• 0.5 μL restriction enzyme
• 2.5 μL buffer
• 21 μL H20 (miliQ)
• 1 μL sample

Preparation of master mixes

• Master mix for NotI
• 5 μL NotI
• 25 μL Orange
• 210 μL H20
• Master mix for RsaI
• 1.5 μL RsaI
• 7.5 μL Tango
• 63 μL H20
• Master mix for PvuII
• 1.5 μL PvuII
• 7.5 μL Green
• 63 μL H20
• Master mix for BanII
• 1.5 μL BanII
• 7.5 μL Tango
• 63 μL H20

Perform electrophoresis to check if the size of the fragments from the digestions is correct.

Comments:

• We picked blue colonies instead of white by mistake. We need to pick colonies again but this time make sure we pick white colonies.
• For the repetition we must find another enzyme instead of BanII as we found out that it doesn't cut very well.

07/06/2014

We picked again 3 colonies for each construction, and we made sure that we picked the WHITE ones. We cultivated them in a "double check" (name invented by us) liquid medium. Those tubes contain:

• 3.5 mL LB
• 7 μL Amp
• 7 μL X-Gal
• 3.5 μL IPTG (turns the tube blue if the colonies picked were blue)

07/07/2014

We made minipreps of yesterday's culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes HarFAR 1, 2, 3; EaDAcT 3 and AtrΔ11 2, 3.

Once we had the minipreps, we perform the digestions to check which were correct and send them to sequencing. This time we selected RsaI instead of BanII. The in silico digestions were as follows.

EaDAcT	NotI	2981, 1167
	RsaI	1876, 1343, 532, 306, 91
HarFAR	NotI	2981, 1440
	PvuII	2564, 1394, 463
AtrΔ11	NotI	2981, 1056
	RsaI	1879, 1310, 467, 327, 54

Preparation of master mixes

• Master mix for NotI
• 3.5 μL NotI
• 17.5 μL Orange
• 147 μL H20
• Master mix for RsaI
• 2 μL RsaI
• 10 μL Tango
• 84 μL H20
• Master mix for PvuII
• 2 μL PvuII
• 10 μL Green
• 84 μL H20

We run the electrophoresis gel to check if this time we have done it correctly.

Everything was OK. We sent AtrΔ11 (3), HarFAR (3) and EaDAcT (3) to sequence.

07/08/2014

Now, while we wait for sequencing results, we go on as they were going to be correct in order to save time.

The next step is to build a transciptional unit (TU) with our sequences. A transcriptional unit is a structure composed by promoter, coding sequence (CDS) and terminator in an α or Ω vector.

Reagents needed for ligation:

• 1 μL promoter 75 ng/μL
• 1 μL terminator 75 ng/μL
• 1 μL CDS 75 ng/μL
• 1 μL vector α
• 1.2 μL ligase buffer 10x
• 1 μL T4
• 1 μL BsaI
• 4.2 μL H20

Total: 12 μL

Take into account that if we want to make binary constructions later (merge 2 TU in a same vector), we need to clone each TU in a different α vector.

Strategy Promoter-Terminator:

AtrΔ11	P35s	T35s	40.41
HarFAR	P35s	TatHSP	39.68
EaDAcT	PAtUbq	TatHSP	32.27

Adjust concentrations to 75 ng/μL for ligation reaction

Initial concentrations (nanodrop):

Piece	Concentrations	Volume	Volume of H20 to add
PAtUpb	442.6 ng/μL	34 μL	166.6 μL
pTatHSP	235.4 ng/μL	36 μL	77 μL
T35s	194.9 ng/μL	37.5 μL	60 μL
P35s	454.7 ng/μL	36 μL	182 μL
2α1	57.1 ng/μL	-	We will need to put 1.5 μL of this one
2α2	104.0 ng/μL	38 μL	14.7 μL
AtrΔ11	359.3 ng/μL	20 μL	75.8 μL
HarFAR	404.4 ng/μL	15 μL	65.9 μL
EaDAcT	155.6 ng/μL	10 μL	10.7 μL

Ligation reaction

• P35s:AtrΔ11:T35s in 2α1
• 1 μL P35s
• 1 μL T35s
• 1 μL AtrΔ11
• 1.5 μL 2α1
• 1.2 μL ligase buffer 10x
• 1 μL T4
• 1 μL BsaI
• 3.7 μL H20

• P35s:HarFAR:TatHSP in 2α2
• 1 μL P35s
• 1 μL TatHSP
• 1 μL HarFAR
• 1 μL 2α2
• 1.2 μL ligase buffer 10x
• 1 μL T4
• 1 μL BsaI
• 4.2 μL H20

• PAtUbq:EaDAcT:TatHSP in 2α2
• 1 μL PAtUbq
• 1 μL TatHSP
• 1 μL EaDAcT
• 1 μL 2α2
• 1.2 μL ligase buffer 10x
• 1 μL T4
• 1 μL BsaI
• 4.2 μL H20

07/09/2014

Transformation of constructions in E. coli

We finally got the sequencing results from 07/07/2014.

• Mutation in AtrΔ11 -> We threw away the colonies and transformed cells. We picked again white colonies.
• HarFAR -> Sequencing correct
• EaDAcT -> Synonim mutation in 601 (A -> T). This is a gBlock!

We took vectors 2Ω1 (GB0487) and 2Ω2 (GB0488) parts from the GB colection.

• Worked in the LAF
• Cultivated in a Petri dish with Spm
• Let them grow for one day

Cultivate transformated cells in two Kan plaques (Kan matches vector α)

• 50 mL transformation in one plaque
• Rest of the culture in another (250 μL aprox)
• Let them grow for one day

07/10/2014

Pick colonies and grow them in liquid medium.

• 6 from AtrΔ11 (repetition because of mutation)
• 3.5 mL LB
• 7 μL Amp
• 7 μL X-gal
• 3.5 μL IPTG
• 1 colony from 2Ω1
• 3.5 mL LB
• 7 μL Spm

• 1 colony from 2Ω2
• 3.5 mL LB
• 7 μL Spm
• 3 colonies from P35s:HarFAR:TatHSP
• 3.5 mL LB
• 7 μL Kan
• 3 colonies from PAtUbq:EaDAcT:TatHSP
• 3.5 mL LB
• 7 μL Kan

Grow at 37ºC in agitation overnight.

We have checked the promoters and terminators are both compatible with GB and BioBricks.

Only P35s and T35s work for both. pPnos could also work.

Pick 3 colonies of P35s:HarFAR:THsp and PAtUbq:EaDAcT:THsp. Culture in liquid medium with Kan.

07/11/2014

We made minipreps of yesterday's liquid culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes AtrΔ11 3 and 6; 2Ω1; 2Ω2; constructions P35s:HarFAR:TatHSP 1, 2, 3 and PAtUbq:EaDAcT:TatHSP 1, 2, 3.

Additionally, we have cultured each of the colonies named above to store them.

07/14/2014

We tested the minipreps made last friday by digestion. Once they were checked, we send the correct ones to sequencing. The in silico digestions were as follows.

Parts	Retriction enzyme	Expected Bands
PAtUbq:EaDAcT:TatHSP in 2α2	HindIII	6322, 1722, 736, 221
P35s:HarFAR:TatHSP in 2 α2	HindIII	6322, 1794, 221
AtrΔ11	NotI	2961, 1056
2Ω1	BamHI	6652, 382, 239
2Ω2	EcoRV	6652, 621

Preparation of master mixes

• Master mix for HindIII
• 3.5 μL HindIII
• 17.5 μL Red
• 147 μL H20
• Master mix for NotI
• 1.5 μL NotI
• 7.5 μL Orange
• 63 μL H20
• Mix for EcoRV
• 0.5 μL EcoRV
• 2.5 μL Red
• 21 μL H20
• Mix for BamHI
• 0.5 μL PvuII
• 2.5 μL Green
• 21 μL H20

We run the electrophoresis gel to check if this time we have done it correctly.

Everything was OK except the AtrΔ11 (3), which had some partial digestion. It was the reason we sent AtrΔ11 (6) to sequence.

07/15/2014

We got the sequencing results from yesterday and everything was OK, so we made the transcriptional units ligation.

Reagents needed for the reaction of ligation (Total volume = 12 μL):

• P35s:AtrΔ11:T35s in 2α1
• 1 μL P35s
• 1 μL T35s
• 1 μL AtrΔ11
• 1.5 μL 2α1
• 1.2 μL ligase buffer 10x
• 1 μL T4
• 1 μL BsaI
• 3.7 μL H20
• P35s:HarFAR:T35s in 2α2
• 1 μL P35s
• 1 μL T35s
• 1 μL HarFAR
• 1 μL 2α2
• 1.2 μL ligase buffer 10x
• 1 μL T4
• 1 μL BsaI
• 4.2 μL H20
• P35s:EaDAcT:T35s in 2α2
• 1 μL P35s
• 1 μL T35s
• 1 μL EaDAcT
• 1 μL 2α2
• 1.2 μL ligase buffer 10x
• 1 μL T4
• 1 μL BsaI
• 4.2 μL H20

Note: Concentrations were previously adjusted to 75 ng/μL. Only the AtrΔ11 was adjusted from 250.2 ng/μL.

Finally, we prepared liquid cultures in order to store in glicerol. The tubes we used and their respective antibiotics were:

• Amp
• pAtrΔ11 (6)
• pEaDAcT (3)
• pHarFAR (3)
• Kan
• P35:HarFAR:TatHSP in 2α2 (3)
• PPAtUbq:EaDAcT:TatHSP in 2apha2 (3)

07/16/2014

Storage in glycerol of the HarFAR (GB1018), AtrΔ11 (GB1019), EaDAcT (GB1020), P35s:HarFAR:TatHSP in 2α2 (GB1021) and PAtUbq:EaDAcT:TatHSP in 2α2 (GB1022). We made 3 tubes: one for us, one for the GB collenction and one for reserve.

The procedure is to mix 700 μL of culture with 300 μL of glycerol 50%, spin it and store it in the -80ºC.

07/17/2014

Pick 3 colonies of P35s:AtrΔ11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Culture in liquid medium with Kan.

Digestions in silico.

Transcriptional units	Restriction enzymes	Expected bands
P35s:AtrΔ11:T35s	EcoRI	6323, 2269
	NcoI	390, 8202
P35s:HarFAR:T35s	HindIII	933, 6322, 1722
	NcoI	8587, 390
P35s:EaDAcT:T35s	HindIII	6322, 2366
	EcoRV	683, 8021

Preparation of reagents needed for genomic extraction of Candida tropicalis for FAO1.

07/18/2014

Mistake in P35s:AtrΔ11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s minipreps. Repeat tomorrow.

07/19/2014

Minipreps of P35s:AtrΔ11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Concentration measuments with nanodrop.

Transcriptional unit	DNA concentration
P35s:AtrΔ11:T35s (1)	164 ng/μL
P35s:AtrΔ11:T35s (2)	168 ng/μL
P35s:AtrΔ11:T35s (3)	147.4 ng/μL
P35s:HarFAR:T35s (1)	125.3 ng/μL
P35s:HarFAR:T35s (2)	114.5 ng/μL
P35s:HarFAR:T35s (3)	140.3 ng/μL
P35s:EaDAcT:T35s (1)	144.2 ng/μL
P35s:EaDAcT:T35s (2)	137.9 ng/μL
P35s:EaDAcT:T35s (3)	128.5 ng/μL
Stuffer fragment	135.5 ng/μL
2Ω1	196.8 ng/μL
2Ω2	175.4 ng/μL

Digestions of P35s:AtrΔ11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s and gel electrophoresis to check if transciptional units have been assembled OK.

All digestions were correct except P35s:EaDAcT:T35s (2).

Ligation in Ω vectors.

• P35s:AtrΔ11:T35s + P35s:HarFAR:T35s in 2Ω1
• 1 μL P35s:AtrΔ11:T35s (75 ng/μL)
• 1 μL P35s:HarFAR:T35s (75 ng/μL)
• 1 μL 2Ω1 (75 ng/μL)
• 1 μL BsmBI (5-10 ud)
• 1 μL T4 ligase (5-10 ud)
• 1 μL buffer ligase (3 ud)
• 4 μL H20
• P35s:EaDAcT:T35s in 2Ω2
• 1 μL stuffer fragment (75 ng/μL)
• 1 μL P35s:EaDAcT:T35s (75 ng/μL)
• 1 μL 2Ω2 (75 ng/μL)
• 1 μL BsmBI (5-10 ud)
• 1 μL T4 ligase (5-10 ud)
• 1 μL buffer ligase (3 ud)
• 4 μL H20

Set the reaction: 25 cycles x (37ºC 2 min, 16ºC 5 min).

Omega vectors include a resistance to spectinomycin.

07/20/2014

Transform and grow in Petri dishes yesterday's ligations: P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω1 and P35S:EaDAcT:T35S in 2Ω2.

07/21/2014

Pick colonies of P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω1 (3) and P35S:EaDAcT:T35S in 2Ω2 (2).

07/22/2014

We made minipreps of yesterday's liquid culture. Selected tubes:

• P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω1(Tubes 1, 2 and 3)
• P35S:EaDAcT:T35S in 2Ω2 (Tubes 1 and 2)

Digestions in silico made to check the transcriptional units:

Transcriptional units	Restriction enzyme	Expected bands
P35S:AtrΔ11:T35S+P35S:HarFAR:T35S in 2Ω1	EcoRV	9307, 2251
	BamHI	6652, 4906
P35S:EaDAcT:T35S in 2Ω2	EcoRV	6652, 1044, 817, 683
	NcoI	8806, 390

Digestion master mixes:

• Master mix for NotI
• 1.5 μL NotI
• 7.5 μL Orange buffer
• 63 μL H20
• Master mix for NcoI
• 1.5 μL NcoI
• 7.5 μL Tango buffer
• 63 μL H20
• Master mix for BamHI
• 2 μL BamHI
• 10 μL Green buffer
• 84 μL H20
• Master mix for EcoRV
• 4 μL EcoRV
• 20 μL Red buffer
• 168 μL H20

Note: Trichome promoter digestion preparation included.

All digestions were correct except the transcriptional unit of EaDAcT in 2Ω2 (P35s:EaDAcT:T35S).

Miniprep quantification:

Piece	Tube	Concentration (ng/μL)	Volume (μL)
P35S:EaDAcT:T35S in 2Ω2	1	350.7	33
P35S:EaDAcT:T35S in 2Ω2	2	271.1	33
P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω1	1	306.3	31
P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω1	2	296.6	28
P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω1	3	246.0	33

All of the pieces named above were adjusted at 75 ng/μL.

Piece	Tube number	Final Volume (μL)	Volume to be added (μL)
P35S:EaDAcT:T35S in 2Ω2	1	154.30	121.3
P35S:EaDAcT:T35S in 2Ω2	2	119.30	86.30
P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω1	1	126.60	95.60
P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω1	2	110.70	82.70
P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω1	3	108.24	75.20

As the digestions of the transcriptional unit (TU) of EaDAcT were incorrect, we repeated the process from the ligation step.

We transformed the same TU in a E. coli competent strain (DH5α). Then, the transformants were cultured in LB media and Spm and stored at 37ºC overnight.

Finally, in order to obtain the FAO1 gene, we want to extract the Candida tropicalis genome, so we have picked a colony of C. tropicalis. To check the extraction protocol, we used a yeast previously tested, Saccharomyces cerevisiae. We have cultured C. tropicalis in YPD media and S. cerevisiae in YPDA media at 28 ºC (5 mL).

07/23/2014

Candida genome extraction

Saccharomyces cerevisiae is used as a control in order to see if we followed the protocol correctly. We aren't really sure if this protocol is going to work in Candida.

Cultures measured at 600 nm:

• S. cerevisiae Abs = 1.07
• C. tropicalis Abs = 0.39

S. cerevisiae is recultured with new media (1:2) because the previous media was saturated. 2.25 mL of YPD media were mixed with 2.25 mL of S. cerevisiae culture. The mix has to grow at 28 ºC until the exponential phase is reached.

The absorbance was measured again:

• S. cerevisiae Abs = 0.52
• C. tropicalis Abs = 0.40

Buffers needed for the genome extraction were prepared freshly.The genome of both strains of yeast were extracted following the protocol:

• Grow yeast in 2 or 5 mL YPD to exponential phase.
• Collect cells in 1.5 mL eppendorf-cup (centrifugation 20 s, 6000 rpm).
• Wash once with 1 mL sterile water.
• Resuspend cells in 200 μL protoplast-buffer (100 mM Tris-HCl, pH 7.5, 10 mM EDTA, 1000 units Zymolyase/mL, 10 μL beta-mercaptoethanol/mL; prepare freshly!). Incubate at 37ºC for 1-2 h and finally resuspend by turning the cups.
• Add 200 μL of Lysis-Mix (0.2 M NaOH, 1% SDS) an mix carefully (Don't vortex!).
• Incubate at 65 ºC for 20 min and cool inmediately on ice.
• Add 200 μL of 5 M KAc (pH 5.4) and mix carefully (Don't vortex!) and incubate 15 min on ice.
• Centrifuge (13,000 rpm, 3 min) and transfer supernatant in a fresh cup.
• Add 2 μL RNase A (10 mg/mL) and incubate at 37 ºC for 30 min.
• Add 600 μL isopropanol and mix carefully (Don't vortex!). Incubate at room temperature for 5 min ad centrifuge (13,000 rpm, 30 s).
• Remove the supernatant and wash with 70% ethanol (10 min at room temperature).
• Centrifuge (13,000 rpm, 30 s) and remove the supernatant.
• Dry DNA pellet in a speed-vacuum (not longer than 3 min!) and resuspend in 50 μL TE-buffer.
• Store chromosomal DNA at 4 ºC (Don't freeze!). Concentration and quality can be checked in an agarose gel (loading 1/10 of the volume).

Genomic quantification:

Organism	Concentration
S. cerevisiae	72.2 ng/μL
C. tropicalis	1397.1 ng/μL

Electrophoresis made to check the extraction quality was correct.

We did not observe genomic from Candida because we used a very diluted sample. We will repeat the gel tomorrow.

We picked EaDAcT colonies.

07/24/2014

The genomic quality of both organisms (C. tropicalis and S. cerevisiae) was checked in an agarose gel again.

We got the Candida genome band, however, the Saccharomyces genome band was not present.

Additionally, minipreps of the liquid culture made yesterday were made and also recultured in solid agar plate.

Miniprep digestions are going to be done tomorrow.

07/25/2014

Digestions in silico made for checking yesterday's minipreps:

Pieces/TU	Restriction enzyme	Expected bands
P35S:EaDAcT:T35S in 2Ω2	EcoRV	6652, 1044, 817, 683
	NcoI	8806, 390

Digestion master mixes:

• Master mix for NotI
• 2 μL NotI
• 10 μL Orange buffer
• 84 μL H20
• Master mix for NcoI
• 2 μL NcoI
• 10 μL Tango buffer
• 84 μL H20
• Master mix for BglII
• 2 μL BglII
• 10 μL Orange buffer
• 84 μL H20
• Master mix for EcoRV
• 1.5 μL EcoRV
• 7.5 μL Red buffer
• 63 μL H20

An agarose gel was made to check the transcriptional unit and the other pieces:

All pieces were correct except the TU corresponding to P35:EaDAcT:T35S.

07/28/2014

Once the Candida tropicalis genome DNA is obtained, the FAO1 gene can be amplified by PCR.

PCR reaction reagents:

• FAO1-PCR1
• Genomic 0.5 μL
• Buffer HF (5X) 10.0 μL
• dNTPs 2.0 μL
• Oligo R (JUL06) 2.5 μL
• Oligo F (JUL05) 2.5 μL
• Phusion polymerase 0.5 μL
• H2O 32.0 μL
• FAO1-PCR2
• Genomic 0.5 μL
• Buffer HF (5X) 10.0 μL
• dNTPs 2.0 μL
• Oligo R (JUL08) 2.5 μL
• Oligo F (JUL07) 2.5 μL
• Phusion polymerase 0.5 μL
• H2O 32.0 μL

Annealing temperatures

• FAO1-PCR1: 59 ºC
• FAO1-PCR2: 64 ºC

PCR products were checked using an electrophoresis. Expected bands:

• FAO1-PCR1: 1157 bp
• FAO1-PCR2: 1015 bp

Both FAO1 PCR products were not correct.

As the EaDAcT TU was not correct, ligation reaction was done again. The following table shows ligation details:

Reagent	Volume
Trichome promoter	1 μL
GFP	1 μL
TNos	1 μL
BsaI	1 μL
p2α2	1 μL
T4 ligase	1 μL
Ligase buffer	1 μL
H2O	3 μL
Total Volume	10 μL

07/29/2014

As the FAO1 PCR was not correct, we repeated the reaction. Below is a table showing the details:

Reagent	FAO1-PCR1	FAO1-PCR2
C. tropicalis genome	2.5 μL	2.5 μL
HF Buffer	30 μL	30 μL
dNTPs	10 μL	10 μL
Oligo R	12.5 μL	12.5 μL
Oligo F	12.5 μL	12.5 μL
Phusion polymerase	1.5 μL	1.5 μL
H2O	181 μL	181 μL

PCR temperatures, 25 cycles:

Step	Temperature (ºC)	Time
Initialization	98	2 min
Denaturation	98	20 s
Annealing	50, 55, 60, 65	??
Extension	72	45 s
Final elongation	72	7 min

We made a mistake preparing the FAO1-PCR1 adding the wrong template, so we do not expect the correct FAO11-PCR1 product.

EaDAcT Transcriptional Unit (TU) transformation

Using an electrocompetent E. coli strain (DH5α) and 1.5 ul ligation (P35s:EaDAcT:T35s in 2Ω2), the mix is electroporated at 1500 V. Then, 300 μL of SOC are added and stored at 37ºC with agitation.

07/30/2014

Transform P35s:AtrΔ11:T35+P35s:HarFAR:T35 and P35s:EaDAcT:T35s (in 2α2) in Agrobacterium tumefaciens strain C58. Introduce 1 μL of construction in a C58 aliquot. Electroporate at 1440V. Add 500 μL of LB in the LAF. Keep 2 hours in agitation at 28ºC. Grow 20 μL and 200 μL in solid medium containing kanamicin and rifampicin. Incubate overnight at 28ºC.

Pick colonies of P35s:EaDAcT:T35s in 2Ω2.

08/01/2014

Pick colonies from Agrobacterium tumefaciens and grow them in liquid medium for two days at 28ºC. Liquid medium is composed by 5 mL LB, Rif (1:1000) and Kan (1:1000) for α vectors and 5 mL LB, Rif (1:1000) and Spm (1:1000) for Ω vectors.

07/31/2014

Minipreps of yesterday's culture were made, obtaining the transcripional unit: P35S:EaDAcT:T35S in 2Ω2

Additionally, we recultured in petri dish with its respective antibiotic (Spm).

Digestions in silico made for checking minipreps:

Pieces/TU	Restriction enzyme	Expected bands
P35S:EaDAcT:T35S in 2Ω2	NcoI	8806, 390
	EcoRV	6652, 1044, 817, 683

Digestion mixes:

• Master mix for EcoRV:
• 3 μL EcoRV
• 15 μL Red buffer
• 126 μL H20
• Master mix for NcoI:
• 1.5 μL NcoI
• 7.5 μL Tango buffer
• 63 μL H2O

Note: We made master mixes because digestions were made simultaneously with the trichome promoter part.

An agarose gel was made to check the transcriptional unit.

Minipreps of P35s:EaDAcT:T35s in 2Ω2 (1) went correctly.

Miniprep results were quantified and then adjusted at 75 ng/μL:

Pieces/TU	Tube	Concentration (ug/μL)	Initial volume (μL)	Final Volume (μL)
P35S:EaDAcT:T35S in 2Ω2	1	141.4	35	31
P35S:EaDAcT:T35S in 2Ω2	2	3.9	33	(Discarded)

Ligation of P35s:EaDAcT:T35s in 2Ω2 with P35s:AtrΔ11:T35+P35s:HarFAR:T35 in 2Ω1.

• 1 μL P35s:AtrΔ11:T35+P35s:HarFAR:T35 in 2Ω1
• 1 μL P35s:EaDAcT:T35s in 2Ω2
• 1 μL 2α1
• 1 μL BsaI
• 1 μL T4 ligase
• 1 μL ligase buffer
• 4 μL H20

08/04/2014

Transformation of P35s:EaDAcT:T35s in 2Ω2 P35s:AtrΔ11:T35+P35s:HarFAR:T35 in E. coli.

Agrobacterium liquid cultures (5 mL LB)

• P35s:GFP:p19:Tnos (Spm, Tet, Rif)
• Empty C58 Agrobacterium tumefaciens (Rif)
• 2x P35s:EaDAcT:T35s in 2α2 (Rif, Kan)
• 2x P35s:AtrΔ11:T35+P35s:HarFAR:T35 in 2Ω1 (Rif, Spm)

08/05/2014

Pick colonies from P35s:AtrΔ11:T35+P35s:HarFAR:T35+P35s:EaDAcT:T35s in 2α1.

Repeat PCR of FAO1.

• FAO1-PCR1: 3 reactions at different temperatures (54, 59, 64ºC)
• 1.75 μL Candida tropicalis genomic
• 35 μL HF buffer (5x)
• 7 μL dNTPs
• 8.75 μL oligo forward (Jul07)
• 8.75 μL oligo reverse (Jul08)
• 1.05 μL Phusion polymerase
• 112.7 H20

PCR temperatures, 35 cycles:

Step	Temperature (ºC)	Time
Initialization	98	2 min
Denaturation	98	10 s
Annealing	54, 59, 64	55 s
Extension	72	55 s
Final elongation	72	7 min

• FAO1-PCR2: touchdown PCR
• 0.5 μL Candida tropicalis genomic
• 10 μL HF buffer (5x)
• 2 μL dNTPs
• 2.5 μL oligo forward (Jul09)
• 2.5 μL oligo reverse (Jul10)
• 0.5 μL Phusion polymerase
• 32 μL H20

PCR temperatures, 35 cycles:

Step	Temperature (ºC)	Time
Initialization	98	5 min
Denaturation	98	10 s
Annealing	69.5 (descending 0.5 per cycle)	20 s
Extension	72	55 s
Final elongation	72	7 min

It continues without working. For the next time we are going to repeat the dilutions in case they weren't correctly done.

08/06/14

Minipreps of yesterday's culture were made:

• TU AtrΔ11 + TU HarFAR + TU EaDAcT

Additionally, we made Agrobacterium' culture minipreps using a different kit (We used the QIAgen Miniprep kit 250, 27106)

• TU AtrΔ11 + TU HarFAR in 2Ω1
• P35S:EaDAcT:T35S in 2Ω2

FAO1 PCR was repeated (this time using a different primers aliquot).

• FAO1-PCR1:
• 0.5 μL Candida tropicalis genomic
• 10 μL HF buffer (5x)
• 2 μL dNTPs
• 2.5 μL oligo forward (Jul07)
• 2.5 μL oligo reverse (Jul08)
• 0.5 μL Phusion polymerase
• 32 μL H20

• FAO2-PCR1:
• 0.5 μL Candida tropicalis genomic
• 10 μL HF buffer (5x)
• 2 μL dNTPs
• 2.5 μL oligo forward (Jul09)
• 2.5 μL oligo reverse (Jul10)
• 0.5 μL Phusion polymerase
• 32 μL H20

PCR temperatures, 35 cycles:

Step	Temperature (ºC)	Time
Initialization	98	2 min
Denaturation	98	10 s
Annealing	59 (PCR1)/ 64 (PCR2) (descending 0.5 per cycle)	20 s
Extension	72	55 s
Final elongation	72	7 min

Digestions made in silico to check minipreps:

E. coli

Pieces/TU	Resriction enzymes	Buffer	Expected Bands
TU AtrΔ11+ TU HarFAR + TU EaDAcT in 2α1	EcoRI	Orange	7428, 6323
TU AtrΔ11+ TU HarFAR + TU EaDAcT in 2α1	BglII	Orange	11175, 2576

A. tumefaciens

Pieces/TU	Resriction enzymes	Buffer	Expected Bands
TU AtrΔ11 + TU HarFAR in 2Ω1	EcoRV	Red	9307, 2251
TU AtrΔ11 + TU HarFAR in 2Ω1	BamHI	Green	6652, 4906
TU EaDAcT in 2α2	EcoRV	Red	8021, 683
TU EaDAcT in 2α2	HindIII	Red	6322, 2382

Digestion master mixes:

• Master mix for NotI:
• 2.5 μL NotI
• 12.5 μL Orange buffer
• 105 μL H20
• Master mix for RsaI:
• 2 μL NcoI
• 10 μL Tango buffer
• 84 μL H2O

Note: We made master mixes because digestions were made simultaneously with the switch part.

We made different mixes for Agrobacterium samples because we think that minipreps are not as good as it is expected.

• Agrobacterium sample mix:
• 0.5 μL Restriction enzyme
• 2.5 μL Buffer
• 5 μL Miniprep sample
• 17 μL H2O

Digestions in A. tumefaciens.

FAO1 PCR product.

All digestions and TU AtrΔ11+ TU HarFAR + TU EaDAcT in 2α1 were correct. PCR products were not correct or absent again.

As digestions were correct, we recultured Agrobacterium in new media (LB) in order to have cultures in exponential phase for tomorrow. We mix in each tube 5 mL of LB with 40 μL of inoculum, XGal (2:1000), IPTG (1:1000)and the corresponding antibiotic (1:1000).

Culture	Antibiotic	Dilution
P35:GFP:P19:TNos	Spm, Tet, Rif
Agrobacterium (as a control)	Rif
P35S:EaDAcT:T35S	Rif, Kan
P35S:AtrΔ11:T35S + P35S:HarFAR:T35S	Rif, Spm

Recultured media was grown at 28 ºC overnight (around 16 h).

08/07/2014

Agroinfiltrate in Nicotiana benthamiana.

• Agrobacterium control culture and P35s:GFP:P19:Tnos (x2 forth true leaves)
• TU AtrΔ11+TU HarFAR and P35s:GFP:P19:Tnos (x2 forth true leaves)
• TU AtrΔ11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos (x2 forth true leaves)

Agroinfiltration protocol consist on:

• Centrifuge the cultures 15 min 3000 rpm and discard supernatant.
• 5 mL of agroinfiltration solution per culture. 100 mL of agroinfiltration solution were composed of 10 mL MES 100mM (pH 5.6), 1 mL MgCl2 1M and 100 μL acetosyringone solution 200 mM (19.62 mg, DMSO 500 μL; prepare freshly). Mix it with the vortex. If the culture is still turbid, add a bit more of agroinfiltration sollution. Put it in the (rodillos) for two hours.
• Measure the OD. The optimum OD for agroinfiltration is 0.2. If it is too high adjust the concentration with more agroinfiltration solution.
• Mix the cultures, keeping all of them in the same proportions.
• Proceed to agroinfiltration.

08/08/2014

In order to have a control for the FAO1 PCR, which hasn't been very successful, Jesús Muñoz provided us with 4 primers and 2 clones of Candida tropicalis (C981 ng/μL and pYEP C98 28.2 ng/μL). These primers amplify for the gene HSR1.

Name	Sequence	Tm
HSR1 RTRv+1149	TTTGTCTTGCAACAGGTCCA	56ºC
HSR1 clone Fw+1	ATGAGTAAGAAAAGCAACAGTACC	54ºC
HSR1 fw-BamHI+480	GCTGGATCCTTAGTAGTAGTGGATCAAGGAAT	49ºC (annealing)
HSR1 clone RV+stop	CTAATTTTCTTCTTTTTCAATAGTAACTATCC	51ºC

Possibility of primer combinations

A	HSR1 fw-BamHI+480	HSR1 RTRv+1149	687	49ºC
C	HSR1 clone Fw+1	HSR1 clone RV+stop	2187	-
B	HSR1 RTRv+1149	HSR1 clone Fw+1	1168	54ºC

We amplified the genomic of C. tropicalis and the two clones (C98 and C98 pYep)with the primer combinations A and B with Taq polymerase at 2 different temperatures (49 and 52ºC). C primer combination was not used due to the length of the spected band.

PCR parameters

• 94ºC, 3 min
• 35 cycles
• 94ºC, 30 s
• 49 or 52ºC, 15 s
• 72ºC, 90 s
• 72ºC, 7 min

PCR products were not present. It probably did not work because we added to much buffer.

08/11/2014

We obtained a different plasmid (pUbiquitina HSRI-CDS col.6) as a positive control of PCR to check the quality of our Candida genome. We diluted them to obtain a final concentration of 30 ng/μL.

PCRs wih Taq polimerase:

• 1 μL Template
• 1.5 μL dNTPs
• 1 μL Forward primer
• 1 μL Reverse primer
• 1 μL Taq pol.
• 5 Buffer 10X
• 39.5 μL H2O

PCR	Template	F primer	R primer
1	pUbiquitina HSRI-CDS col.6	HSR1 BamHI + 480	HSR1 Rtrev + 1149
2	pUbiquitina HSRI-CDS col.6	HSR1 Rtrv + 1149	HSR1 Fw + 1
3	C. tropicalis genome	HSRI-CDS col.6	HSR1 BamHI + 480	HSR1 Rtrev + 1149
4	C. tropicalis genome	HSR1 Rtrv + 1149	HSR1 Fw + 1

PCR conditions:

• 94ºC 3 min
• 35 cycles
• 94ºC 30 s
• 49ºC 15 s
• 72ºC 90 s
• 72ºC 7 min

Trichome promoter

07/03/2014

Genomic DNA extraction from Nicotiana tabacum. We need the genome of this organism because we want to obtain the trichome promoter from the NtCPS2 gene.

• Obtain 100 mg of the tobacco leaves (5 disks made with a 1.5 mL vial). Made it twice.
• Introduce the disks inside the tube.
• Introduce the two tubes in liquid nitrogen.
• Remove them from the liquid nitrogen and store at -80ºC until use.
• Remove one tube from -80ºC and re-introduce them in liquid nitrogen.
• Grind the disks.
• Add 600 μL of CTAB (2%) buffer (pre-heat at 65ºC.)
• Grind the mixture.
• Add RNAse (1.6 μL at M = 100 ug/μL for each mL of CTAB buffer).
• Vortex it and maintain at 65ºC for 45 min. Mix it by inversion 5-15 min.
• Add 600 μL cloroform:isoamilic alcohol. Vortex it.
• Centrifuge 15 min at 13000 rpm (or 10 min at 14500 rpm.
• Recover the supernatant by aspiration (with a 200 μL pipet).
• Repeat the last three steps.
• Add one volume o isopropanol and mix well by inversion (10 times).
• To precipitate, maintain 20 min on ice or at -80ºC during 5 min.
• Centrifuge 10 min at 13000 rpm (4ºC).
• Discard the supernatant by decantation (be carefull with the pellet).
• Wash with 600 μL ethanol (80%).
• Centrifuge 5 min at 13000 rpm.
• Discard the ethanol by pipeting and let it dry a few minutes.
• Resuspend it in 50-100 μL H2O miliQ or with TE buffer.
• Store at -20ºC.

Measurement of genomic concentration with nanodrop.

• Tabacco 1: 182 ng/μL (Thrown away)
• Tabacco 2: 620 ng/μL (Stored at -20ºC)

Electrophoresis performed to check the genomic size of tobacco (to see if it is degradated).

It is correct.

07/10/2014

PCR of genomic extraction of tobacco in order to amplify the trichome promoter CPS2.

Ordered primers

• IGEMJULO1
• IGEMJULO2

Ajust primers to a 100 uM concentration:

• IGEMJUL01 + 566 μL miliQ H2O
• IGEMJUL02 + 691 μL miliQ H2O

Use a 1:10 alicuot for PCR (10 uM).

Reagents needed for PCR:

• 0.5 μL template
• 10 μL buffer HF 5x
• 2 μL dNTPs
• 2.5 μL oligo R
• 2.5 μL oligo F
• 0.5 μL Pfu
• 32 μL miliQ H2O

Final volume: 50 μL

Parameters:

• 98 ºC (2 min)
• 35 cycles
• 98 ºC (10 sec)
• 59 ºC (15 sec)
• 72 ºC (45 sec)
• 72 ºC (7 min)

We didn't get PCR product.

07/11/2014

Repeat PCR with different parameters.

	1	2	3	4	5
Template	0.5 μL	0.5 μL	0.5 μL	0.5 μL	0.5 μL
Buffer (5x)	0.5 μL	0.5 μL	0.5 μL	0.5 μL	0.5 μL
dNTPs	2 μL	2 μL	2 μL	2 μL	2 μL
Oligo R	2.5 μL	2.5 μL	2.5 μL	2.5 μL	2.5 μL
Oligo F	2.5 μL	2.5 μL	2.5 μL	2.5 μL	2.5 μL
Phu	0.5 μL	0.5 μL	0.5 μL	0.5 μL	0.5 μL
Buffer	32 μL	32 μL	32 μL	32 μL	32 μL

1, 2 and 5 contain buffer F; 3 and 4 contain buffer GC.

PCR parameters

• 98 ºC (2 min)
• 35 cycles
• 98 ºC (10 sec)
• 1, 3, 5 -> 59 ºC (15 sec). 2, 4 -> 55 ºC (15 sec)
• 72 ºC (45 sec)
• 72 ºC (7 min)

No PCR products again.

Repeat PCR again with other parameters.

	Buffer HF	Buffer GC
Template	2 μL	2 μL
Buffer (5x)	40 μL	40 μL
dNTPs	8 μL	8 μL
Oligo R	10 μL	10 μL
Oligo F	10 μL	10 μL
Phu	2	2 μL μL
Buffer	128 μL	128 μL

Set 4 tubes with each buffer at different temperatures: 49, 52, 55, 60.

• 98 ºC (2 min)
• 35 cycles
• 98 ºC (10 sec)
• 49, 52, 55, 60 ºC (15 sec)
• 72 ºC (45 sec)
• 72 ºC (7 min)

No PCR products again.

07/14/2014

Repeat PCR again with more genomic.

Buffer HF	Buffer GC
Template	5	5
Buffer (5x)	50	50
dNTPs	10	10
Oligo R	12.5	12.5
Oligo F	12.5	12.5
Phu	2.5	2.5
Buffer	107.5	107.5

Same parameters as before except annealing temperatures which are: 50, 53, 57, 59 ºC.

We still without having any amplification.

07/18/2014

Repeat the PCR with other enzyme.

• 12.5 μL Q5 Master mix (2x).
• 1.25 μL forward primer 10 uM
• 1.25 μL reverse primer 10 uM
• 0.5 μL template 620 ng/μL
• 9.5 μL H2O

Set 4 reactions at 50, 53, 55, 59 ºC.

• 98 ºC (30 sec)
• 35 cycles
• 98 ºC (10 sec)
• 50, 53, 55, 59 ºC (15 sec)
• 72 ºC (45 sec)
• 72 ºC (2 min)

The DNA fragment of interest is around 1.5 kb so we see we finally obtained amplification at 55 and 59 ºC reactions.

07/19/2014

Trichome promoter PCR product ligation in pUPD.

• 1 μL pUPD
• 1 μL PCR product
• 1 μL BsmBI (5-10 ud)
• 1 μL T4 ligase (5-10 ud)
• 1.2 μL buffer ligase (3 ud)
• 6.8 μL H20

Set the reaction: 25 cycles x (37ºC 2 min, 16ºC 5 min).

07/20/2014

Transform and grow in Petri dishes yesterday's ligation of the trichome promoter in pUPD.

07/21/2014

We picked colonies of the trichome promoter in pUPD and grown it in liquid culture.

07/22/2014

We made minipreps of yesterday's liquid culture. Additionally, we have recultured them in solid growth media.

Miniprep quantification:

Piece	Tube	Concentration (ng/μL)	Volume (μL)
Trichome promoter in pUPD	1	317.1	26
Trichome promoter in pUPD	3	354.8	32

Both minipreps were adjusted to 75 ng/μL.

Digestions in silico performed to check the insertion:

Piece	Restriction enzyme	Expected bands
Trichome Promoter in pUPD	NotI	2981, 1523
	EcoRV	3942, 562

Note: To see further details of digestion master mixes, go to the biosynthesis part, date 07/22/2014.

Pieces taken from the GoldenBraid 2.0 collection were cultured in solid growth media:

• pTnos (GB0037)
• pGFP (GB0059)
• pLuciferase (GB0096)

07/23/2014

Yesterday's digestions were correct, so the trichome promoter in pUPD was send to sequencing.

We picked colonies from pTnos, pGFP and pLuciferase.

07/24/2014

Results of sequencing the promoter were obtained:

Mutation	Position
T insertion	??
T insertion	??

Minipreps of pTnos, pGFP and pLuciferase.

07/28/2014

Piece	Concentration (ng/μL)	Initial Volume (μL)	Final Volume (μL)
GFP	318.8	35	148.8
Tnos	400.8	35	186.5
pLuciferase	NotI	2981, 1731

See master mix and gel digestion in Biosynthesis part. Pieces were obtained correctly and adjusted to 75 ng/μL.

The following table shows ligation details of the trichome promoter:

Reagent	Volume
CPS2	1 μL
GFP	1 μL
TNos	1 μL
BsaI	1 μL
p2α2	1 μL
T4 ligase	1 μL
Ligase buffer	1 μL
H2O	3 μL
Total Volume	10 μL

07/29/2014

Trichome Promoter transformation in E. coli.

Using an electrocompetent E. coli strain (DH5α) and 1.5 ul ligation (CPS2:GFP:TNos in 2α2), the mix is electroporated at 1500 V. Then, 300 μL of SOC are added and stored at 37 ºC with agitation.

07/30/2014

Pick colonies of CPS2:GFP:TNos in 2α2.

07/31/2014

Minipreps of yesterday's culture were made, obtaining the transcripional unit: PCPS2:GFP:TNos in 2 α2

Additionally, we recultured in petri dish with its respective antibiotic (Kan).

Digestions in silico made for checking minipreps:

Pieces/TU	Restriction enzyme	Expected bands
CPS2:GFP:TNos in 2α2	HindIII	6322, 2694
	EcoRV	8454, 562

Digestion mixes:

• Master mix for EcoRV:
• 3 μL EcoRV
• 15 μL Red buffer
• 126 μL H20
• Master mix for HindIII:
• 2 μL HindIII
• 10 μL Red buffer
• 84 μL H2O

Note: We made master mixes because digestions were made simultaneously with the biosynthesis part.

An agarose gel was made to check the transcriptional unit:

Minipreps of CPS2:GFP:TNos in 2α2 (1) went correctly.

Miniprep results were quantified and then adjusted at 75 ng/μL:

Pieces/TU	Tube	Concentration (ug/μL)	Initial volume (μL)	Final Volume (μL)
PCPS2:GFP:TNos in 2α2	1	128.5	33	56.5
PCPS2:GFP:TNos in 2α2	2	135.9	34	61.6
PCPS2:GFP:TNos in 2α2	3	126.2	35	58.9

08/05/2014

Transcriptional Unit (TU) PCPS2:GFP:TNos in 2α2 was transformed in Agrobacterium tumefaciens (C58) and cultured in liquid media with Kan and Rif at 1:1000 (2 days at 28ºC).

Note: The scientific name has been updated to Rhizobium radiobacter.

08/08/2014

The TU (PCPS2:GFP:TNos) was recultured in liquid media. Additionally, P35S:GFP:p19:TNos TU was recultured in liquid media, using Spm and Rif as antibiotics.

08/11/2014

Agrobacterium cultures were refreshed in new liquid media. Additionally, we cultured them in solid media.

Minipreps of the TU PCPS2:GFP:TNos) were made.

Switch

07/04/2014

Adquisition of S. cerevisiae genomic DNA. (5 μL, stored in the fridge)

07/28/2014

We had the genome of S. cerevisiae, needed to extract the target genes that are going to be used to build the switch. However we finally used our genome extraction (see Biosynthesis part, date 07/23/2014 for further details).

Previously we have designed a cupple of primers to amplify the CUP1 and CUP2 genes present in the yeast.

PCR reaction reagents:

Reagent	CUP1-PCR1	CUP2-PCR2
Template	0.5 μL	0.5 μL
Buffer HF (5X)	10.0 μL	10.0 μL
dNTPs	2.0 μL	2.0 μL
Oligo R (JUL06)	2.5 μL	2.5 μL
Oligo F (JUL05)	2.5 μL	2.5 μL
Phusion polymerase	0.5 μL	0.5 μL
H2O	32.0 μL	32.0 μL

Annealing temperature: both 61 ºC

PCR products were checked using an electrophoresis. Expected bands:

• CUP1-PCR1: 386 bp
• CUP2-PCR2: 348 bp

Both PCR products were correct.

07/30/2014

We repeated the PCR because we had to purify the bands CUP1-PCR1 and CUP2-PCR2.For this purpose we used the kit "QIAEX II Gel Extraction Kit".

Ligation of both parts of CUP2.

• 1 μL CUP1-PCR1
• 1 μL CUP1-PCR1
• 1 μL pUPD
• 1 μL BsmBI
• 1 μL T4 ligase
• 1 μL ligase buffer
• 4 μL H20

07/31/2014

CUP2 was transformed in pUPD and cultured in solid media (37ºC).

08/04/2014

Grow the piece corresponding to Gal4 Activation Domain (GB0095) from the GB collection in solid medium.

08/05/2014

Pick colonies from CUP2 (3 colonies) and Gal4AD (1 colony).

08/06/14

Minipreps of yesterday's culture were made:

• Gal4AD
• CUP2

Digestions made in silico in order to check transcriptional units:

Pieces/TU	Resriction enzymes	Buffer	Expected Bands
CUP2 in pUPD	Not1	Orange	2981, 752
CUP2 in pUPD	RsaI	Tango	2457, 1276
Gal4AD in pUPD	Not1	Orange	2981, 330
Gal4AD	PuuI	Red	2215, 1096

CUP2 in pUPD is correct. RsaI restriction enzyme does not cut properly, as a result we obtained different bands from those ones expected.

Gal4AD piece is correct.

08/11/2014

Sequencing results of CUP2 piece were finally received and they were correct.

As the sequence was correct, we could continue with ligations.

Quantification

• CUP2: 110.3 ng/μL
• Gal4: 221.4 ng/μL

Samples were diluted to 75 ng/μL.

Ligations made:

• P35S:CUP2:Gal4AD:T35S
• 1 μL P35S
• 1 μL CUP2
• 1 μL Gal4AD
• 1 μL T35S
• 1 μL BsaI
• 1 μL T4 ligase
• 1 μL Buffer ligase
• 1 μL 2α2
• 2 μL H2O

• PCPS2:CUP2:Gal4AD:T35S
• 1 μL PCPS2
• 1 μL CUP2
• 1 μL Gal4AD
• 1 μL T35S
• 1 μL BsaI
• 1 μL T4 ligase
• 1 μL Buffer ligase
• 1 μL 2α2
• 2 μL H2O




Biosafety




07/22/2014

Pieces taken from the GoldenBraid 2.0 collection were cultured in solid growth media:

• P35S:Rosea:TNos
• TA29:Barnase:TNos (from GoldenBraid 1.0 collection)

We were told by our advisor that Rosea produces necrosis in N. benthamiana, so we must think of an alternative.




07/23/2014

We picked colonies from P35S:Rosea:TNos and TA29:Barnase:TNos.




07/24/2014

Minipreps of P35S:Rosea:TNos and TA29:Barnase:TNos.




07/25/2014

Digestions in silico made for checking yesterday's minipreps:

Pieces	Restriction enzyme	Expected bands
P35S:Rosea:Tnos	BglII	2495, 2302
	NcoI	4407, 390
TA29:Barnase:Tnos	BglII	2825, 2245




07/28/2014

See master mix and gel digestion in Biosynthesis part. Pieces were obtained correctly and adjusted to 75 ng/μL.




07/31/2014

We talked with the NRP-UEA-Norwich team. We stablished a possible collaboration in developing the biosafety module together. They could send us their chromoproteins and we could send them our barnase and TA29 promoter.




08/05/2014

Order primers for TA29 and barnase:

Name	Sequence	T annealing
I14Ago01_TA29_F1	CGCCGTCTCGCTCGGGAGTAGCGAATGCAATTAATTTAGACAT	61.8°C
I14Ago02_TA29_R1	CGCCGTCTCGCTCGCATTTTTAGCTAATTTCTTTAAGTAAAAACTTTG	60.8°C
I14Ago03_barnase_F1	CGCCGTCTCGCTCGAATGGCACAGGTTATCAACACG	65.0°C
I14Ago04_barnase_R1	CGCCGTCTCGCTCGAAGCTTATCTGATTTTTGTAAAGGTCTGATAATG	63.4°C




08/07/2014

Primers received. PCR for barnase and TA29 performed.

• TA29 PCR parameters
• 98°C, 2 min
• 35 cycles
• 98°C, 10 s
• 60°C, 18 s
• 72°C, 40 s
• 72°C, 7 min
• Barnase PCR parameters
• 98°C, 2 min
• 35 cycles
• 98°C, 10 s
• 63°C, 18 s
• 72°C, 40 s
• 72°C, 7 min


We didn't obtain PCR product. There is a band for the barnase, but it should be around 330 bp.




08/08/2014

We repeat yesterday's PCR with 2 degrees less in the annealing step.



Results obtained are the same of yesterday's. We should think about charging something else.




08/11/2014

The previous PCR was repeated changing the annealing temperature to 61ºC.





Translator to BioBricks




08/07/2014

Ale's primers labeled A11Dic32 and M11Nov12 found.

Run PCR with the following templates and primers:

Template	Forward	Reverse	Expected lenght
P35s	iGEMJul11 A11Dic32	1086 bp
T35s	M11Nov12iGEM12Jul	284 bp

• P35s PCR parameters
• 98°C, 2 min
• 35 cycles
• 98, 10 s
• 67°C, 18 s
• 72°C, 40 s
• 98°C, 7 min
• T35s PCR parameters
• 98°C, 2 min
• 35 cycles
• 98°C, 10 s
• 65°C, 18 s
• 72°C, 40 s
• 98°C, 7 min


We didn't obtain PCR product.




08/08/2014

We repeat yesterday's PCR with 2 degrees less in the annealing step.



Now there is a band for P35s but it should not be there.