Team:Valencia UPV/style css

From 2014.igem.org

(Difference between revisions)
(Undo revision 57733 by Lestelles (talk))
Line 1: Line 1:
-
[[File:Igem.png|100px|right|igem_logo|link=https://igem.org/Main_Page]]
 
<html>
<html>
-
<head>
 
<style>
<style>
-
table,th,td {border:1px solid black;
+
body
-
    margin: 0px;  
+
{
-
}
+
background-image: url(https://static.igem.org/mediawiki/2014/5/56/Logo_upv.png);
 +
font-family: arial;
-
h3 {
 
-
    color: #6A8347;
 
-
    text-align: left;
 
-
    font-size: 18pt;
 
-
    font-weight:bold;
 
-
}
 
-
h4 {
 
-
    color: #71B238;
 
-
    text-align: left;
 
-
    font-size: 12pt;
 
-
    font-weight:bold;
 
}
}
-
p {
+
footer-box, #siteSub, #search-controls, .firstHeading, #contentSub, #catlinks, #p-logo {
-
    margin: 0px;
+
display:none;
}
}
-
strong{
+
.Buttons
-
    color: red;
+
{
-
    text-align: left;
+
background-color: #87CEEB;
-
    font-size: 10pt;
+
width: 200px;
-
    font-weight:bold;
+
height: 100px;
-
 
+
margin: 20px;
-
}
+
border: 5px outset black;
-
.box_above{
+
-
    border: 2px dashed blue;
+
-
    margin: 10px;
+
-
    padding: 10px;
+
-
    background-color: #b0c4de;
+
}
}
-
</style>
+
#main
-
</head>
+
{
-
<body>
+
position: relative;
 +
width: 92%;
 +
left: 4%;
 +
background-color: #EEE8AA;
-
<div class="box_above">
 
-
Contents:
+
}
-
<ul> <li> <a href="#Biosynthesis">Biosynthesis</a></li> <li> <a href="#Trichome_promoter">Trichome promoter</a></li> <li> <a href="#Switch">Switch</a></li> <li> <a href="#Biosafety">Biosafety</a></li></ul>
+
-
</div><a name="Biosynthesis"></a></br></br><h3><p></p>Biosynthesis</h3></br><p><h4>06/09/2014</h4></p>
+
 +
/*HEADER MENU STYLE*/
 +
.example
 +
{
 +
background:#fff url(https://static.igem.org/mediawiki/2014/5/5c/Ivllobel_blue.jpg); /* METER EL FONDO */
 +
width:711px;
 +
height:50px;
 +
border:1px #000 solid;
 +
margin:20px auto;
 +
padding:15px;
 +
border-radius:3px;
 +
-moz-border-radius:3px;
 +
-webkit-border-radius:3px;
 +
}
-
<p>The enzymes involved in the biosynthesis pathways are Atr&Delta;11, HarFAR, FAO1, EaDAcT.</p>
 
-
<p></br></p>
+
/* main menu styles */
 +
.menu
 +
{
 +
background-color:#d0e6f5;
 +
text-align:center;
 +
width:100%;
 +
}
 +
.menu > span
 +
{
 +
display:inline-block;
 +
margin:0 auto;
 +
}
 +
#nav
 +
{
 +
display:inline;
 +
text-align:center;
 +
position:relative;
 +
list-style-type:none;
 +
}
-
<img src=https://static.igem.org/mediawiki/2014/thumb/0/0f/UPV_rutas-biosintesis_feromonas.png/547px-UPV_rutas-biosintesis_feromonas.png width="273" height="300"
+
#nav > li
-
>
+
{
 +
float:left;
 +
padding:0;
 +
position:relative;
 +
}
 +
#nav > li > a
 +
{
 +
border:1px solid transparent;
 +
color:#4F4F4F;
 +
display:block;
 +
font-size:90%;
 +
padding:3px 10px;
 +
position:relative;
 +
text-decoration:none;
 +
}
 +
#nav > li > a:hover
 +
{
 +
background-color:#e4ecf4;
 +
border-color:#999;
 +
}
-
<p></br></p>
+
#nav > li.selected  > a
 +
{
 +
background-color:#FFFFFF;
 +
border-color:#999999 #999999 #FFFFFF;
 +
z-index:2;
 +
}
 +
#nav li div
 +
{
 +
    position:relative;
 +
}
 +
#nav li div div
 +
{
 +
background-color:#FFFFFF;
 +
border:1px solid #999999;
 +
padding:12px 0;
 +
display:none;
 +
font-size:0.75em;
 +
margin:0;
 +
position:absolute;
 +
top:-1px;
 +
z-index:1;
 +
width:190px;
 +
}
-
<p>The design of the GBlocks was performed taking into account the following considerations:</p>
+
#nav li div div.wrp2
 +
{
 +
width:380px;
 +
}
-
<ul><li>Codon optimization</li>
+
#nav .sep
 +
{
 +
left:190px;
 +
border-left:1px solid #E3E3E3;
 +
bottom:0;
 +
height:auto;
 +
margin:15px 0;
 +
position:absolute;
 +
top:0;
 +
width:1px;
 +
}
-
<li>Inner restriction sites eliminations by finding synonymous mutations</li>
+
#nav li div ul
 +
{
 +
padding-left:10px;
 +
padding-right:10px;
 +
position:relative;
 +
width:170px;
 +
float:left;
 +
list-style-type:none;
 +
}
-
<li>Addition of GB endings</li>
+
#nav li div ul li  
 +
{
 +
margin:0;
 +
padding:0;
 +
}
-
</ul>
+
#nav li div ul li h3
 +
{
 +
border-bottom:1px solid #E3E3E3;
 +
color:#4F4F4F;
 +
font-weight:bold;
 +
margin:0 5px 4px;
 +
font-size:0.95em;
 +
padding-bottom:3px;
 +
padding-top:3px;
 +
}
 +
#nav li ul ul
 +
{
 +
padding:0 0 8px;
 +
}
 +
#nav li ul ul li
 +
{
 +
margin:0;
 +
padding:0;
 +
}
-
</br><p><h4>06/10/2014</h4></p>
+
#nav li ul li a
 +
{
 +
text-decoration:none; /* Level Team and Photogallery*/
 +
}
 +
#nav li ul ul li a
 +
{
 +
color:#0060A6;
 +
display:block;
 +
margin-bottom:1px;
 +
padding:3px 5px;
 +
text-decoration:none;
 +
font-size:0.9em;
 +
}
 +
#nav li ul ul li a:hover
 +
{
 +
background-color:#0060a6;
 +
color:#fff;
 +
}
-
<p>Codes for IDT known. MEGAGEM2014 - 25% off one order, up to 800 USD</p>
+
/* TEAM ACCORDION STYLE*/
-
<p>GBlocks designed to be compatible with BioBricks and GoldenBraid (GB).</p>
+
.container {
 +
width:80%;
 +
position:relative;
 +
z-index:0;
 +
margin:40px auto;
 +
}
 +
.content {
 +
width:1000px;
 +
margin:0 auto;
 +
}
 +
.va-container{
 +
position:relative;
 +
margin:40px auto 0 auto;
 +
}
 +
.va-wrapper{
 +
width:80%;
 +
height:100%;
 +
position:relative;
 +
overflow:hidden;
 +
background:#000;
 +
}
 +
.va-slice{
 +
cursor:pointer;
 +
position:absolute;
 +
width:100%;
 +
left:0px;
 +
overflow:hidden;
 +
}
 +
.va-slice-1{
 +
background:#000 url(../images/1.jpg) no-repeat center center;
 +
}
 +
.va-slice-2{
 +
background:#000 url(../images/2.jpg) no-repeat center center;
 +
}
 +
.va-slice-3{
 +
background:#000 url(../images/3.jpg) no-repeat center center;
 +
}
 +
.va-slice-4{
 +
background:#000 url(../images/4.jpg) no-repeat center center;
 +
}
 +
.va-slice-5{
 +
background:#000 url(../images/5.jpg) no-repeat center center;
 +
}
 +
.va-slice-Javier{
 +
background:#000 url(https://static.igem.org/mediawiki/2014/3/39/Ivllobel_Team_Javier.png) no-repeat center center;
 +
}
 +
.va-slice-Estefania{
 +
background:#000 url(https://static.igem.org/mediawiki/2014/7/7a/Ivllobel_Team_Estefania.png) no-repeat center center;
 +
}
 +
.va-slice-Ivan{
 +
background:#000 url(https://static.igem.org/mediawiki/2014/3/3b/Ivllobel_Team_Ivan_provisional.png) no-repeat center center;
 +
}
 +
.va-slice-Yadira{
 +
background:#000 url(https://static.igem.org/mediawiki/2014/b/bc/Ivllobel_Team_Yadira.png) no-repeat center center;
 +
}
 +
.va-slice-6{
 +
background:#000 url(../images/6.jpg) no-repeat center center;
 +
}
 +
.va-slice-7{
 +
background:#000 url(../images/Yadira_glteam.jpg) no-repeat center center;
 +
}
 +
.va-slice-color-1{
 +
background-color:#97c5eb;
 +
}
 +
.va-slice-color-2{
 +
background-color:#68ace5;
 +
}
 +
.va-slice-color-3{
 +
background-color:#0072cf;
 +
}
 +
.va-slice-color-4{
 +
background-color:#0039a6;
 +
}
 +
.va-slice-color-5{
 +
background-color:#00338e;
 +
}
 +
.va-slice-color-6{
 +
background-color:#002c76;
 +
}
 +
.va-slice-color-7{
 +
background-color:#002144;
 +
}
 +
.va-title{
 +
font-family: 'Open Sans Condensed', sans-serif;
 +
text-transform:uppercase;
 +
font-size:20px;
 +
margin-left:20px;
 +
color:#FFD700;
 +
text-shadow: 0px 0px 1px #FF8C00;
 +
}
 +
.va-content{
 +
display:none;
 +
margin-left:25px;
 +
}
 +
.va-slice p{
 +
font-size: 22px;
 +
font-style: italic;
 +
font-family:Georgia, serif;
 +
}
 +
.va-slice ul{
 +
margin-top:20px;
 +
}
 +
.va-slice ul li{
 +
float:left;
 +
margin:0px 2px;
 +
}
 +
.va-slice ul li a{
 +
color:#000;
 +
background:#eede2f;
 +
padding:3px 6px;
 +
font-size:14px;
 +
font-family:'PT Sans', sans-serif;
 +
text-transform:uppercase;
 +
}
 +
.va-slice ul li a:hover{
 +
background:#000;
 +
color:#fff;
 +
text-shadow:none;
 +
}
 +
.va-nav span{
 +
width:40px;
 +
height:25px;
 +
background:transparent url(https://static.igem.org/mediawiki/2014/e/e2/Ivllobel_Prev.png) no-repeat center center;
 +
position:absolute;
 +
top:-35px;
 +
left:50%;
 +
margin-left:-20px;
 +
text-indent:-9000px;
 +
opacity:0.7;
 +
cursor:pointer;
 +
display:none;
 +
z-index:100;
 +
}
 +
.va-nav span.va-nav-next{
 +
background-image:url(https://static.igem.org/mediawiki/2014/4/46/Ivllobel_Next.png);
 +
top:auto;
 +
bottom:-35px;
 +
}
 +
.va-nav span:hover{
 +
opacity:1.0;
 +
}
 +
/*TEAM ACCORDION*/
-
</br><p><h4>06/11/2014</h4></p>
+
.more ul{
 +
text-transform:uppercase;
 +
font-size:13px;
 +
padding:50px 0px 30px 0px;
 +
height:30px;
 +
clear:both;
 +
width:1000px;
 +
margin:10px auto 0 auto;
 +
color:#000;
 +
}
 +
.more ul li{
 +
float:left;
 +
margin:0px 2px;
 +
}
 +
.more ul li.selected a, .more ul li.selected a:hover{
 +
background:#000;
 +
color:#fff;
 +
text-shadow:none;
 +
}
 +
.more ul li a{
 +
text-shadow:1px 1px 1px #fff;
 +
color:#555;
 +
background:#f7f7f7;
 +
padding:3px 6px;
 +
-moz-box-shadow:1px 1px 2px #aaa;
 +
-webkit-box-shadow:1px 1px 2px #aaa;
 +
box-shadow:1px 1px 2px #aaa;
 +
}
 +
.more ul li a:hover{
 +
background:#000;
 +
color:#fff;
 +
text-shadow:none;
 +
}
 +
.content{
 +
width:100%;
 +
position:relative;
 +
}
 +
/* Footer Style */
 +
.header{
 +
position:absolute;
 +
width:100%;
 +
height:25px;
 +
line-height:24px;
 +
top:0;
 +
font-size:13px;
 +
background:#000;
 +
opacity:0.9;
 +
text-transform:uppercase;
 +
z-index:4;
 +
}
 +
.header a{
 +
padding:5px 10px;
 +
letter-spacing:1px;
 +
text-shadow:1px 1px 1px #000;
 +
color:#ddd;
 +
text-align:right;
 +
}
 +
.header a:hover{
 +
color:#fff;
 +
}
 +
.header a span{
 +
font-weight:bold;
 +
}
 +
.header span.right_ab{
 +
position:absolute;
 +
right:4px;
 +
}
 +
ul {
 +
list-style:none; /* Button inside images*/
 +
}
 +
ul li a {
 +
text-decoration: none; /* Button inside images*/
 +
}
-
<p>We ordered the following gBlocks and primers.</p>
+
body,div,dl,dt,dd,ul,ol,li,h1,h2,h3,h4,h5,h6,pre,form,fieldset,input,textarea,p,blockquote,th,td {
 +
margin:0;
 +
padding:0;
 +
}
 +
/* END OF THE ACCORDION*/
-
 
+
</style>
-
<ul><li>EaDAcT: <i>Eunymus alatus</i> (adapted for GB) 1127 bp</li>
+
-
 
+
-
<li>HarFAR: <i>Helicoverpa armigera</i> (adapted for GB) 1400 bp</li>
+
-
 
+
-
<li>Atr&Delta;11: <i>Amyelois transitella</i> (order primers for GB) 1000 bp</li>
+
-
 
+
-
<ul><li>I14Jun03 Atr&Delta;11 F1</li>
+
-
 
+
-
<li>I14Jun04 Atr&Delta;11 R1</li>
+
-
 
+
-
</ul><li>FAO1: N.benthamiana primers</li>
+
-
 
+
-
<ul><li>I14Jun01 FAO1 F1</li>
+
-
 
+
-
<li>I14Jun02 FAO1 R1</li>
+
-
 
+
-
</ul></ul>
+
-
 
+
-
<table style="width:300px">
+
-
 
+
-
<tr><td>Name</td><td>Sequence</td><td>Lenght</td><td>Tm (NTI)</td><td>Tm (Phusion)</td></tr>
+
-
 
+
-
<tr><td>I14Jun01_FAO1_F1</td><td>cgccgtctcgctcgaatggagaaaaagagccatcc</td><td>35</td><td>49.9</td><td>62.4</td></tr>
+
-
 
+
-
<tr><td>I14Jun02_FAO1_R1</td><td>cgccgtctcgctcgaagcttatcttgagaatttgccttcttttatc</td><td>46</td><td>54.5</td><td>63.7</td></tr>
+
-
 
+
-
<tr><td>I14Jun03Atr_D11_F1</td><td>gcgccgtctcgctcgaatggttcctaataag</td><td>31</td><td>54.5</td><td>65.3</td></tr>
+
-
 
+
-
<tr><td>I14Jun04Atr_D11_R1</td><td>gcgccgtctcgctcgaagctcaacgtttc</td><td>29</td><td>57</td><td>69.1</td></tr>
+
-
 
+
-
</table>
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>06/24/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>We thought which parts of the GB collection could we use.</p>
+
-
 
+
-
 
+
-
 
+
-
<p>Strategy 1:</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>pP35S, pT35s (x2)</li>
+
-
 
+
-
<li>pAtUbq10, pTAtHSP18.2</li>
+
-
 
+
-
</ul>
+
-
 
+
-
<p>Strategy 2:</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>pP35S, pT35s</li>
+
-
 
+
-
<li>pP35s, pTAtHSP18.2</li>
+
-
 
+
-
<li>pAtUbq10, pTAtHSP18.2</li>
+
-
 
+
-
</ul>
+
-
 
+
-
<p>Strategy 3:</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>pP35S, pT35s</li>
+
-
 
+
-
<li>pP35s, pTTctp</li>
+
-
 
+
-
<li>pAtUbq10, pTAtHSP18.2</li>
+
-
 
+
-
</ul>
+
-
 
+
-
<p>Pieces to take from GB2.0 colection:</p>
+
-
 
+
-
 
+
-
 
+
-
<table style="width:300px">
+
-
 
+
-
<tr><td>pDGB2&alpha;1</td><td>GB0483</td><td>Kan</td></tr>
+
-
 
+
-
<tr><td>pDGB2&alpha;2</td><td>GB0484</td><td>Kan</td></tr>
+
-
 
+
-
<tr><td>pP35s</td><td>GB0030</td><td>Amp</td></tr>
+
-
 
+
-
<tr><td>pT35s</td><td>GB0036</td><td>Amp</td></tr>
+
-
 
+
-
<tr><td>pAtUbq10</td><td>GB0223</td><td>Amp</td></tr>
+
-
 
+
-
<tr><td>pTAtHSP18.2</td><td>GB0035</td><td>Amp</td></tr>
+
-
 
+
-
<tr><td>pTTctp</td><td>GB0081</td><td>Amp</td></tr>
+
-
 
+
-
<tr><td>pUPD</td><td>GB0317</td><td>Amp</td></tr>
+
-
 
+
-
</table>
+
-
 
+
-
 
+
-
 
+
-
<p>Later we will need:</p>
+
-
 
+
-
 
+
-
 
+
-
<table style="width:300px">
+
-
 
+
-
<tr><td>pDGB2&Omega;1</td><td>GB0487</td><td>Smp</td></tr>
+
-
 
+
-
<tr><td>pDGB2&Omega;2</td><td>GB0488</td><td>Smp</td></tr>
+
-
 
+
-
</table>
+
-
 
+
-
 
+
-
 
+
-
<p>Prepare plaques with antibiotics Kan, Spm, Amp</p>
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>06/25/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>Grow the selected pieces from the GB collection in liquid medium (performed in laminar air flow cabinet).</p>
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>06/26/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>Culture in agar Petri dish. 2 plaques: Amp and Kan.</p>
+
-
 
+
-
 
+
-
 
+
-
<p>Minipreps with EZNA Plasmid DNA MiniKit I.</p>
+
-
 
+
-
 
+
-
 
+
-
<p>Expected digestions:</p>
+
-
 
+
-
 
+
-
 
+
-
<table style="width:300px">
+
-
 
+
-
<tr><td>pP35s </td><td>GB0030</td><td>NotI</td><td>Buffer: Orange</td><td>2981, 1105</td></tr>
+
-
 
+
-
<tr><td>pT35s </td><td>GB0036</td><td>NotI</td><td>Buffer: Orange</td><td>2981, 304</td></tr>
+
-
 
+
-
<tr><td>pAtUbq10 </td><td>GB0223</td><td>NotI</td><td>Buffer: Orange</td><td>2981, 714</td></tr>
+
-
 
+
-
<tr><td>pTAtHSP18.2 </td><td>GB0035</td><td>NotI</td><td>Buffer: Orange</td><td>2981, 328</td></tr>
+
-
 
+
-
<tr><td>pTTctp </td><td>GB0081</td><td>NotI</td><td>Buffer: Orange</td><td>2981, 487</td></tr>
+
-
 
+
-
</table>
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
<p>Electrophoresis analysis.</p>
+
-
 
+
-
 
+
-
 
+
-
<img src=https://static.igem.org/mediawiki/2014/d/d9/20140626_piezas_coleccion.png width="212" height="388"
+
-
>
+
-
 
+
-
 
+
-
 
+
-
<p>We got the expected bands in all cases.</p>
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/01/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>Atr&Delta;11 amplification by PCR with primers that contain extra nucleotides to introduce them in the sequence. </p>
+
-
 
+
-
<p>We made a PCR amplification using the Atr&Delta;11 gene as a template and the oligos: R +F</p>
+
-
 
+
-
 
+
-
 
+
-
<p>Reagents needed:</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>32.5 &mu;L of H2O miliQ</li>
+
-
 
+
-
<li>10 &mu;L HF buffer </li>
+
-
 
+
-
<li>2 &mu;L dNTPs</li>
+
-
 
+
-
<li>2.5 &mu;L Reverse primer</li>
+
-
 
+
-
<li>2.5 &mu;L Forward primer</li>
+
-
 
+
-
<li>1 &mu;L template (Atr&Delta;11 gene)</li>
+
-
 
+
-
<li>0.5 &mu;L phusion (polimerase)</li>
+
-
 
+
-
</ul>
+
-
 
+
-
<p>PCR parameters: The annealing temperature was 60ºC and the extension temperature was 65ºC. </p>
+
-
 
+
-
 
+
-
 
+
-
<p>Electrophoresis performed to check the PCR product, which was expected to be around 1 kb. </p>
+
-
 
+
-
 
+
-
 
+
-
<img src=https://static.igem.org/mediawiki/2014/6/6a/20140701_pcr_gblock_atrd11.png
+
-
>
+
-
 
+
-
 
+
-
 
+
-
<p>pUPD ligation of EaDAcT, HarFar and Atr&Delta;11</p>
+
-
 
+
-
 
+
-
 
+
-
<p>Reagents needed for the reaction of ligation:</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>1 &mu;L pUPD</li>
+
-
 
+
-
<li>1 &mu;L PCR product/gblock product  </li>
+
-
 
+
-
<li>1.2 &mu;L buffer 10x</li>
+
-
 
+
-
<li>1 &mu;L BsmBI</li>
+
-
 
+
-
<li>1 &mu;L T4 ligase</li>
+
-
 
+
-
<li>6.8 &mu;L H2O miliQ</li>
+
-
 
+
-
</ul>
+
-
 
+
-
<p>Vfinal= 12 &mu;L</p>
+
-
 
+
-
 
+
-
 
+
-
<p>Termocycler parameters: The ligase temperature was 16ºC and the BsmBI temperature was 37ºC. </p>
+
-
 
+
-
 
+
-
 
+
-
<p>As a result, there are obtained three different pUPD plasmids containing the genes EaDAcT, HarFAR and Atr&Delta;11.</p>
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/02/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p><i>E. coli</i> transformation</p>
+
-
 
+
-
 
+
-
 
+
-
<p>This step is performed in a laminar air flow cabinet (LAF). </p>
+
-
 
+
-
<p>We have used an electrocompetent <i>E. coli</i> strain (DH5&alpha;) and a sample from each product of ligation made in the previous step (three pUPD plasmids, each of them containing one of the three genes), so transformation is made three times.</p>
+
-
 
+
-
 
+
-
 
+
-
<p>Reagents needed:</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li><i>E. coli</i> aliquot</li>
+
-
 
+
-
<li>1.5 &mu;L of ligation in pUPD (for each gene: EaDAcT, HarFAR, Atr&Delta;11)</li>
+
-
 
+
-
</ul>
+
-
 
+
-
<p>Each mix is introduced in a electroporation vial and electroporated at 1500 V, then 300 &mu;L of SOC are added to each vial. All of them were incubated at 37ºC for 1 hour.</p>
+
-
 
+
-
 
+
-
 
+
-
<p>After incubation, culture in Petri plates (always in a LAF).</p>
+
-
 
+
-
<p>2 cell-culture dishes per transformation (with Ampicillin), one with 50 &mu;L and the other with the remaining volume. </p>
+
-
 
+
-
<p>Petri plates are incubated at 37ºC for 16 h.</p>
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/03/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>Transformed colonies selection. The white ones are recultured in liquid medium. One colony of each transformation is picked and cultured in 3.5 mL LB and 7 &mu;L Amp. This step is repeated three times:</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>3x 1 colony of EaDAcT in pUPD + LB + Amp</li>
+
-
 
+
-
<li>3x 1 colony of HarFAR in pUPD + LB + Amp</li>
+
-
 
+
-
<li>3x 1 colony of Atr&Delta;11 in pUPD + LB + Amp</li>
+
-
 
+
-
</ul>
+
-
 
+
-
<p>All tubes are incubated at 37ºC overnight in agitation.</p>
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/04/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>Digestions in silico using Vector NTI to check after minipreps if ligations are correct.</p>
+
-
 
+
-
 
+
-
 
+
-
<table style="width:300px">
+
-
 
+
-
<tr><td>EaDAcT</td><td>NotI</td><td>2981, 1167</td></tr>
+
-
 
+
-
<tr><td></td><td>RsaI</td><td>1876, 1343, 532, 306, 91</td></tr>
+
-
 
+
-
<tr><td>HarFAR</td><td>NotI</td><td>2981, 1440</td></tr>
+
-
 
+
-
<tr><td></td><td>PvuII</td><td>2564, 1394, 463</td></tr>
+
-
 
+
-
<tr><td>Atr&Delta;11</td><td>NotI</td><td>2981, 1056</td></tr>
+
-
 
+
-
<tr><td></td><td>BanII</td><td>2570, 803, 351, 314</td></tr>
+
-
 
+
-
</table>
+
-
 
+
-
 
+
-
 
+
-
<p>Digestion reagents:</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>0.5 &mu;L restriction enzyme</li>
+
-
 
+
-
<li>2.5 &mu;L buffer</li>
+
-
 
+
-
<li>21 &mu;L H20 (miliQ)</li>
+
-
 
+
-
<li>1 &mu;L sample</li>
+
-
 
+
-
</ul>
+
-
 
+
-
<p>Preparation of master mixes</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>Master mix for NotI</li>
+
-
 
+
-
<ul><li>5 &mu;L NotI</li>
+
-
 
+
-
<li>25 &mu;L Orange</li>
+
-
 
+
-
<li>210 &mu;L H20</li>
+
-
 
+
-
</ul><li>Master mix for RsaI</li>
+
-
 
+
-
<ul><li>1.5 &mu;L RsaI</li>
+
-
 
+
-
<li>7.5 &mu;L Tango</li>
+
-
 
+
-
<li>63 &mu;L H20</li>
+
-
 
+
-
</ul><li>Master mix for PvuII</li>
+
-
 
+
-
<ul><li>1.5 &mu;L PvuII</li>
+
-
 
+
-
<li>7.5 &mu;L Green</li>
+
-
 
+
-
<li>63 &mu;L H20</li>
+
-
 
+
-
</ul><li>Master mix for BanII</li>
+
-
 
+
-
<ul><li>1.5 &mu;L BanII</li>
+
-
 
+
-
<li>7.5 &mu;L Tango</li>
+
-
 
+
-
<li>63 &mu;L H20</li>
+
-
 
+
-
</ul></ul>
+
-
 
+
-
<p>Perform electrophoresis to check if the size of the fragments from the digestions is correct.</p>
+
-
 
+
-
 
+
-
 
+
-
<img src=https://static.igem.org/mediawiki/2014/d/d5/20140704_digestiones_ligaciones.png
+
-
>
+
-
 
+
-
 
+
-
 
+
-
<p>Comments:</p>
+
-
 
+
-
<ul><li>We picked blue colonies instead of white by mistake. We need to pick colonies again but this time make sure we pick white colonies.</li>
+
-
 
+
-
<li>For the repetition we must find another enzyme instead of BanII as we found out that it doesn't cut very well.</li>
+
-
 
+
-
</ul>
+
-
 
+
-
</br><p><h4>07/06/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>We picked again 3 colonies for each construction, and we made sure that we picked the WHITE ones. We cultivated them in a "double check" (name invented by us)  liquid medium. Those tubes contain:</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>3.5 mL LB</li>
+
-
 
+
-
<li>7 &mu;L Amp</li>
+
-
 
+
-
<li>7 &mu;L X-Gal</li>
+
-
 
+
-
<li>3.5 &mu;L IPTG (turns the tube blue if the colonies picked were blue)</li>
+
-
 
+
-
</ul>
+
-
 
+
-
</br><p><h4>07/07/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>We made minipreps of yesterday's culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes HarFAR 1, 2, 3; EaDAcT 3 and Atr&Delta;11 2, 3.</p>
+
-
 
+
-
 
+
-
 
+
-
<p>Once we had the minipreps, we perform the digestions to check which were correct and send them to sequencing. This time we selected RsaI instead of BanII. The in silico digestions were as follows.</p>
+
-
 
+
-
 
+
-
 
+
-
<table style="width:300px">
+
-
 
+
-
<tr><td>EaDAcT</td><td>NotI</td><td>2981, 1167</td></tr>
+
-
 
+
-
<tr><td></td><td>RsaI</td><td>1876, 1343, 532, 306, 91</td></tr>
+
-
 
+
-
<tr><td>HarFAR</td><td>NotI</td><td>2981, 1440</td></tr>
+
-
 
+
-
<tr><td></td><td>PvuII</td><td>2564, 1394, 463</td></tr>
+
-
 
+
-
<tr><td>Atr&Delta;11</td><td>NotI</td><td>2981, 1056</td></tr>
+
-
 
+
-
<tr><td></td><td>RsaI</td><td>1879, 1310, 467, 327, 54</td></tr>
+
-
 
+
-
</table>
+
-
 
+
-
 
+
-
 
+
-
<p>Preparation of master mixes</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>Master mix for NotI</li>
+
-
 
+
-
<ul><li>3.5 &mu;L NotI</li>
+
-
 
+
-
<li>17.5 &mu;L Orange</li>
+
-
 
+
-
<li>147 &mu;L H20</li>
+
-
 
+
-
</ul><li>Master mix for RsaI</li>
+
-
 
+
-
<ul><li>2 &mu;L RsaI</li>
+
-
 
+
-
<li>10 &mu;L Tango</li>
+
-
 
+
-
<li>84 &mu;L H20</li>
+
-
 
+
-
</ul><li>Master mix for PvuII</li>
+
-
 
+
-
<ul><li>2 &mu;L PvuII</li>
+
-
 
+
-
<li>10 &mu;L Green</li>
+
-
 
+
-
<li>84 &mu;L H20</li>
+
-
 
+
-
</ul></ul>
+
-
 
+
-
<p>We run the electrophoresis gel to check if this time we have done it correctly.</p>
+
-
 
+
-
 
+
-
 
+
-
<img src=https://static.igem.org/mediawiki/2014/c/ca/20140707_digestiones_ligaciones2.png
+
-
>
+
-
 
+
-
 
+
-
 
+
-
<p>Everything was OK. We sent Atr&Delta;11 (3), HarFAR (3) and EaDAcT (3) to sequence.</p>
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/08/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>Now, while we wait for sequencing results, we go on as they were going to be correct in order to save time.</p>
+
-
 
+
-
 
+
-
 
+
-
<p>The next step is to build a transciptional unit (TU) with our sequences. A transcriptional unit is a structure composed by promoter, coding sequence (CDS) and terminator in an &alpha; or &Omega; vector.</p>
+
-
 
+
-
 
+
-
 
+
-
<p>Reagents needed for ligation:</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>1 &mu;L promoter 75 ng/&mu;L</li>
+
-
 
+
-
<li>1 &mu;L terminator 75 ng/&mu;L</li>
+
-
 
+
-
<li>1 &mu;L CDS 75 ng/&mu;L</li>
+
-
 
+
-
<li>1 &mu;L vector &alpha;</li>
+
-
 
+
-
<li>1.2 &mu;L ligase buffer 10x</li>
+
-
 
+
-
<li>1 &mu;L T4</li>
+
-
 
+
-
<li>1 &mu;L BsaI</li>
+
-
 
+
-
<li>4.2 &mu;L H20</li>
+
-
 
+
-
</ul>
+
-
 
+
-
<p>Total: 12 &mu;L</p>
+
-
 
+
-
 
+
-
 
+
-
<p>Take into account that if we want to make binary constructions later (merge 2 TU in a same vector), we need to clone each TU in a different &alpha; vector.</p>
+
-
 
+
-
 
+
-
 
+
-
<p>Strategy Promoter-Terminator:</p>
+
-
 
+
-
 
+
-
 
+
-
<table style="width:300px">
+
-
 
+
-
<tr><td>Atr&Delta;11</td><td>P35s</td><td>T35s</td><td>40.41</td></tr>
+
-
 
+
-
<tr><td>HarFAR</td><td>P35s</td><td>TatHSP</td><td>39.68</td></tr>
+
-
 
+
-
<tr><td>EaDAcT</td><td>PAtUbq</td><td>TatHSP</td><td>32.27</td></tr>
+
-
 
+
-
</table>
+
-
 
+
-
 
+
-
 
+
-
<p>Adjust concentrations to 75 ng/&mu;L for ligation reaction</p>
+
-
 
+
-
 
+
-
 
+
-
<p>Initial concentrations (nanodrop):</p>
+
-
 
+
-
 
+
-
 
+
-
<table style="width:300px">
+
-
 
+
-
<tr><td>Piece</td><td>Concentrations</td><td>Volume</td><td>Volume of H20 to add</td></tr>
+
-
 
+
-
<tr><td>PAtUpb</td><td>442.6 ng/&mu;L</td><td>34 &mu;L</td><td>166.6 &mu;L</td></tr>
+
-
 
+
-
<tr><td>pTatHSP</td><td>235.4 ng/&mu;L</td><td>36 &mu;L</td><td>77 &mu;L</td></tr>
+
-
 
+
-
<tr><td>T35s</td><td>194.9 ng/&mu;L</td><td>37.5 &mu;L</td><td>60 &mu;L</td></tr>
+
-
 
+
-
<tr><td>P35s</td><td>454.7 ng/&mu;L</td><td>36 &mu;L</td><td>182 &mu;L</td></tr>
+
-
 
+
-
<tr><td>2&alpha;1</td><td>57.1 ng/&mu;L</td><td>-</td><td>We will need to put 1.5 &mu;L of this one</td></tr>
+
-
 
+
-
<tr><td>2&alpha;2</td><td>104.0 ng/&mu;L</td><td>38 &mu;L</td><td>14.7 &mu;L</td></tr>
+
-
 
+
-
<tr><td>Atr&Delta;11</td><td>359.3 ng/&mu;L</td><td>20 &mu;L</td><td>75.8 &mu;L</td></tr>
+
-
 
+
-
<tr><td>HarFAR</td><td>404.4 ng/&mu;L</td><td>15 &mu;L</td><td>65.9 &mu;L</td></tr>
+
-
 
+
-
<tr><td>EaDAcT</td><td>155.6 ng/&mu;L</td><td>10 &mu;L</td><td>10.7 &mu;L</td></tr>
+
-
 
+
-
</table>
+
-
 
+
-
 
+
-
 
+
-
<p>Ligation reaction</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>P35s:Atr&Delta;11:T35s in 2&alpha;1</li>
+
-
 
+
-
<ul><li>1 &mu;L P35s</li>
+
-
 
+
-
<li>1 &mu;L T35s</li>
+
-
 
+
-
<li>1 &mu;L Atr&Delta;11</li>
+
-
 
+
-
<li>1.5 &mu;L 2&alpha;1</li>
+
-
 
+
-
<li>1.2 &mu;L ligase buffer 10x</li>
+
-
 
+
-
<li>1 &mu;L T4</li>
+
-
 
+
-
<li>1 &mu;L BsaI</li>
+
-
 
+
-
<li>3.7 &mu;L H20</li>
+
-
 
+
-
</ul></ul>
+
-
 
+
-
<ul><li>P35s:HarFAR:TatHSP in 2&alpha;2</li>
+
-
 
+
-
<ul><li>1 &mu;L P35s</li>
+
-
 
+
-
<li>1 &mu;L TatHSP</li>
+
-
 
+
-
<li>1 &mu;L HarFAR</li>
+
-
 
+
-
<li>1 &mu;L 2&alpha;2</li>
+
-
 
+
-
<li>1.2 &mu;L ligase buffer 10x</li>
+
-
 
+
-
<li>1 &mu;L T4</li>
+
-
 
+
-
<li>1 &mu;L BsaI</li>
+
-
 
+
-
<li>4.2 &mu;L H20</li>
+
-
 
+
-
</ul></ul>
+
-
 
+
-
<ul><li>PAtUbq:EaDAcT:TatHSP in 2&alpha;2</li>
+
-
 
+
-
<ul><li>1 &mu;L PAtUbq</li>
+
-
 
+
-
<li>1 &mu;L TatHSP</li>
+
-
 
+
-
<li>1 &mu;L EaDAcT</li>
+
-
 
+
-
<li>1 &mu;L 2&alpha;2</li>
+
-
 
+
-
<li>1.2 &mu;L ligase buffer 10x</li>
+
-
 
+
-
<li>1 &mu;L T4</li>
+
-
 
+
-
<li>1 &mu;L BsaI</li>
+
-
 
+
-
<li>4.2 &mu;L H20</li>
+
-
 
+
-
</ul></ul>
+
-
 
+
-
</br><p><h4>07/09/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>Transformation of constructions in <i>E. coli</i></p>
+
-
 
+
-
 
+
-
 
+
-
<p>We finally got the sequencing results from 07/07/2014.</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>Mutation in Atr&Delta;11 -> We threw away the colonies and transformed cells. We picked again white colonies.</li>
+
-
 
+
-
<li>HarFAR -> Sequencing correct</li>
+
-
 
+
-
<li>EaDAcT -> Synonim mutation in 601 (A -> T). This is a gBlock!</li>
+
-
 
+
-
</ul>
+
-
 
+
-
<p>We took vectors 2&Omega;1 (GB0487) and 2&Omega;2 (GB0488) parts from the GB colection.</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>Worked in the LAF</li>
+
-
 
+
-
<li>Cultivated in a Petri dish with Spm</li>
+
-
 
+
-
<li>Let them grow for one day</li>
+
-
 
+
-
</ul>
+
-
 
+
-
<p>Cultivate transformated cells in two Kan plaques (Kan matches vector &alpha;)</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>50 mL transformation in one plaque</li>
+
-
 
+
-
<li>Rest of the culture in another (250 &mu;L aprox)</li>
+
-
 
+
-
<li>Let them grow for one day</li>
+
-
 
+
-
</ul>
+
-
 
+
-
</br><p><h4>07/10/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>Pick colonies and grow them in liquid medium.</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>6 from Atr&Delta;11 (repetition because of mutation)</li>
+
-
 
+
-
<ul><li>3.5 mL LB</li>
+
-
 
+
-
<li>7 &mu;L Amp</li>
+
-
 
+
-
<li>7 &mu;L X-gal</li>
+
-
 
+
-
<li>3.5 &mu;L IPTG</li>
+
-
 
+
-
</ul><li>1 colony from 2&Omega;1</li>
+
-
 
+
-
<ul><li>3.5 mL LB</li>
+
-
 
+
-
<li>7 &mu;L Spm</li>
+
-
 
+
-
</ul></ul>
+
-
 
+
-
<ul><li>1 colony from 2&Omega;2</li>
+
-
 
+
-
<ul><li>3.5 mL LB</li>
+
-
 
+
-
<li>7 &mu;L Spm</li>
+
-
 
+
-
</ul><li>3 colonies from P35s:HarFAR:TatHSP</li>
+
-
 
+
-
<ul><li>3.5 mL LB</li>
+
-
 
+
-
<li>7 &mu;L Kan</li>
+
-
 
+
-
</ul><li>3 colonies from PAtUbq:EaDAcT:TatHSP</li>
+
-
 
+
-
<ul><li>3.5 mL LB</li>
+
-
 
+
-
<li>7 &mu;L Kan</li>
+
-
 
+
-
</ul></ul>
+
-
 
+
-
<p>Grow at 37ºC in agitation overnight.</p>
+
-
 
+
-
 
+
-
 
+
-
<p>We have checked the promoters and terminators are both compatible with GB and BioBricks.</p>
+
-
 
+
-
<p>Only P35s and T35s work for both. pPnos could also work.</p>
+
-
 
+
-
 
+
-
 
+
-
<p>Pick 3 colonies of P35s:HarFAR:THsp and PAtUbq:EaDAcT:THsp. Culture in liquid medium with Kan.</p>
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/11/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>We made minipreps of yesterday's liquid culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes Atr&Delta;11 3 and 6; 2&Omega;1; 2&Omega;2; constructions P35s:HarFAR:TatHSP 1, 2, 3 and PAtUbq:EaDAcT:TatHSP 1, 2, 3.</p>
+
-
 
+
-
 
+
-
 
+
-
<p>Additionally, we have cultured each of the colonies named above to store them.</p>
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/14/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>We tested the minipreps made last friday by digestion. Once they were checked, we send the correct ones to sequencing. The in silico digestions were as follows.</p>
+
-
 
+
-
 
+
-
 
+
-
<table style="width:300px">
+
-
 
+
-
<tr><td>Parts</td><td>Retriction enzyme</td><td>Expected Bands</td></tr>
+
-
 
+
-
<tr><td>PAtUbq:EaDAcT:TatHSP in 2&alpha;2</td><td>HindIII</td><td>6322, 1722, 736, 221</td></tr>
+
-
 
+
-
<tr><td>P35s:HarFAR:TatHSP in 2 &alpha;2</td><td>HindIII</td><td>6322, 1794, 221</td></tr>
+
-
 
+
-
<tr><td>Atr&Delta;11</td><td>NotI</td><td>2961, 1056</td></tr>
+
-
 
+
-
<tr><td>2&Omega;1</td><td>BamHI</td><td>6652, 382, 239</td></tr>
+
-
 
+
-
<tr><td>2&Omega;2</td><td>EcoRV</td><td>6652, 621</td></tr>
+
-
 
+
-
</table>
+
-
 
+
-
 
+
-
 
+
-
<p>Preparation of master mixes</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>Master mix for HindIII</li>
+
-
 
+
-
<ul><li>3.5 &mu;L HindIII</li>
+
-
 
+
-
<li>17.5 &mu;L Red</li>
+
-
 
+
-
<li>147 &mu;L H20</li>
+
-
 
+
-
</ul><li>Master mix for NotI</li>
+
-
 
+
-
<ul><li>1.5 &mu;L NotI</li>
+
-
 
+
-
<li>7.5 &mu;L Orange</li>
+
-
 
+
-
<li>63 &mu;L H20</li>
+
-
 
+
-
</ul><li>Mix for EcoRV</li>
+
-
 
+
-
<ul><li>0.5 &mu;L EcoRV</li>
+
-
 
+
-
<li>2.5 &mu;L Red</li>
+
-
 
+
-
<li>21 &mu;L H20</li>
+
-
 
+
-
</ul><li>Mix for BamHI</li>
+
-
 
+
-
<ul><li>0.5 &mu;L PvuII</li>
+
-
 
+
-
<li>2.5 &mu;L Green</li>
+
-
 
+
-
<li>21 &mu;L H20</li>
+
-
 
+
-
</ul></ul>
+
-
 
+
-
 
+
-
 
+
-
<p>We run the electrophoresis gel to check if this time we have done it correctly.</p>
+
-
 
+
-
 
+
-
 
+
-
<img src=https://static.igem.org/mediawiki/2014/7/7a/20140714_digestion_ligaciones.png
+
-
>
+
-
 
+
-
 
+
-
 
+
-
<p>Everything was OK except the Atr&Delta;11 (3), which had some partial digestion. It was the reason we sent Atr&Delta;11 (6) to sequence.</p>
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/15/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>We got the sequencing results from yesterday and everything was OK, so we made the transcriptional units ligation. </p>
+
-
 
+
-
 
+
-
 
+
-
<p>Reagents needed for the reaction of ligation (Total volume = 12 &mu;L):</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>P35s:Atr&Delta;11:T35s in 2&alpha;1</li>
+
-
 
+
-
<ul><li>1 &mu;L P35s</li>
+
-
 
+
-
<li>1 &mu;L T35s</li>
+
-
 
+
-
<li>1 &mu;L Atr&Delta;11</li>
+
-
 
+
-
<li>1.5 &mu;L 2&alpha;1</li>
+
-
 
+
-
<li>1.2 &mu;L ligase buffer 10x</li>
+
-
 
+
-
<li>1 &mu;L T4</li>
+
-
 
+
-
<li>1 &mu;L BsaI</li>
+
-
 
+
-
<li>3.7 &mu;L H20</li>
+
-
 
+
-
</ul><li>P35s:HarFAR:T35s in 2&alpha;2</li>
+
-
 
+
-
<ul><li>1 &mu;L P35s</li>
+
-
 
+
-
<li>1 &mu;L T35s</li>
+
-
 
+
-
<li>1 &mu;L HarFAR</li>
+
-
 
+
-
<li>1 &mu;L 2&alpha;2</li>
+
-
 
+
-
<li>1.2 &mu;L ligase buffer 10x</li>
+
-
 
+
-
<li>1 &mu;L T4</li>
+
-
 
+
-
<li>1 &mu;L BsaI</li>
+
-
 
+
-
<li>4.2 &mu;L H20</li>
+
-
 
+
-
</ul><li>P35s:EaDAcT:T35s in 2&alpha;2</li>
+
-
 
+
-
<ul><li>1 &mu;L P35s</li>
+
-
 
+
-
<li>1 &mu;L T35s</li>
+
-
 
+
-
<li>1 &mu;L EaDAcT</li>
+
-
 
+
-
<li>1 &mu;L 2&alpha;2</li>
+
-
 
+
-
<li>1.2 &mu;L ligase buffer 10x</li>
+
-
 
+
-
<li>1 &mu;L T4</li>
+
-
 
+
-
<li>1 &mu;L BsaI</li>
+
-
 
+
-
<li>4.2 &mu;L H20</li>
+
-
 
+
-
</ul></ul>
+
-
 
+
-
<p>Note: Concentrations were previously adjusted to 75 ng/&mu;L. Only the Atr&Delta;11 was adjusted from 250.2 ng/&mu;L.</p>
+
-
 
+
-
 
+
-
 
+
-
<p>Finally, we prepared liquid cultures in order to store in glicerol. The tubes we used and their respective antibiotics were:</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>Amp</li>
+
-
 
+
-
<ul><li>pAtr&Delta;11 (6)</li>
+
-
 
+
-
<li>pEaDAcT (3)</li>
+
-
 
+
-
<li>pHarFAR (3)</li>
+
-
 
+
-
</ul><li>Kan</li>
+
-
 
+
-
<ul><li>P35:HarFAR:TatHSP in 2&alpha;2 (3)</li>
+
-
 
+
-
<li>PPAtUbq:EaDAcT:TatHSP in 2apha2 (3)</li>
+
-
 
+
-
</ul></ul>
+
-
 
+
-
</br><p><h4>07/16/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>Storage in glycerol of the HarFAR (GB1018), Atr&Delta;11 (GB1019), EaDAcT (GB1020), P35s:HarFAR:TatHSP in 2&alpha;2 (GB1021) and PAtUbq:EaDAcT:TatHSP in 2&alpha;2 (GB1022). We made 3 tubes: one for us, one for the GB collenction and one for reserve. </p>
+
-
 
+
-
 
+
-
 
+
-
<p>The procedure is to mix 700 &mu;L of culture with 300 &mu;L of glycerol 50%, spin it and store it in the -80ºC.</p>
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/17/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>Pick 3 colonies of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Culture in liquid medium with Kan.</p>
+
-
 
+
-
 
+
-
 
+
-
<p>Digestions in silico.</p>
+
-
 
+
-
 
+
-
 
+
-
<table style="width:300px">
+
-
 
+
-
<tr><td>Transcriptional units</td><td>Restriction enzymes</td><td>Expected bands</td></tr>
+
-
 
+
-
<tr><td>P35s:Atr&Delta;11:T35s</td><td>EcoRI</td><td>6323, 2269</td></tr>
+
-
 
+
-
<tr><td></td><td>NcoI</td><td>390, 8202</td></tr>
+
-
 
+
-
<tr><td>P35s:HarFAR:T35s</td><td>HindIII</td><td>933, 6322, 1722</td></tr>
+
-
 
+
-
<tr><td></td><td>NcoI</td><td>8587, 390</td></tr>
+
-
 
+
-
<tr><td>P35s:EaDAcT:T35s</td><td>HindIII</td><td>6322, 2366</td></tr>
+
-
 
+
-
<tr><td></td><td>EcoRV</td><td>683, 8021</td></tr>
+
-
 
+
-
</table>
+
-
 
+
-
 
+
-
 
+
-
<p>Preparation of reagents needed for genomic extraction of <i>Candida tropicalis</i> for FAO1.</p>
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/18/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>Mistake in P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s minipreps. Repeat tomorrow.</p>
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/19/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>Minipreps of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Concentration measuments with nanodrop.</p>
+
-
 
+
-
 
+
-
 
+
-
<table style="width:300px">
+
-
 
+
-
<tr><td>Transcriptional unit </td><td>DNA concentration</td></tr>
+
-
 
+
-
<tr><td>P35s:Atr&Delta;11:T35s (1)</td><td>164 ng/&mu;L</td></tr>
+
-
 
+
-
<tr><td>P35s:Atr&Delta;11:T35s (2)</td><td>168 ng/&mu;L</td></tr>
+
-
 
+
-
<tr><td>P35s:Atr&Delta;11:T35s (3)</td><td>147.4 ng/&mu;L</td></tr>
+
-
 
+
-
<tr><td>P35s:HarFAR:T35s (1)</td><td>125.3 ng/&mu;L</td></tr>
+
-
 
+
-
<tr><td>P35s:HarFAR:T35s (2)</td><td>114.5 ng/&mu;L</td></tr>
+
-
 
+
-
<tr><td>P35s:HarFAR:T35s (3)</td><td>140.3 ng/&mu;L</td></tr>
+
-
 
+
-
<tr><td>P35s:EaDAcT:T35s (1)</td><td>144.2 ng/&mu;L</td></tr>
+
-
 
+
-
<tr><td>P35s:EaDAcT:T35s (2)</td><td>137.9 ng/&mu;L</td></tr>
+
-
 
+
-
<tr><td>P35s:EaDAcT:T35s (3)</td><td>128.5 ng/&mu;L</td></tr>
+
-
 
+
-
<tr><td>Stuffer fragment</td><td>135.5 ng/&mu;L</td></tr>
+
-
 
+
-
<tr><td>2&Omega;1</td><td>196.8 ng/&mu;L</td></tr>
+
-
 
+
-
<tr><td>2&Omega;2</td><td>175.4 ng/&mu;L</td></tr>
+
-
 
+
-
</table>
+
-
 
+
-
 
+
-
 
+
-
<p>Digestions of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s and gel electrophoresis to check if transciptional units have been assembled OK.</p>
+
-
 
+
-
 
+
-
 
+
-
<img src=https://static.igem.org/mediawiki/2014/3/3c/20140719_digestiones_TU.png
+
-
>
+
-
 
+
-
 
+
-
 
+
-
<p>All digestions were correct except P35s:EaDAcT:T35s (2).</p>
+
-
 
+
-
 
+
-
 
+
-
<p>Ligation in &Omega; vectors.</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>P35s:Atr&Delta;11:T35s + P35s:HarFAR:T35s in 2&Omega;1</li>
+
-
 
+
-
<ul><li>1 &mu;L P35s:Atr&Delta;11:T35s (75 ng/&mu;L)</li>
+
-
 
+
-
<li>1 &mu;L P35s:HarFAR:T35s (75 ng/&mu;L)</li>
+
-
 
+
-
<li>1 &mu;L 2&Omega;1 (75 ng/&mu;L)</li>
+
-
 
+
-
<li>1 &mu;L BsmBI (5-10 ud)</li>
+
-
 
+
-
<li>1 &mu;L T4 ligase (5-10 ud)</li>
+
-
 
+
-
<li>1 &mu;L buffer ligase (3 ud)</li>
+
-
 
+
-
<li>4 &mu;L H20</li>
+
-
 
+
-
</ul><li>P35s:EaDAcT:T35s in 2&Omega;2</li>
+
-
 
+
-
<ul><li>1 &mu;L stuffer fragment (75 ng/&mu;L)</li>
+
-
 
+
-
<li>1 &mu;L P35s:EaDAcT:T35s (75 ng/&mu;L)</li>
+
-
 
+
-
<li>1 &mu;L 2&Omega;2 (75 ng/&mu;L)</li>
+
-
 
+
-
<li>1 &mu;L BsmBI (5-10 ud)</li>
+
-
 
+
-
<li>1 &mu;L T4 ligase (5-10 ud)</li>
+
-
 
+
-
<li>1 &mu;L buffer ligase (3 ud)</li>
+
-
 
+
-
<li>4 &mu;L H20</li>
+
-
 
+
-
</ul></ul>
+
-
 
+
-
<p>Set the reaction: 25 cycles x (37ºC 2 min, 16ºC 5 min).</p>
+
-
 
+
-
 
+
-
 
+
-
<p>Omega vectors include a resistance to spectinomycin.</p>
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/20/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>Transform and grow in Petri dishes yesterday's ligations: P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1 and P35S:EaDAcT:T35S in 2&Omega;2.</p>
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/21/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>Pick colonies of P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1 (3) and P35S:EaDAcT:T35S in 2&Omega;2 (2).</p>
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/22/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>We made minipreps of yesterday's liquid culture. Selected tubes: </p>
+
-
 
+
-
<ul><li>P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1(Tubes 1, 2 and 3)</li>
+
-
 
+
-
<li>P35S:EaDAcT:T35S in 2&Omega;2 (Tubes 1 and 2)</li>
+
-
 
+
-
</ul>
+
-
 
+
-
 
+
-
 
+
-
<p>Digestions in silico made to check the transcriptional units:</p>
+
-
 
+
-
 
+
-
 
+
-
<table style="width:300px">
+
-
 
+
-
<tr><td>Transcriptional units</td><td>Restriction enzyme</td><td>Expected bands</td></tr>
+
-
 
+
-
<tr><td>P35S:Atr&Delta;11:T35S+P35S:HarFAR:T35S in 2&Omega;1</td><td>EcoRV</td><td>9307, 2251</td></tr>
+
-
 
+
-
<tr><td></td><td>BamHI</td><td>6652, 4906</td></tr>
+
-
 
+
-
<tr><td>P35S:EaDAcT:T35S in 2&Omega;2</td><td>EcoRV</td><td>6652, 1044, 817, 683</td></tr>
+
-
 
+
-
<tr><td></td><td>NcoI</td><td>8806, 390</td></tr>
+
-
 
+
-
</table>
+
-
 
+
-
 
+
-
 
+
-
<p>Digestion master mixes:</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>Master mix for NotI</li>
+
-
 
+
-
<ul><li>1.5 &mu;L NotI</li>
+
-
 
+
-
<li>7.5 &mu;L Orange buffer</li>
+
-
 
+
-
<li>63 &mu;L H20</li>
+
-
 
+
-
</ul><li>Master mix for NcoI</li>
+
-
 
+
-
<ul><li>1.5 &mu;L NcoI</li>
+
-
 
+
-
<li>7.5 &mu;L Tango buffer</li>
+
-
 
+
-
<li>63 &mu;L H20</li>
+
-
 
+
-
</ul><li>Master mix for BamHI</li>
+
-
 
+
-
<ul><li>2 &mu;L BamHI</li>
+
-
 
+
-
<li>10 &mu;L Green buffer</li>
+
-
 
+
-
<li>84 &mu;L H20</li>
+
-
 
+
-
</ul><li>Master mix for EcoRV</li>
+
-
 
+
-
<ul><li>4 &mu;L EcoRV</li>
+
-
 
+
-
<li>20 &mu;L Red buffer</li>
+
-
 
+
-
<li>168 &mu;L H20</li>
+
-
 
+
-
</ul></ul>
+
-
 
+
-
<p>Note: Trichome promoter digestion preparation included. </p>
+
-
 
+
-
 
+
-
 
+
-
<p>All digestions were correct except the transcriptional unit of EaDAcT in 2&Omega;2 (P35s:EaDAcT:T35S). </p>
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
<img src=https://static.igem.org/mediawiki/2014/8/83/20140722_digestiones_atr%2Bhar_Ea_y_p_tricomas.png
+
-
>
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
<p>Miniprep quantification:</p>
+
-
 
+
-
 
+
-
 
+
-
<table style="width:300px">
+
-
 
+
-
<tr><td>Piece</td><td>Tube</td><td>Concentration (ng/&mu;L)</td><td>Volume (&mu;L)</td></tr>
+
-
 
+
-
<tr><td>P35S:EaDAcT:T35S in 2&Omega;2</td><td>1</td><td>350.7</td><td>33</td></tr>
+
-
 
+
-
<tr><td>P35S:EaDAcT:T35S in 2&Omega;2</td><td>2</td><td>271.1</td><td>33</td></tr>
+
-
 
+
-
<tr><td>P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td>1</td><td>306.3</td><td>31</td></tr>
+
-
 
+
-
<tr><td>P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td>2</td><td>296.6</td><td>28</td></tr>
+
-
 
+
-
<tr><td>P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td>3</td><td>246.0</td><td>33</td></tr>
+
-
 
+
-
</table>
+
-
 
+
-
 
+
-
 
+
-
<p>All of the pieces named above were adjusted at 75 ng/&mu;L.</p>
+
-
 
+
-
 
+
-
 
+
-
<table style="width:300px">
+
-
 
+
-
<tr><td>Piece </td><td>Tube number</td><td>Final Volume (&mu;L)</td><td>Volume to be added (&mu;L)</td></tr>
+
-
 
+
-
<tr><td>P35S:EaDAcT:T35S in 2&Omega;2</td><td>1</td><td>154.30</td><td>121.3</td></tr>
+
-
 
+
-
<tr><td>P35S:EaDAcT:T35S in 2&Omega;2</td><td>2</td><td>119.30</td><td>86.30</td></tr>
+
-
 
+
-
<tr><td>P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td>1</td><td>126.60</td><td>95.60</td></tr>
+
-
 
+
-
<tr><td>P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td>2</td><td>110.70</td><td>82.70</td></tr>
+
-
 
+
-
<tr><td>P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td>3</td><td>108.24</td><td>75.20</td></tr>
+
-
 
+
-
</table>
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
<p>As the digestions of the transcriptional unit (TU) of EaDAcT were incorrect, we repeated the process from the ligation step. </p>
+
-
 
+
-
 
+
-
 
+
-
<p>We transformed the same TU in a <i>E. coli</i> competent strain (DH5&alpha;). Then, the transformants were cultured in LB media and Spm and stored at 37ºC overnight. </p>
+
-
 
+
-
 
+
-
 
+
-
<p>Finally, in order to obtain the FAO1 gene, we want to extract the <i>Candida tropicalis</i> genome, so we have picked a colony of <i>C. tropicalis</i>. To check the extraction protocol, we used a yeast previously tested, <i>Saccharomyces cerevisiae</i>. We have cultured <i>C. tropicalis</i> in YPD media and <i>S. cerevisiae</i> in YPDA media at 28 ºC (5 mL).</p>
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/23/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>Candida genome extraction</p>
+
-
 
+
-
 
+
-
 
+
-
<p><i>Saccharomyces cerevisiae</i> is used as a control in order to see if we followed the protocol correctly. We aren't really sure if this protocol is going to work in Candida.</p>
+
-
 
+
-
 
+
-
 
+
-
<p>Cultures measured at 600 nm:</p>
+
-
 
+
-
<ul><li><i>S. cerevisiae</i> Abs = 1.07 </li>
+
-
 
+
-
<li><i>C. tropicalis</i> Abs = 0.39</li>
+
-
 
+
-
</ul>
+
-
 
+
-
<p><i>S. cerevisiae</i> is recultured with new media (1:2) because the previous media was saturated. 2.25 mL of YPD media were mixed with 2.25 mL of <i>S. cerevisiae</i> culture. The mix has to grow at 28 ºC until the exponential phase is reached. </p>
+
-
 
+
-
 
+
-
 
+
-
<p>The absorbance was measured again:</p>
+
-
 
+
-
<ul><li><i>S. cerevisiae</i> Abs = 0.52</li>
+
-
 
+
-
<li><i>C. tropicalis</i> Abs = 0.40</li>
+
-
 
+
-
</ul>
+
-
 
+
-
<p>Buffers needed for the genome extraction were prepared freshly.The genome of both strains of yeast were extracted following the protocol:</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>Grow yeast in 2 or 5 mL YPD to exponential phase. </li>
+
-
 
+
-
<li>Collect cells in 1.5 mL eppendorf-cup (centrifugation 20 s, 6000 rpm).</li>
+
-
 
+
-
<li>Wash once with 1 mL sterile water.</li>
+
-
 
+
-
<li>Resuspend cells in 200 &mu;L protoplast-buffer (100 mM Tris-HCl, pH 7.5, 10 mM EDTA, 1000 units Zymolyase/mL, 10 &mu;L beta-mercaptoethanol/mL; prepare freshly!). Incubate at 37ºC for 1-2 h and finally resuspend by turning the cups. </li>
+
-
 
+
-
<li>Add 200 &mu;L of Lysis-Mix (0.2 M NaOH, 1% SDS) an mix carefully (Don't vortex!).</li>
+
-
 
+
-
<li>Incubate at 65 ºC for 20 min and cool inmediately on ice.</li>
+
-
 
+
-
<li>Add 200 &mu;L of 5 M KAc (pH 5.4) and mix carefully (Don't vortex!) and incubate 15 min on ice. </li>
+
-
 
+
-
<li>Centrifuge (13,000 rpm, 3 min) and transfer supernatant in a fresh cup.</li>
+
-
 
+
-
<li>Add 2 &mu;L RNase A (10 mg/mL) and incubate at 37 ºC for 30 min.</li>
+
-
 
+
-
<li>Add 600 &mu;L isopropanol and mix carefully (Don't vortex!). Incubate at room temperature for 5 min ad centrifuge (13,000 rpm, 30 s). </li>
+
-
 
+
-
<li>Remove the supernatant and wash with 70% ethanol (10 min at room temperature). </li>
+
-
 
+
-
<li>Centrifuge (13,000 rpm, 30 s) and remove the supernatant.</li>
+
-
 
+
-
<li>Dry DNA pellet in a speed-vacuum (not longer than 3 min!) and resuspend in 50 &mu;L TE-buffer. </li>
+
-
 
+
-
<li>Store chromosomal DNA at 4 ºC (Don't freeze!). Concentration and quality can be checked in an agarose gel (loading 1/10 of the volume).</li>
+
-
 
+
-
</ul>
+
-
 
+
-
<p>Genomic quantification:</p>
+
-
 
+
-
 
+
-
 
+
-
<table style="width:300px">
+
-
 
+
-
<tr><td>Organism</td><td>Concentration </td></tr>
+
-
 
+
-
<tr><td><i>S. cerevisiae</i></td><td>72.2 ng/&mu;L</td></tr>
+
-
 
+
-
<tr><td><i>C. tropicalis</i></td><td>1397.1 ng/&mu;L</td></tr>
+
-
 
+
-
</table>
+
-
 
+
-
 
+
-
 
+
-
<p>Electrophoresis made to check the extraction quality was correct. </p>
+
-
 
+
-
 
+
-
 
+
-
<img src=https://static.igem.org/mediawiki/2014/6/64/20140723_genomico_candida.png
+
-
>
+
-
 
+
-
 
+
-
 
+
-
<p>We did not observe genomic from Candida because we used a very diluted sample. We will repeat the gel tomorrow.</p>
+
-
 
+
-
 
+
-
 
+
-
<p>We picked EaDAcT colonies.</p>
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/24/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>The genomic quality of both organisms (<i>C. tropicalis</i> and <i>S. cerevisiae</i>) was checked in an agarose gel again.</p>
+
-
 
+
-
 
+
-
 
+
-
<img src=https://static.igem.org/mediawiki/2014/d/d8/20140724_genomico_candida_y_sac_2.png
+
-
>
+
-
 
+
-
 
+
-
 
+
-
<p>We got the Candida genome band, however, the Saccharomyces genome band was not present.</p>
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
<p>Additionally, minipreps of the liquid culture made yesterday were made and also recultured in solid agar plate. </p>
+
-
 
+
-
 
+
-
 
+
-
<p>Miniprep digestions are going to be done tomorrow.</p>
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/25/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>Digestions in silico made for checking yesterday's minipreps:</p>
+
-
 
+
-
 
+
-
 
+
-
<table style="width:300px">
+
-
 
+
-
<tr><td>Pieces/TU</td><td>Restriction enzyme</td><td>Expected bands</td></tr>
+
-
 
+
-
<tr><td>P35S:EaDAcT:T35S in 2&Omega;2</td><td>EcoRV</td><td>6652, 1044, 817, 683</td></tr>
+
-
 
+
-
<tr><td></td><td>NcoI</td><td>8806, 390</td></tr>
+
-
 
+
-
</table>
+
-
 
+
-
 
+
-
 
+
-
<p>Digestion master mixes:</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>Master mix for NotI</li>
+
-
 
+
-
<ul><li>2 &mu;L NotI</li>
+
-
 
+
-
<li>10 &mu;L Orange buffer</li>
+
-
 
+
-
<li>84 &mu;L H20</li>
+
-
 
+
-
</ul><li>Master mix for NcoI</li>
+
-
 
+
-
<ul><li>2 &mu;L NcoI</li>
+
-
 
+
-
<li>10 &mu;L Tango buffer</li>
+
-
 
+
-
<li>84 &mu;L H20</li>
+
-
 
+
-
</ul><li>Master mix for BglII</li>
+
-
 
+
-
<ul><li>2 &mu;L BglII</li>
+
-
 
+
-
<li>10 &mu;L Orange buffer</li>
+
-
 
+
-
<li>84 &mu;L H20</li>
+
-
 
+
-
</ul><li>Master mix for EcoRV</li>
+
-
 
+
-
<ul><li>1.5 &mu;L EcoRV</li>
+
-
 
+
-
<li>7.5 &mu;L Red buffer</li>
+
-
 
+
-
<li>63 &mu;L H20</li>
+
-
 
+
-
</ul></ul>
+
-
 
+
-
<p>An agarose gel was made to check the transcriptional unit and the other pieces:</p>
+
-
 
+
-
 
+
-
 
+
-
<img src=https://static.igem.org/mediawiki/2014/4/4c/20140725_Minipreps_piezas_y_construcciones.png
+
-
>
+
-
 
+
-
 
+
-
 
+
-
<p>All pieces were correct except the TU corresponding to P35:EaDAcT:T35S.</p>
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/28/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>Once the <i>Candida tropicalis</i> genome DNA is obtained, the FAO1 gene can be amplified by PCR.</p>
+
-
 
+
-
 
+
-
 
+
-
<p>PCR reaction reagents:</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>FAO1-PCR1</li>
+
-
 
+
-
<ul><li>Genomic 0.5 &mu;L</li>
+
-
 
+
-
<li>Buffer HF (5X) 10.0 &mu;L</li>
+
-
 
+
-
<li>dNTPs 2.0 &mu;L</li>
+
-
 
+
-
<li>Oligo R (JUL06) 2.5 &mu;L</li>
+
-
 
+
-
<li>Oligo F (JUL05) 2.5 &mu;L</li>
+
-
 
+
-
<li>Phusion polymerase 0.5 &mu;L</li>
+
-
 
+
-
<li>H2O 32.0 &mu;L</li>
+
-
 
+
-
</ul><li>FAO1-PCR2</li>
+
-
 
+
-
<ul><li>Genomic 0.5 &mu;L</li>
+
-
 
+
-
<li>Buffer HF (5X) 10.0 &mu;L</li>
+
-
 
+
-
<li>dNTPs 2.0 &mu;L</li>
+
-
 
+
-
<li>Oligo R (JUL08) 2.5 &mu;L</li>
+
-
 
+
-
<li>Oligo F (JUL07) 2.5 &mu;L</li>
+
-
 
+
-
<li>Phusion polymerase 0.5 &mu;L</li>
+
-
 
+
-
<li>H2O 32.0 &mu;L</li>
+
-
 
+
-
</ul></ul>
+
-
 
+
-
 
+
-
 
+
-
<p>Annealing temperatures</p>
+
-
 
+
-
<ul><li>FAO1-PCR1: 59 ºC</li>
+
-
 
+
-
<li>FAO1-PCR2: 64 ºC</li>
+
-
 
+
-
</ul>
+
-
 
+
-
<p>PCR products were checked using an electrophoresis. Expected bands:</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>FAO1-PCR1: 1157 bp</li>
+
-
 
+
-
<li>FAO1-PCR2: 1015 bp</li>
+
-
 
+
-
</ul>
+
-
 
+
-
<img src=https://static.igem.org/mediawiki/2014/8/81/20140728_CUP2yFAO1.png
+
-
>
+
-
 
+
-
 
+
-
 
+
-
<p>Both FAO1 PCR products were not correct.</p>
+
-
 
+
-
 
+
-
 
+
-
<p>As the EaDAcT TU was not correct, ligation reaction was done again. The following table shows ligation details:</p>
+
-
 
+
-
 
+
-
 
+
-
<table style="width:300px">
+
-
 
+
-
<tr><td>Reagent</td><td>Volume</td></tr>
+
-
 
+
-
<tr><td>Trichome promoter</td><td>1 &mu;L</td></tr>
+
-
 
+
-
<tr><td>GFP</td><td>1 &mu;L</td></tr>
+
-
 
+
-
<tr><td>TNos</td><td>1 &mu;L</td></tr>
+
-
 
+
-
<tr><td>BsaI</td><td>1 &mu;L</td></tr>
+
-
 
+
-
<tr><td>p2&alpha;2</td><td>1 &mu;L</td></tr>
+
-
 
+
-
<tr><td>T4 ligase</td><td>1 &mu;L</td></tr>
+
-
 
+
-
<tr><td>Ligase buffer</td><td>1 &mu;L</td></tr>
+
-
 
+
-
<tr><td>H2O</td><td>3 &mu;L</td></tr>
+
-
 
+
-
<tr><td>Total Volume</td><td>10 &mu;L</td></tr>
+
-
 
+
-
</table>
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/29/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>As the FAO1 PCR was not correct, we repeated the reaction. Below is a table showing the details:</p>
+
-
 
+
-
 
+
-
 
+
-
<table style="width:300px">
+
-
 
+
-
<tr><td>Reagent</td><td>FAO1-PCR1</td><td>FAO1-PCR2</td></tr>
+
-
 
+
-
<tr><td><i>C. tropicalis</i> genome</td><td>2.5 &mu;L</td><td>2.5 &mu;L</td></tr>
+
-
 
+
-
<tr><td>HF Buffer</td><td>30 &mu;L</td><td>30 &mu;L</td></tr>
+
-
 
+
-
<tr><td>dNTPs</td><td>10 &mu;L</td><td>10 &mu;L</td></tr>
+
-
 
+
-
<tr><td>Oligo R</td><td>12.5 &mu;L</td><td>12.5 &mu;L</td></tr>
+
-
 
+
-
<tr><td>Oligo F</td><td>12.5 &mu;L</td><td>12.5 &mu;L</td></tr>
+
-
 
+
-
<tr><td>Phusion polymerase</td><td>1.5 &mu;L</td><td>1.5 &mu;L</td></tr>
+
-
 
+
-
<tr><td>H2O</td><td>181 &mu;L</td><td>181 &mu;L</td></tr>
+
-
 
+
-
</table>
+
-
 
+
-
 
+
-
 
+
-
<p>PCR temperatures, 25 cycles:</p>
+
-
 
+
-
 
+
-
 
+
-
<table style="width:300px">
+
-
 
+
-
<tr><td>Step</td><td>Temperature (ºC)</td><td>Time </td></tr>
+
-
 
+
-
<tr><td>Initialization</td><td>98</td><td>2 min</td></tr>
+
-
 
+
-
<tr><td>Denaturation</td><td>98</td><td>20 s</td></tr>
+
-
 
+
-
<tr><td>Annealing</td><td>50, 55, 60, 65</td><td>??</td></tr>
+
-
 
+
-
<tr><td>Extension</td><td>72</td><td>45 s</td></tr>
+
-
 
+
-
<tr><td>Final elongation</td><td>72</td><td>7 min</td></tr>
+
-
 
+
-
</table>
+
-
 
+
-
 
+
-
 
+
-
<p>We made a mistake preparing the FAO1-PCR1 adding the wrong template, so we do not expect the correct FAO11-PCR1 product. </p>
+
-
 
+
-
 
+
-
 
+
-
<p>EaDAcT Transcriptional Unit (TU) transformation</p>
+
-
 
+
-
 
+
-
 
+
-
<p>Using an electrocompetent <i>E. coli</i> strain (DH5&alpha;) and 1.5 ul ligation (P35s:EaDAcT:T35s in 2&Omega;2), the mix is electroporated at 1500 V. Then, 300 &mu;L of SOC are added and stored at 37ºC with agitation. </p>
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/30/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>Transform P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 and P35s:EaDAcT:T35s (in 2&alpha;2) in <i><i>Agrobacterium</i> tumefaciens</i> strain C58. Introduce 1 &mu;L of construction in a C58 aliquot. Electroporate at 1440V. Add 500 &mu;L of LB in the LAF. Keep 2 hours in agitation at 28ºC. Grow 20 &mu;L and 200 &mu;L in solid medium containing kanamicin and rifampicin. Incubate overnight at 28ºC.</p>
+
-
 
+
-
 
+
-
 
+
-
<p>Pick colonies of P35s:EaDAcT:T35s in 2&Omega;2.</p>
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>08/01/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>Pick colonies from <i><i>Agrobacterium</i> tumefaciens</i> and grow them in liquid medium for two days at 28ºC. Liquid medium is composed by 5 mL LB, Rif (1:1000) and Kan (1:1000) for &alpha; vectors and 5 mL LB, Rif (1:1000) and Spm (1:1000) for &Omega; vectors.</p>
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/31/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>Minipreps of yesterday's culture were made, obtaining the transcripional unit: P35S:EaDAcT:T35S in 2&Omega;2 </p>
+
-
 
+
-
 
+
-
 
+
-
<p>Additionally, we recultured in petri dish with its respective antibiotic (Spm).</p>
+
-
 
+
-
 
+
-
 
+
-
<p>Digestions in silico made for checking minipreps:</p>
+
-
 
+
-
 
+
-
 
+
-
<table style="width:300px">
+
-
 
+
-
<tr><td>Pieces/TU</td><td>Restriction enzyme</td><td>Expected bands</td></tr>
+
-
 
+
-
<tr><td>P35S:EaDAcT:T35S in 2&Omega;2</td><td>NcoI</td><td>8806, 390</td></tr>
+
-
 
+
-
<tr><td></td><td>EcoRV</td><td>6652, 1044, 817, 683</td></tr>
+
-
 
+
-
</table>
+
-
 
+
-
 
+
-
 
+
-
<p>Digestion mixes:</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>Master mix for EcoRV:</li>
+
-
 
+
-
<ul><li>3 &mu;L EcoRV</li>
+
-
 
+
-
<li>15 &mu;L Red buffer</li>
+
-
 
+
-
<li>126 &mu;L H20</li>
+
-
 
+
-
</ul><li>Master mix for NcoI:</li>
+
-
 
+
-
<ul><li>1.5 &mu;L NcoI</li>
+
-
 
+
-
<li>7.5 &mu;L Tango buffer</li>
+
-
 
+
-
<li>63 &mu;L H2O</li>
+
-
 
+
-
</ul></ul>
+
-
 
+
-
<p>Note: We made master mixes because digestions were made simultaneously with the trichome promoter part. </p>
+
-
 
+
-
 
+
-
 
+
-
<p>An agarose gel was made to check the transcriptional unit.</p>
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
<img src=https://static.igem.org/mediawiki/2014/a/af/20140731_minipreps_eadact_en_2alpha2_y_ptricomas-GFP-tnos_en_2omega2.png
+
-
>
+
-
 
+
-
 
+
-
 
+
-
<p>Minipreps of P35s:EaDAcT:T35s in 2&Omega;2 (1) went correctly.</p>
+
-
 
+
-
 
+
-
 
+
-
<p>Miniprep results were quantified and then adjusted at 75 ng/&mu;L:</p>
+
-
 
+
-
 
+
-
 
+
-
<table style="width:300px">
+
-
 
+
-
<tr><td>Pieces/TU</td><td></td><td>Tube</td><td>Concentration (ug/&mu;L)</td><td>Initial volume (&mu;L)</td><td>Final Volume (&mu;L)</td></tr>
+
-
 
+
-
<tr><td>P35S:EaDAcT:T35S in 2&Omega;2</td><td>1</td><td>141.4</td><td>35</td><td>31</td></tr>
+
-
 
+
-
<tr><td>P35S:EaDAcT:T35S in 2&Omega;2</td><td>2</td><td>3.9</td><td>33</td><td>(Discarded)</td></tr>
+
-
 
+
-
</table>
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
<p>Ligation of P35s:EaDAcT:T35s in 2&Omega;2 with P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in 2&Omega;1.</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>1 &mu;L P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in 2&Omega;1</li>
+
-
 
+
-
<li>1 &mu;L P35s:EaDAcT:T35s in 2&Omega;2</li>
+
-
 
+
-
<li>1 &mu;L 2&alpha;1</li>
+
-
 
+
-
<li>1 &mu;L BsaI</li>
+
-
 
+
-
<li>1 &mu;L T4 ligase</li>
+
-
 
+
-
<li>1 &mu;L ligase buffer</li>
+
-
 
+
-
<li>4 &mu;L H20</li>
+
-
 
+
-
</ul>
+
-
 
+
-
</br><p><h4>08/04/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>Transformation of P35s:EaDAcT:T35s in 2&Omega;2+P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in <i>E. coli</i>.</p>
+
-
 
+
-
 
+
-
 
+
-
<p><i>Agrobacterium</i> liquid cultures (5 mL LB)</p>
+
-
 
+
-
<ul><li>P35s:GFP:p19:Tnos (Spm, Tet, Rif)</li>
+
-
 
+
-
<li>Empty C58 <i><i>Agrobacterium</i> tumefaciens</i> (Rif)</li>
+
-
 
+
-
<li>2x P35s:EaDAcT:T35s in 2&alpha;2 (Rif, Kan)</li>
+
-
 
+
-
<li>2x P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in 2&Omega;1 (Rif, Spm)</li>
+
-
 
+
-
</ul>
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
<a name="Trichome_promoter"></a></br></br><h3><p></p>Trichome promoter</h3></br><p><h4>07/03/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>Genomic DNA extraction from Nicotiana tabacum. We need the genome of this organism because we want to obtain the trichome promoter from the NtCPS2 gene.</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>Obtain 100 mg of the tobacco leaves (5 disks made with a 1.5 mL vial). Made it twice.</li>
+
-
 
+
-
<li>Introduce the disks inside the tube.</li>
+
-
 
+
-
<li>Introduce the two tubes in liquid nitrogen.</li>
+
-
 
+
-
<li>Remove them from the liquid nitrogen and store at -80ºC until use.</li>
+
-
 
+
-
<li>Remove one tube from -80ºC and re-introduce them in liquid nitrogen. </li>
+
-
 
+
-
<li>Grind the disks.</li>
+
-
 
+
-
<li>Add 600 &mu;L of CTAB (2%) buffer (pre-heat at 65ºC.)</li>
+
-
 
+
-
<li>Grind the mixture.</li>
+
-
 
+
-
<li>Add RNAse (1.6 &mu;L at M = 100 ug/&mu;L for each mL of CTAB buffer). </li>
+
-
 
+
-
<li>Vortex it and maintain at 65ºC for 45 min. Mix it by inversion 5-15 min.</li>
+
-
 
+
-
<li>Add 600 &mu;L cloroform:isoamilic alcohol. Vortex it.</li>
+
-
 
+
-
<li>Centrifuge 15 min at 13000 rpm (or 10 min at 14500 rpm.</li>
+
-
 
+
-
<li>Recover the supernatant by aspiration (with a 200 &mu;L pipet).</li>
+
-
 
+
-
<li>Repeat the last three steps.</li>
+
-
 
+
-
<li>Add one volume o isopropanol and mix well by inversion (10 times). </li>
+
-
 
+
-
<li>To precipitate, maintain 20 min on ice or at -80ºC during 5 min.</li>
+
-
 
+
-
<li>Centrifuge 10 min at 13000 rpm (4ºC).</li>
+
-
 
+
-
<li>Discard the supernatant by decantation (be carefull with the pellet).</li>
+
-
 
+
-
<li>Wash with 600 &mu;L ethanol (80%).</li>
+
-
 
+
-
<li>Centrifuge 5 min at 13000 rpm. </li>
+
-
 
+
-
<li>Discard the ethanol by pipeting and let it dry a few minutes. </li>
+
-
 
+
-
<li>Resuspend it in 50-100 &mu;L H2O miliQ or with TE buffer.</li>
+
-
 
+
-
<li>Store at -20ºC.  </li>
+
-
 
+
-
</ul>
+
-
 
+
-
<p>Measurement of genomic concentration with nanodrop.</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>Tabacco 1: 182 ng/&mu;L (Thrown away)</li>
+
-
 
+
-
<li>Tabacco 2: 620 ng/&mu;L (Stored at -20ºC)</li>
+
-
 
+
-
</ul>
+
-
 
+
-
<p>Electrophoresis performed to check the genomic size of tobacco (to see if it is degradated).</p>
+
-
 
+
-
 
+
-
 
+
-
<img src=https://static.igem.org/mediawiki/2014/5/5e/20140703_extraccion_genomico_tobacco.png
+
-
>
+
-
 
+
-
 
+
-
 
+
-
<p>It is correct.</p>
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/10/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>PCR of genomic extraction of tobacco in order to amplify the trichome promoter CPS2.</p>
+
-
 
+
-
 
+
-
 
+
-
<p>Ordered primers</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>IGEMJULO1</li>
+
-
 
+
-
<li>IGEMJULO2</li>
+
-
 
+
-
</ul>
+
-
 
+
-
<p>Ajust primers to a 100 uM concentration:</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>IGEMJUL01 + 566 &mu;L miliQ H2O</li>
+
-
 
+
-
<li>IGEMJUL02 + 691 &mu;L miliQ H2O</li>
+
-
 
+
-
</ul>
+
-
 
+
-
<p>Use a 1:10 alicuot for PCR (10 uM).</p>
+
-
 
+
-
 
+
-
 
+
-
<p>Reagents needed for PCR:</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>0.5 &mu;L template</li>
+
-
 
+
-
<li>10 &mu;L buffer HF 5x</li>
+
-
 
+
-
<li>2 &mu;L dNTPs</li>
+
-
 
+
-
<li>2.5 &mu;L oligo R</li>
+
-
 
+
-
<li>2.5 &mu;L oligo F</li>
+
-
 
+
-
<li>0.5 &mu;L Pfu</li>
+
-
 
+
-
<li>32 &mu;L miliQ H2O</li>
+
-
 
+
-
</ul>
+
-
 
+
-
<p>Final volume: 50 &mu;L</p>
+
-
 
+
-
 
+
-
 
+
-
<p>Parameters:</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>98 ºC (2 min)</li>
+
-
 
+
-
<li>35 cycles</li>
+
-
 
+
-
<ul><li>98 ºC (10 sec)</li>
+
-
 
+
-
<li>59 ºC (15 sec)</li>
+
-
 
+
-
<li>72 ºC (45 sec)</li>
+
-
 
+
-
</ul><li>72 ºC (7 min)</li>
+
-
 
+
-
</ul>
+
-
 
+
-
<img src=https://static.igem.org/mediawiki/2014/d/dd/20140710_productoPCR_tricomas.png
+
-
>
+
-
 
+
-
 
+
-
 
+
-
<p>We didn't get PCR product.</p>
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/11/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>Repeat PCR with different parameters.</p>
+
-
 
+
-
 
+
-
 
+
-
<table style="width:300px">
+
-
 
+
-
<tr><td> </td><td>1 </td><td>2 </td><td>3 </td><td>4 </td><td>5</td></tr>
+
-
 
+
-
<tr><td>Template</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td></tr>
+
-
 
+
-
<tr><td>Buffer (5x)</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td></tr>
+
-
 
+
-
<tr><td>dNTPs</td><td>2 &mu;L</td><td>2 &mu;L</td><td>2 &mu;L</td><td>2 &mu;L</td><td>2 &mu;L</td></tr>
+
-
 
+
-
<tr><td>Oligo R</td><td>2.5 &mu;L</td><td>2.5 &mu;L</td><td>2.5 &mu;L</td><td>2.5 &mu;L</td><td>2.5 &mu;L</td></tr>
+
-
 
+
-
<tr><td>Oligo F</td><td>2.5 &mu;L</td><td>2.5 &mu;L</td><td>2.5 &mu;L</td><td>2.5 &mu;L</td><td>2.5 &mu;L</td></tr>
+
-
 
+
-
<tr><td>Phu</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td></tr>
+
-
 
+
-
<tr><td>Buffer</td><td>32 &mu;L</td><td>32 &mu;L</td><td>32 &mu;L</td><td>32 &mu;L</td><td>32 &mu;L</td></tr>
+
-
 
+
-
</table>
+
-
 
+
-
 
+
-
 
+
-
<p>1, 2 and 5 contain buffer F; 3 and 4 contain buffer GC.</p>
+
-
 
+
-
 
+
-
 
+
-
<p>PCR parameters</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>98 ºC (2 min)</li>
+
-
 
+
-
<li>35 cycles</li>
+
-
 
+
-
<ul><li>98 ºC (10 sec)</li>
+
-
 
+
-
<li>1, 3, 5 -> 59 ºC (15 sec). 2, 4 -> 55 ºC (15 sec)</li>
+
-
 
+
-
<li>72 ºC (45 sec)</li>
+
-
 
+
-
</ul><li>72 ºC (7 min)</li>
+
-
 
+
-
</ul>
+
-
 
+
-
<img src=https://static.igem.org/mediawiki/2014/4/40/20140711_productoPCR_tricomas_repeticion.png
+
-
>
+
-
 
+
-
 
+
-
 
+
-
<p>No PCR products again.</p>
+
-
 
+
-
 
+
-
 
+
-
<p>Repeat PCR again with other parameters.</p>
+
-
 
+
-
 
+
-
 
+
-
<table style="width:300px">
+
-
 
+
-
<tr><td> </td><td>Buffer HF </td><td>Buffer GC</td></tr>
+
-
 
+
-
<tr><td>Template</td><td>2 &mu;L</td><td>2 &mu;L</td></tr>
+
-
 
+
-
<tr><td>Buffer (5x)</td><td>40 &mu;L</td><td>40 &mu;L</td></tr>
+
-
 
+
-
<tr><td>dNTPs</td><td>8 &mu;L</td><td>8 &mu;L</td></tr>
+
-
 
+
-
<tr><td>Oligo R</td><td>10 &mu;L</td><td>10 &mu;L</td></tr>
+
-
 
+
-
<tr><td>Oligo F</td><td>10 &mu;L</td><td>10 &mu;L</td></tr>
+
-
 
+
-
<tr><td>Phu</td><td>2</td><td>2 &mu;L &mu;L</td></tr>
+
-
 
+
-
<tr><td>Buffer</td><td>128 &mu;L</td><td>128 &mu;L</td></tr>
+
-
 
+
-
</table>
+
-
 
+
-
 
+
-
 
+
-
<p>Set 4 tubes with each buffer at different temperatures: 49, 52, 55, 60.</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>98 ºC (2 min)</li>
+
-
 
+
-
<li>35 cycles</li>
+
-
 
+
-
<ul><li>98 ºC (10 sec)</li>
+
-
 
+
-
<li>49, 52, 55, 60 ºC (15 sec)</li>
+
-
 
+
-
<li>72 ºC (45 sec)</li>
+
-
 
+
-
</ul><li>72 ºC (7 min)</li>
+
-
 
+
-
</ul>
+
-
 
+
-
<img src=https://static.igem.org/mediawiki/2014/7/7e/20140711_productoPCR_tricomas_segunda_repeticion.png
+
-
>
+
-
 
+
-
 
+
-
 
+
-
<p>No PCR products again.</p>
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/14/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>Repeat PCR again with more genomic.</p>
+
-
 
+
-
 
+
-
 
+
-
<table style="width:300px">
+
-
 
+
-
<tr><td>Buffer HF </td><td>Buffer GC</td></tr>
+
-
 
+
-
<tr><td>Template</td><td>5</td><td>5</td></tr>
+
-
 
+
-
<tr><td>Buffer (5x)</td><td>50</td><td>50</td></tr>
+
-
 
+
-
<tr><td>dNTPs</td><td>10</td><td>10</td></tr>
+
-
 
+
-
<tr><td>Oligo R</td><td>12.5</td><td>12.5</td></tr>
+
-
 
+
-
<tr><td>Oligo F</td><td>12.5</td><td>12.5</td></tr>
+
-
 
+
-
<tr><td>Phu</td><td>2.5</td><td>2.5</td></tr>
+
-
 
+
-
<tr><td>Buffer</td><td>107.5</td><td>107.5</td></tr>
+
-
 
+
-
</table>
+
-
 
+
-
 
+
-
 
+
-
<p>Same parameters as before except annealing temperatures which are: 50, 53, 57, 59  ºC.</p>
+
-
 
+
-
 
+
-
 
+
-
<img src=https://static.igem.org/mediawiki/2014/3/3a/20140714_productoPCR_tricomas_tercera_repeticion.png
+
-
>
+
-
 
+
-
 
+
-
 
+
-
<p>We still without having any amplification.</p>
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/18/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>Repeat the PCR with other enzyme.</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>12.5 &mu;L Q5 Master mix (2x).</li>
+
-
 
+
-
<li>1.25 &mu;L forward primer 10 uM</li>
+
-
 
+
-
<li>1.25 &mu;L reverse primer 10 uM</li>
+
-
 
+
-
<li>0.5 &mu;L template 620 ng/&mu;L</li>
+
-
 
+
-
<li>9.5 &mu;L H2O</li>
+
-
 
+
-
</ul>
+
-
 
+
-
<p>Set 4 reactions at 50, 53, 55, 59 ºC.</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>98 ºC (30 sec)</li>
+
-
 
+
-
<li>35 cycles</li>
+
-
 
+
-
<ul><li>98 ºC (10 sec)</li>
+
-
 
+
-
<li>50, 53, 55, 59 ºC (15 sec)</li>
+
-
 
+
-
<li>72 ºC (45 sec)</li>
+
-
 
+
-
</ul><li>72 ºC (2 min)</li>
+
-
 
+
-
</ul>
+
-
 
+
-
<img src=https://static.igem.org/mediawiki/2014/7/74/20140714_productoPCR_tricomas_cuarta_repeticion_BUENA.png
+
-
>
+
-
 
+
-
 
+
-
 
+
-
<p>The DNA fragment of interest is around 1.5 kb so we see we finally obtained amplification at 55 and 59 ºC reactions.</p>
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/19/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>Trichome promoter PCR product ligation in pUPD.</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>1 &mu;L pUPD</li>
+
-
 
+
-
<li>1 &mu;L PCR product</li>
+
-
 
+
-
<li>1 &mu;L BsmBI (5-10 ud)</li>
+
-
 
+
-
<li>1 &mu;L T4 ligase (5-10 ud)</li>
+
-
 
+
-
<li>1.2 &mu;L buffer ligase (3 ud)</li>
+
-
 
+
-
<li>6.8 &mu;L H20</li>
+
-
 
+
-
</ul>
+
-
 
+
-
<p>Set the reaction: 25 cycles x (37ºC 2 min, 16ºC 5 min).</p>
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/20/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>Transform and grow in Petri dishes yesterday's ligation of the trichome promoter in pUPD.</p>
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/21/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>We picked colonies of the trichome promoter in pUPD and grown it in liquid culture.</p>
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/22/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>We made minipreps of yesterday's liquid culture. Additionally, we have recultured them in solid growth media. </p>
+
-
 
+
-
 
+
-
 
+
-
<p>Miniprep quantification:</p>
+
-
 
+
-
 
+
-
 
+
-
<table style="width:300px">
+
-
 
+
-
<tr><td>Piece</td><td>Tube</td><td>Concentration (ng/&mu;L)</td><td>Volume (&mu;L)</td></tr>
+
-
 
+
-
<tr><td>Trichome promoter in pUPD</td><td>1</td><td>317.1</td><td>26</td></tr>
+
-
 
+
-
<tr><td>Trichome promoter in pUPD</td><td>3</td><td>354.8</td><td>32</td></tr>
+
-
 
+
-
</table>
+
-
 
+
-
 
+
-
 
+
-
<p>Both minipreps were adjusted to 75 ng/&mu;L.</p>
+
-
 
+
-
 
+
-
 
+
-
<p>Digestions in silico performed to check the insertion:</p>
+
-
 
+
-
 
+
-
 
+
-
<table style="width:300px">
+
-
 
+
-
<tr><td>Piece</td><td>Restriction enzyme</td><td>Expected bands</td></tr>
+
-
 
+
-
<tr><td>Trichome Promoter in pUPD</td><td>NotI</td><td>2981, 1523</td></tr>
+
-
 
+
-
<tr><td></td><td>EcoRV</td><td>3942, 562</td></tr>
+
-
 
+
-
</table>
+
-
 
+
-
 
+
-
 
+
-
<p>Note: To see further details of digestion master mixes, go to the biosynthesis part, date 07/22/2014.</p>
+
-
 
+
-
 
+
-
 
+
-
<p>Pieces taken from the GoldenBraid 2.0 collection were cultured in solid growth media:</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>pTnos (GB0037)</li>
+
-
 
+
-
<li>pGFP (GB0059)</li>
+
-
 
+
-
<li>pLuciferase (GB0096)</li>
+
-
 
+
-
</ul>
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/23/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>Yesterday's digestions were correct, so the trichome promoter in pUPD was send to sequencing.</p>
+
-
 
+
-
 
+
-
 
+
-
<p>We picked colonies from pTnos, pGFP and pLuciferase.</p>
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/24/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>Results of sequencing the promoter were obtained:</p>
+
-
 
+
-
 
+
-
 
+
-
<table style="width:300px">
+
-
 
+
-
<tr><td>Mutation</td><td>Position</td></tr>
+
-
 
+
-
<tr><td>T insertion</td><td>??</td></tr>
+
-
 
+
-
<tr><td>T insertion</td><td>??</td></tr>
+
-
 
+
-
</table>
+
-
 
+
-
 
+
-
 
+
-
<p>Minipreps of pTnos, pGFP and pLuciferase.</p>
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/28/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<table style="width:300px">
+
-
 
+
-
<tr><td>Piece</td><td>Concentration (ng/&mu;L)</td><td>Initial Volume (&mu;L)</td><td>Final Volume (&mu;L)</td></tr>
+
-
 
+
-
<tr><td>GFP</td><td>318.8</td><td>35</td><td>148.8</td></tr>
+
-
 
+
-
<tr><td>Tnos</td><td>400.8</td><td>35</td><td>186.5</td></tr>
+
-
 
+
-
<tr><td>pLuciferase</td><td>NotI</td><td>2981, 1731</td></tr>
+
-
 
+
-
</table>
+
-
 
+
-
 
+
-
 
+
-
<p>See master mix and gel digestion in Biosynthesis part. Pieces were obtained correctly and adjusted to 75 ng/&mu;L.</p>
+
-
 
+
-
 
+
-
 
+
-
<p>The following table shows ligation details of the trichome promoter:</p>
+
-
 
+
-
 
+
-
 
+
-
<table style="width:300px">
+
-
 
+
-
<tr><td>Reagent</td><td>Volume</td></tr>
+
-
 
+
-
<tr><td>CPS2</td><td>1 &mu;L</td></tr>
+
-
 
+
-
<tr><td>GFP</td><td>1 &mu;L</td></tr>
+
-
 
+
-
<tr><td>TNos</td><td>1 &mu;L</td></tr>
+
-
 
+
-
<tr><td>BsaI</td><td>1 &mu;L</td></tr>
+
-
 
+
-
<tr><td>p2&alpha;2</td><td>1 &mu;L</td></tr>
+
-
 
+
-
<tr><td>T4 ligase</td><td>1 &mu;L</td></tr>
+
-
 
+
-
<tr><td>Ligase buffer</td><td>1 &mu;L</td></tr>
+
-
 
+
-
<tr><td>H2O</td><td>3 &mu;L</td></tr>
+
-
 
+
-
<tr><td>Total Volume</td><td>10 &mu;L</td></tr>
+
-
 
+
-
</table>
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/29/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>Trichome Promoter transformation in <i>E. coli</i>.</p>
+
-
 
+
-
 
+
-
 
+
-
<p>Using an electrocompetent <i>E. coli</i> strain (DH5&alpha;) and 1.5 ul ligation (CPS2:GFP:TNos in 2&alpha;2), the mix is electroporated at 1500 V. Then, 300 &mu;L of SOC are added and stored at 37 ºC with agitation. </p>
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/30/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>Pick colonies of CPS2:GFP:TNos in 2&alpha;2.</p>
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/31/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>Minipreps of yesterday's culture were made, obtaining the transcripional unit: PCPS2:GFP:TNos in 2 &alpha;2</p>
+
-
 
+
-
 
+
-
 
+
-
<p>Additionally, we recultured in petri dish with its respective antibiotic (Kan).</p>
+
-
 
+
-
 
+
-
 
+
-
<p>Digestions in silico made for checking minipreps:</p>
+
-
 
+
-
 
+
-
 
+
-
<table style="width:300px">
+
-
 
+
-
<tr><td>Pieces/TU</td><td>Restriction enzyme</td><td>Expected bands</td></tr>
+
-
 
+
-
<tr><td>CPS2:GFP:TNos in 2&alpha;2</td><td>HindIII</td><td>6322, 2694</td></tr>
+
-
 
+
-
<tr><td></td><td>EcoRV</td><td>8454, 562</td></tr>
+
-
 
+
-
</table>
+
-
 
+
-
 
+
-
 
+
-
<p>Digestion mixes:</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>Master mix for EcoRV:</li>
+
-
 
+
-
<ul><li>3 &mu;L EcoRV</li>
+
-
 
+
-
<li>15 &mu;L Red buffer</li>
+
-
 
+
-
<li>126 &mu;L H20</li>
+
-
 
+
-
</ul><li>Master mix for HindIII:</li>
+
-
 
+
-
<ul><li>2 &mu;L HindIII</li>
+
-
 
+
-
<li>10 &mu;L Red buffer</li>
+
-
 
+
-
<li>84 &mu;L H2O</li>
+
-
 
+
-
</ul></ul>
+
-
 
+
-
<p>Note: We made master mixes because digestions were made simultaneously with the biosynthesis part. </p>
+
-
 
+
-
 
+
-
 
+
-
<p>An agarose gel was made to check the transcriptional unit:</p>
+
-
 
+
-
 
+
-
 
+
-
<img src=https://static.igem.org/mediawiki/2014/a/af/20140731_minipreps_eadact_en_2alpha2_y_ptricomas-GFP-tnos_en_2omega2.png
+
-
>
+
-
 
+
-
 
+
-
 
+
-
<p>Minipreps of CPS2:GFP:TNos in 2&alpha;2 (1) went correctly.</p>
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
<p>Miniprep results were quantified and then adjusted at 75 ng/&mu;L:</p>
+
-
 
+
-
 
+
-
 
+
-
<table style="width:300px">
+
-
 
+
-
<tr><td>Pieces/TU</td><td>Tube</td><td>Concentration (ug/&mu;L)</td><td>Initial volume (&mu;L)</td><td>Final Volume (&mu;L)</td></tr>
+
-
 
+
-
<tr><td>PCPS2:GFP:TNos in 2&alpha;2</td><td>1</td><td>128.5</td><td>33</td><td>56.5</td></tr>
+
-
 
+
-
<tr><td>PCPS2:GFP:TNos in 2&alpha;2</td><td>2</td><td>135.9</td><td>34</td><td>61.6</td></tr>
+
-
 
+
-
<tr><td>PCPS2:GFP:TNos in 2&alpha;2</td><td>3</td><td>126.2</td><td>35</td><td>58.9</td></tr>
+
-
 
+
-
</table>
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
<a name="Switch"></a></br></br><h3><p></p>Switch</h3></br><p><h4>07/04/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>Adquisition of <i>S. cerevisiae</i> genomic DNA. (5 &mu;L, stored in the fridge)</p>
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/28/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>We had the genome of <i>S. cerevisiae</i>, needed to extract the target genes that are going to be used to build the switch. However we finally used our genome extraction (see Biosynthesis part, date 07/23/2014 for further details).</p>
+
-
 
+
-
<p>Previously we have designed a cupple of primers to amplify the CUP1 and CUP2 genes present in the yeast. </p>
+
-
 
+
-
<p> </p>
+
-
 
+
-
<p>PCR reaction reagents:</p>
+
-
 
+
-
 
+
-
 
+
-
<table style="width:300px">
+
-
 
+
-
<tr><td>Reagent</td><td>CUP1-PCR1</td><td>CUP2-PCR2</td></tr>
+
-
 
+
-
<tr><td>Template</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td></tr>
+
-
 
+
-
<tr><td>Buffer HF (5X)</td><td>10.0 &mu;L</td><td>10.0 &mu;L</td></tr>
+
-
 
+
-
<tr><td>dNTPs</td><td>2.0 &mu;L</td><td>2.0 &mu;L</td></tr>
+
-
 
+
-
<tr><td>Oligo R (JUL06)</td><td>2.5 &mu;L</td><td>2.5 &mu;L</td></tr>
+
-
 
+
-
<tr><td>Oligo F (JUL05)</td><td>2.5 &mu;L</td><td>2.5 &mu;L</td></tr>
+
-
 
+
-
<tr><td>Phusion polymerase</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td></tr>
+
-
 
+
-
<tr><td>H2O</td><td>32.0 &mu;L</td><td>32.0 &mu;L</td></tr>
+
-
 
+
-
</table>
+
-
 
+
-
 
+
-
 
+
-
<p>Annealing temperature: both 61 ºC</p>
+
-
 
+
-
 
+
-
 
+
-
<p>PCR products were checked using an electrophoresis. Expected bands:</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>CUP1-PCR1: 386 bp</li>
+
-
 
+
-
<li>CUP2-PCR2: 348 bp</li>
+
-
 
+
-
</ul>
+
-
 
+
-
<img src=https://static.igem.org/mediawiki/2014/8/81/20140728_CUP2yFAO1.png
+
-
>
+
-
 
+
-
 
+
-
 
+
-
<p>Both PCR products were correct.</p>
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/30/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>We repeated the PCR because we had to purify the bands CUP1-PCR1 and CUP2-PCR2.For this purpose we used the kit "QIAEX II Gel Extraction Kit".</p>
+
-
 
+
-
 
+
-
 
+
-
<p>Ligation of both parts of CUP2.</p>
+
-
 
+
-
<ul><li>1 &mu;L CUP1-PCR1</li>
+
-
 
+
-
<li>1 &mu;L CUP1-PCR1</li>
+
-
 
+
-
<li>1 &mu;L pUPD</li>
+
-
 
+
-
<li>1 &mu;L BsmBI</li>
+
-
 
+
-
<li>1 &mu;L T4 ligase</li>
+
-
 
+
-
<li>1 &mu;L ligase buffer</li>
+
-
 
+
-
<li>4 &mu;L H20</li>
+
-
 
+
-
</ul>
+
-
 
+
-
</br><p><h4>07/31/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>CUP2 was transformed in pUPD and cultured in solid media (37ºC).</p>
+
-
 
+
-
<a name="Biosafety"></a></br></br><h3><p></p>Biosafety</h3></br><p><h4>07/22/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>Pieces taken from the GoldenBraid 2.0 collection were cultured in solid growth media:</p>
+
-
 
+
-
 
+
-
 
+
-
<ul><li>P35S:Rosea:TNos</li>
+
-
 
+
-
<li>TA29:Barnase:TNos (from GoldenBraid 1.0 collection)</li>
+
-
 
+
-
</ul>
+
-
 
+
-
<p>We were told by our advisor that Rosea produces necrosis in N. benthamiana, so we must think of an alternative.</p>
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/23/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>We picked colonies from P35S:Rosea:TNos and TA29:Barnase:TNos.</p>
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/24/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>Minipreps of P35S:Rosea:TNos and TA29:Barnase:TNos.</p>
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/25/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>Digestions in silico made for checking yesterday's minipreps:</p>
+
-
 
+
-
 
+
-
 
+
-
<table style="width:300px">
+
-
 
+
-
<tr><td>Pieces</td><td>Restriction enzyme</td><td>Expected bands</td></tr>
+
-
 
+
-
<tr><td>P35S:Rosea:Tnos</td><td>BglII</td><td>2495, 2302</td></tr>
+
-
 
+
-
<tr><td></td><td>NcoI</td><td>4407, 390</td></tr>
+
-
 
+
-
<tr><td>TA29:Barnase:Tnos</td><td>BglII</td><td>2825, 2245</td></tr>
+
-
 
+
-
</table>
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/28/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>See master mix and gel digestion in Biosynthesis part. Pieces were obtained correctly and adjusted to 75 ng/&mu;L.</p>
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>07/31/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>We talked with the NRP-UEA-Norwich team. We stablished a possible collaboration in developing the biosafety module together. They could send us their chromoproteins and we could send them our barnase and TA29 promoter.</p>
+
-
 
+
-
 
+
-
 
+
-
</br><p><h4>08/05/2014</h4></p>
+
-
 
+
-
 
+
-
 
+
-
<p>Order primers for TA29 and barnase:</p>
+
-
 
+
-
 
+
-
 
+
-
<table style="width:300px">
+
-
 
+
-
<tr><td>Name</td><td>Sequence</td><td>T annealing</td></tr>
+
-
 
+
-
<tr><td>I14Ago01_TA29_F1</td><td>CGCCGTCTCGCTCGGGAGTAGCGAATGCAATTAATTTAGACAT</td><td>61.8ºC</td></tr>
+
-
 
+
-
<tr><td>I14Ago02_TA29_R1</td><td>CGCCGTCTCGCTCGCATTTTTAGCTAATTTCTTTAAGTAAAAACTTTG</td><td>60.8ºC</td></tr>
+
-
 
+
-
<tr><td>I14Ago03_barnase_F1</td><td>CGCCGTCTCGCTCGAATGGCACAGGTTATCAACACG</td><td>65.0ºC</td></tr>
+
-
 
+
-
<tr><td>I14Ago04_barnase_R1</td><td>CGCCGTCTCGCTCGAAGCTTATCTGATTTTTGTAAAGGTCTGATAATG</td><td>63.4ºC</td></tr>
+
-
 
+
-
</table>
+
-
 
+
-
</body>
+
</html>
</html>

Revision as of 12:10, 5 August 2014

Retrieved from "http://2014.igem.org/Team:Valencia_UPV/style_css"