Wiki/Notebook wetlab.html

From 2014.igem.org

(Difference between revisions)
Line 16: Line 16:
-
<p>The enzymes involved in the biosynthesis pathways are AtrD11, HarFAR, FAO, EaDAcT.
+
<p>The enzymes involved in the biosynthesis pathways are Atr&Delta;11, HarFAR, FAO, EaDAcT.
</p>
</p>
Line 63: Line 63:
</li>
</li>
-
<li>AtrD11: Amyelois transitella (order primers for GB) 1000 bp
+
<li>Atr&Delta;11: Amyelois transitella (order primers for GB) 1000 bp
</li>
</li>
-
<ul><li>I14Jun03 AtrD11 F1
+
<ul><li>I14Jun03 Atr&Delta;11 F1
</li>
</li>
-
<li>I14Jun04 AtrD11 R1
+
<li>I14Jun04 Atr&Delta;11 R1
</li>
</li>
Line 165: Line 165:
<table style="width:300px">
<table style="width:300px">
-
<tr><td>pDGB2alpha1</td><td>GB0483</td><td>Kan
+
<tr><td>pDGB2&alpha;1</td><td>GB0483</td><td>Kan
</td></tr>
</td></tr>
-
<tr><td>pDGB2alpha2</td><td>GB0484</td><td>Kan
+
<tr><td>pDGB2&alpha;2</td><td>GB0484</td><td>Kan
</td></tr>
</td></tr>
Line 200: Line 200:
<table style="width:300px">
<table style="width:300px">
-
<tr><td>pDGB2omega1</td><td>GB0487</td><td>Smp
+
<tr><td>pDGB2&Omega;1</td><td>GB0487</td><td>Smp
</td></tr>
</td></tr>
-
<tr><td>pDGB2omega2</td><td>GB0488</td><td>Smp
+
<tr><td>pDGB2&Omega;2</td><td>GB0488</td><td>Smp
</td></tr>
</td></tr>
Line 291: Line 291:
-
<p>AtrD11 amplification by PCR with primers that contain extra nucleotides to introduce them in the sequence.  
+
<p>Atr&Delta;11 amplification by PCR with primers that contain extra nucleotides to introduce them in the sequence.  
</p>
</p>
-
<p>We made a PCR amplification using the AtrD11 gene as a template and the oligos: R +F
+
<p>We made a PCR amplification using the Atr&Delta;11 gene as a template and the oligos: R +F
</p>
</p>
Line 304: Line 304:
-
<ul><li>32.5 uL of H2O miliQ
+
<ul><li>32.5 &mu;L of H2O miliQ
</li>
</li>
-
<li>10 uL HF buffer  
+
<li>10 &mu;L HF buffer  
</li>
</li>
-
<li>2 uL dNTPs
+
<li>2 &mu;L dNTPs
</li>
</li>
-
<li>2.5 uL Reverse primer
+
<li>2.5 &mu;L Reverse primer
</li>
</li>
-
<li>2.5 uL Forward primer
+
<li>2.5 &mu;L Forward primer
</li>
</li>
-
<li>1 uL template (AtrD11 gene)
+
<li>1 &mu;L template (Atr&Delta;11 gene)
</li>
</li>
-
<li>0.5 uL phusion (polimerase)
+
<li>0.5 &mu;L phusion (polimerase)
</li>
</li>
Line 342: Line 342:
-
<p>pUPD ligation of EaDAcT, HarFar and AtrD11
+
<p>pUPD ligation of EaDAcT, HarFar and Atr&Delta;11
</p>
</p>
Line 352: Line 352:
-
<ul><li>1 uL pUPD
+
<ul><li>1 &mu;L pUPD
</li>
</li>
-
<li>1 uL PCR product/gblock product   
+
<li>1 &mu;L PCR product/gblock product   
</li>
</li>
-
<li>1.2 uL buffer 10x
+
<li>1.2 &mu;L buffer 10x
</li>
</li>
-
<li>1 uL BsmBI
+
<li>1 &mu;L BsmBI
</li>
</li>
-
<li>1 uL T4 ligase
+
<li>1 &mu;L T4 ligase
</li>
</li>
-
<li>6.8 uL H2O miliQ
+
<li>6.8 &mu;L H2O miliQ
</li>
</li>
</ul>
</ul>
-
<p>Vfinal= 12 uL
+
<p>Vfinal= 12 &mu;L
</p>
</p>
Line 382: Line 382:
-
<p>As a result, there are obtained three different pUPD plasmids containing the genes EaDAcT, HarFAR and AtrD11.
+
<p>As a result, there are obtained three different pUPD plasmids containing the genes EaDAcT, HarFAR and Atr&Delta;11.
</p>
</p>
Line 401: Line 401:
</p>
</p>
-
<p>We have used an electrocompetent E. coli strain (DH5alpha) and a sample from each product of ligation made in the previous step (three pUPD plasmids, each of them containing one of the three genes), so transformation is made three times.
+
<p>We have used an electrocompetent E. coli strain (DH5&alpha;) and a sample from each product of ligation made in the previous step (three pUPD plasmids, each of them containing one of the three genes), so transformation is made three times.
</p>
</p>
Line 414: Line 414:
</li>
</li>
-
<li>1.5 uL of ligation in pUPD (for each gene: EaDAcT, HarFAR, AtrD11)
+
<li>1.5 &mu;L of ligation in pUPD (for each gene: EaDAcT, HarFAR, Atr&Delta;11)
</li>
</li>
</ul>
</ul>
-
<p>Each mix is introduced in a electroporation vial and electroporated at 1500 V, then 300 uL of SOC are added to each vial. All of them were incubated at 37ºC for 1 hour.
+
<p>Each mix is introduced in a electroporation vial and electroporated at 1500 V, then 300 &mu;L of SOC are added to each vial. All of them were incubated at 37ºC for 1 hour.
</p>
</p>
Line 427: Line 427:
</p>
</p>
-
<p>2 cell-culture dishes per transformation (with Ampicillin), one with 50 uL and the other with the remaining volume.  
+
<p>2 cell-culture dishes per transformation (with Ampicillin), one with 50 &mu;L and the other with the remaining volume.  
</p>
</p>
Line 439: Line 439:
-
<p>Transformed colonies selection. The white ones are recultured in liquid medium. One colony of each transformation is picked and cultured in 3.5 mL LB and 7 uL Amp. This step is repeated three times:
+
<p>Transformed colonies selection. The white ones are recultured in liquid medium. One colony of each transformation is picked and cultured in 3.5 mL LB and 7 &mu;L Amp. This step is repeated three times:
</p>
</p>
Line 450: Line 450:
</li>
</li>
-
<li>3x 1 colony of AtrD11 in pUPD + LB + Amp
+
<li>3x 1 colony of Atr&Delta;11 in pUPD + LB + Amp
</li>
</li>
Line 485: Line 485:
</td></tr>
</td></tr>
-
<tr><td>AtrD11</td><td>NotI</td><td>2981, 1056
+
<tr><td>Atr&Delta;11</td><td>NotI</td><td>2981, 1056
</td></tr>
</td></tr>
Line 500: Line 500:
-
<ul><li>0.5 uL restriction enzyme
+
<ul><li>0.5 &mu;L restriction enzyme
</li>
</li>
-
<li>2.5 uL buffer
+
<li>2.5 &mu;L buffer
</li>
</li>
-
<li>21 uL H20 (miliQ)
+
<li>21 &mu;L H20 (miliQ)
</li>
</li>
-
<li>1 uL sample
+
<li>1 &mu;L sample
</li>
</li>
Line 522: Line 522:
</li>
</li>
-
<ul><li>5 uL NotI
+
<ul><li>5 &mu;L NotI
</li>
</li>
-
<li>25 uL Orange
+
<li>25 &mu;L Orange
</li>
</li>
-
<li>210 uL H20
+
<li>210 &mu;L H20
</li>
</li>
Line 534: Line 534:
</li>
</li>
-
<ul><li>1.5 uL RsaI
+
<ul><li>1.5 &mu;L RsaI
</li>
</li>
-
<li>7.5 uL Tango
+
<li>7.5 &mu;L Tango
</li>
</li>
-
<li>63 uL H20
+
<li>63 &mu;L H20
</li>
</li>
Line 546: Line 546:
</li>
</li>
-
<ul><li>1.5 uL PvuII
+
<ul><li>1.5 &mu;L PvuII
</li>
</li>
-
<li>7.5 uL Green
+
<li>7.5 &mu;L Green
</li>
</li>
-
<li>63 uL H20
+
<li>63 &mu;L H20
</li>
</li>
Line 558: Line 558:
</li>
</li>
-
<ul><li>1.5 uL BanII
+
<ul><li>1.5 &mu;L BanII
</li>
</li>
-
<li>7.5 uL Tango
+
<li>7.5 &mu;L Tango
</li>
</li>
-
<li>63 uL H20
+
<li>63 &mu;L H20
</li>
</li>
Line 602: Line 602:
</li>
</li>
-
<li>7 uL Amp
+
<li>7 &mu;L Amp
</li>
</li>
-
<li>7 uL X-Gal
+
<li>7 &mu;L X-Gal
</li>
</li>
-
<li>3.5 uL IPTG (turns the tube blue if the colonies picked were blue)
+
<li>3.5 &mu;L IPTG (turns the tube blue if the colonies picked were blue)
</li>
</li>
Line 617: Line 617:
-
<p>We made minipreps of yesterday's culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes HarFAR 1, 2, 3; EaDAcT 3 and AtrD11 2, 3.
+
<p>We made minipreps of yesterday's culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes HarFAR 1, 2, 3; EaDAcT 3 and Atr&Delta;11 2, 3.
</p>
</p>
Line 641: Line 641:
</td></tr>
</td></tr>
-
<tr><td>AtrD11</td><td>NotI</td><td>2981, 1056
+
<tr><td>Atr&Delta;11</td><td>NotI</td><td>2981, 1056
</td></tr>
</td></tr>
Line 659: Line 659:
</li>
</li>
-
<ul><li>3.5 uL NotI
+
<ul><li>3.5 &mu;L NotI
</li>
</li>
-
<li>17.5 uL Orange
+
<li>17.5 &mu;L Orange
</li>
</li>
-
<li>147 uL H20
+
<li>147 &mu;L H20
</li>
</li>
Line 671: Line 671:
</li>
</li>
-
<ul><li>2 uL RsaI
+
<ul><li>2 &mu;L RsaI
</li>
</li>
-
<li>10 uL Tango
+
<li>10 &mu;L Tango
</li>
</li>
-
<li>84 uL H20
+
<li>84 &mu;L H20
</li>
</li>
Line 683: Line 683:
</li>
</li>
-
<ul><li>2 uL PvuII
+
<ul><li>2 &mu;L PvuII
</li>
</li>
-
<li>10 uL Green
+
<li>10 &mu;L Green
</li>
</li>
-
<li>84 uL H20
+
<li>84 &mu;L H20
</li>
</li>
Line 704: Line 704:
-
<p>Everything was OK. We sent AtrD11 (3), HarFAR (3) and EaDAcT (3) to sequence.
+
<p>Everything was OK. We sent Atr&Delta;11 (3), HarFAR (3) and EaDAcT (3) to sequence.
</p>
</p>
Line 718: Line 718:
-
<p>The next step is to build a transciptional unit (TU) with our sequences. A transcriptional unit is a structure composed by promoter, coding sequence (CDS) and terminator in an alpha or omega vector.
+
<p>The next step is to build a transciptional unit (TU) with our sequences. A transcriptional unit is a structure composed by promoter, coding sequence (CDS) and terminator in an &alpha; or &Omega; vector.
</p>
</p>
Line 728: Line 728:
-
<ul><li>1 uL promoter 75 ng/uL
+
<ul><li>1 &mu;L promoter 75 ng/&mu;L
</li>
</li>
-
<li>1 uL terminator 75 ng/uL
+
<li>1 &mu;L terminator 75 ng/&mu;L
</li>
</li>
-
<li>1 uL CDS 75 ng/uL
+
<li>1 &mu;L CDS 75 ng/&mu;L
</li>
</li>
-
<li>1 uL vector alpha
+
<li>1 &mu;L vector &alpha;
</li>
</li>
-
<li>1.2 uL ligase buffer 10x
+
<li>1.2 &mu;L ligase buffer 10x
</li>
</li>
-
<li>1 uL T4
+
<li>1 &mu;L T4
</li>
</li>
-
<li>1 uL BsaI
+
<li>1 &mu;L BsaI
</li>
</li>
-
<li>4.2 uL H20
+
<li>4.2 &mu;L H20
</li>
</li>
</ul>
</ul>
-
<p>Total: 12 uL
+
<p>Total: 12 &mu;L
</p>
</p>
-
<p>Take into account that if we want to make binary constructions later (merge 2 TU in a same vector), we need to clone each TU in a different alpha vector.
+
<p>Take into account that if we want to make binary constructions later (merge 2 TU in a same vector), we need to clone each TU in a different &alpha; vector.
</p>
</p>
Line 771: Line 771:
<table style="width:300px">
<table style="width:300px">
-
<tr><td>AtrD11</td><td>P35s</td><td>T35s</td><td>40.41
+
<tr><td>Atr&Delta;11</td><td>P35s</td><td>T35s</td><td>40.41
</td></tr>
</td></tr>
Line 784: Line 784:
-
<p>Adjust concentrations to 75 ng/uL for ligation reaction
+
<p>Adjust concentrations to 75 ng/&mu;L for ligation reaction
</p>
</p>
Line 799: Line 799:
</td></tr>
</td></tr>
-
<tr><td>PAtUpb</td><td>442.6 ng/uL</td><td>34 uL</td><td>166.6 uL
+
<tr><td>PAtUpb</td><td>442.6 ng/&mu;L</td><td>34 &mu;L</td><td>166.6 &mu;L
</td></tr>
</td></tr>
-
<tr><td>pTatHSP</td><td>235.4 ng/uL</td><td>36 uL</td><td>77 uL
+
<tr><td>pTatHSP</td><td>235.4 ng/&mu;L</td><td>36 &mu;L</td><td>77 &mu;L
</td></tr>
</td></tr>
-
<tr><td>T35s</td><td>194.9 ng/uL</td><td>37.5 uL</td><td>60 uL
+
<tr><td>T35s</td><td>194.9 ng/&mu;L</td><td>37.5 &mu;L</td><td>60 &mu;L
</td></tr>
</td></tr>
-
<tr><td>P35s</td><td>454.7 ng/uL</td><td>36 uL</td><td>182 uL
+
<tr><td>P35s</td><td>454.7 ng/&mu;L</td><td>36 &mu;L</td><td>182 &mu;L
</td></tr>
</td></tr>
-
<tr><td>2alpha1</td><td>57.1 ng/uL</td><td>-</td><td>We will need to put 1.5 uL of this one
+
<tr><td>2&alpha;1</td><td>57.1 ng/&mu;L</td><td>-</td><td>We will need to put 1.5 &mu;L of this one
</td></tr>
</td></tr>
-
<tr><td>2alpha2</td><td>104.0 ng/uL</td><td>38 uL</td><td>14.7 uL
+
<tr><td>2&alpha;2</td><td>104.0 ng/&mu;L</td><td>38 &mu;L</td><td>14.7 &mu;L
</td></tr>
</td></tr>
-
<tr><td>AtrD11</td><td>359.3 ng/uL</td><td>20 uL</td><td>75.8 uL
+
<tr><td>Atr&Delta;11</td><td>359.3 ng/&mu;L</td><td>20 &mu;L</td><td>75.8 &mu;L
</td></tr>
</td></tr>
-
<tr><td>HarFAR</td><td>404.4 ng/uL</td><td>15 uL</td><td>65.9 uL
+
<tr><td>HarFAR</td><td>404.4 ng/&mu;L</td><td>15 &mu;L</td><td>65.9 &mu;L
</td></tr>
</td></tr>
-
<tr><td>EaDAcT</td><td>155.6 ng/uL</td><td>10 uL</td><td>10.7 uL
+
<tr><td>EaDAcT</td><td>155.6 ng/&mu;L</td><td>10 &mu;L</td><td>10.7 &mu;L
</td></tr>
</td></tr>
Line 835: Line 835:
-
<ul><li>P35s:AtrD11:T35s in 2alpha1
+
<ul><li>P35s:Atr&Delta;11:T35s in 2&alpha;1
</li>
</li>
-
<ul><li>1 uL P35s
+
<ul><li>1 &mu;L P35s
</li>
</li>
-
<li>1 uL T35s
+
<li>1 &mu;L T35s
</li>
</li>
-
<li>1 uL AtrD11
+
<li>1 &mu;L Atr&Delta;11
</li>
</li>
-
<li>1.5 uL 2alpha1
+
<li>1.5 &mu;L 2&alpha;1
</li>
</li>
-
<li>1.2 uL ligase buffer 10x
+
<li>1.2 &mu;L ligase buffer 10x
</li>
</li>
-
<li>1 uL T4
+
<li>1 &mu;L T4
</li>
</li>
-
<li>1 uL BsaI
+
<li>1 &mu;L BsaI
</li>
</li>
-
<li>3.7 uL H20
+
<li>3.7 &mu;L H20
</li>
</li>
</ul></ul>
</ul></ul>
-
<ul><li>P35s:HarFAR:TatHSP in 2alpha2
+
<ul><li>P35s:HarFAR:TatHSP in 2&alpha;2
</li>
</li>
-
<ul><li>1 uL P35s
+
<ul><li>1 &mu;L P35s
</li>
</li>
-
<li>1 uL TatHSP
+
<li>1 &mu;L TatHSP
</li>
</li>
-
<li>1 uL HarFAR
+
<li>1 &mu;L HarFAR
</li>
</li>
-
<li>1 uL 2alpha2
+
<li>1 &mu;L 2&alpha;2
</li>
</li>
-
<li>1.2 uL ligase buffer 10x
+
<li>1.2 &mu;L ligase buffer 10x
</li>
</li>
-
<li>1 uL T4
+
<li>1 &mu;L T4
</li>
</li>
-
<li>1 uL BsaI
+
<li>1 &mu;L BsaI
</li>
</li>
-
<li>4.2 uL H20
+
<li>4.2 &mu;L H20
</li>
</li>
</ul></ul>
</ul></ul>
-
<ul><li>PAtUbq:EaDAcT:TatHSP in 2alpha2
+
<ul><li>PAtUbq:EaDAcT:TatHSP in 2&alpha;2
</li>
</li>
-
<ul><li>1 uL PAtUbq
+
<ul><li>1 &mu;L PAtUbq
</li>
</li>
-
<li>1 uL TatHSP
+
<li>1 &mu;L TatHSP
</li>
</li>
-
<li>1 uL EaDAcT
+
<li>1 &mu;L EaDAcT
</li>
</li>
-
<li>1 uL 2alpha2
+
<li>1 &mu;L 2&alpha;2
</li>
</li>
-
<li>1.2 uL ligase buffer 10x
+
<li>1.2 &mu;L ligase buffer 10x
</li>
</li>
-
<li>1 uL T4
+
<li>1 &mu;L T4
</li>
</li>
-
<li>1 uL BsaI
+
<li>1 &mu;L BsaI
</li>
</li>
-
<li>4.2 uL H20
+
<li>4.2 &mu;L H20
</li>
</li>
Line 936: Line 936:
-
<ul><li>Mutation in AtrD11 -> We threw away the colonies and transformed cells. We picked again white colonies.
+
<ul><li>Mutation in Atr&Delta;11 -> We threw away the colonies and transformed cells. We picked again white colonies.
</li>
</li>
Line 947: Line 947:
</ul>
</ul>
-
<p>We took vectors 2omega1 (GB0487) and 2omega2 (GB0488) parts from the GB colection.
+
<p>We took vectors 2&Omega;1 (GB0487) and 2&Omega;2 (GB0488) parts from the GB colection.
</p>
</p>
Line 963: Line 963:
</ul>
</ul>
-
<p>Cultivate transformated cells in two Kan plaques (Kan matches vector alpha)
+
<p>Cultivate transformated cells in two Kan plaques (Kan matches vector &alpha;)
</p>
</p>
Line 971: Line 971:
</li>
</li>
-
<li>Rest of the culture in another (250 uL aprox)
+
<li>Rest of the culture in another (250 &mu;L aprox)
</li>
</li>
Line 988: Line 988:
-
<ul><li>6 from AtrD11 (repetition because of mutation)
+
<ul><li>6 from Atr&Delta;11 (repetition because of mutation)
</li>
</li>
Line 994: Line 994:
</li>
</li>
-
<li>7 uL Amp
+
<li>7 &mu;L Amp
</li>
</li>
-
<li>7 uL X-gal
+
<li>7 &mu;L X-gal
</li>
</li>
-
<li>3.5 uL IPTG
+
<li>3.5 &mu;L IPTG
</li>
</li>
-
</ul><li>1 colony from 2omega1
+
</ul><li>1 colony from 2&Omega;1
</li>
</li>
Line 1,009: Line 1,009:
</li>
</li>
-
<li>7 uL Spm
+
<li>7 &mu;L Spm
</li>
</li>
</ul></ul>
</ul></ul>
-
<ul><li>1 colony from 2omega2
+
<ul><li>1 colony from 2&Omega;2
</li>
</li>
Line 1,020: Line 1,020:
</li>
</li>
-
<li>7 uL Spm
+
<li>7 &mu;L Spm
</li>
</li>
Line 1,029: Line 1,029:
</li>
</li>
-
<li>7 uL Kan
+
<li>7 &mu;L Kan
</li>
</li>
Line 1,038: Line 1,038:
</li>
</li>
-
<li>7 uL Kan
+
<li>7 &mu;L Kan
</li>
</li>
Line 1,065: Line 1,065:
-
<p>We made minipreps of yesterday's liquid culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes AtrD11 3 and 6; 2omega1; 2omega2; constructions P35s:HarFAR:TatHSP 1, 2, 3 and PAtUbq:EaDAcT:TatHSP 1, 2, 3.
+
<p>We made minipreps of yesterday's liquid culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes Atr&Delta;11 3 and 6; 2&Omega;1; 2&Omega;2; constructions P35s:HarFAR:TatHSP 1, 2, 3 and PAtUbq:EaDAcT:TatHSP 1, 2, 3.
</p>
</p>
Line 1,089: Line 1,089:
</td></tr>
</td></tr>
-
<tr><td>PAtUbq:EaDAcT:TatHSP in 2alpha2</td><td>HindIII</td><td>6322, 1722, 736, 221
+
<tr><td>PAtUbq:EaDAcT:TatHSP in 2&alpha;2</td><td>HindIII</td><td>6322, 1722, 736, 221
</td></tr>
</td></tr>
-
<tr><td>P35s:HarFAR:TatHSP in 2 alpha2</td><td>HindIII</td><td>6322, 1794, 221
+
<tr><td>P35s:HarFAR:TatHSP in 2 &alpha;2</td><td>HindIII</td><td>6322, 1794, 221
</td></tr>
</td></tr>
-
<tr><td>AtrD11</td><td>NotI</td><td>2961, 1056
+
<tr><td>Atr&Delta;11</td><td>NotI</td><td>2961, 1056
</td></tr>
</td></tr>
-
<tr><td>2omega1</td><td>BamHI</td><td>6652, 382, 239
+
<tr><td>2&Omega;1</td><td>BamHI</td><td>6652, 382, 239
</td></tr>
</td></tr>
-
<tr><td>2omega2</td><td>EcoRV</td><td>6652, 621
+
<tr><td>2&Omega;2</td><td>EcoRV</td><td>6652, 621
</td></tr>
</td></tr>
Line 1,116: Line 1,116:
</li>
</li>
-
<ul><li>3.5 uL HindIII
+
<ul><li>3.5 &mu;L HindIII
</li>
</li>
-
<li>17.5 uL Red
+
<li>17.5 &mu;L Red
</li>
</li>
-
<li>147 uL H20
+
<li>147 &mu;L H20
</li>
</li>
Line 1,128: Line 1,128:
</li>
</li>
-
<ul><li>1.5 uL NotI
+
<ul><li>1.5 &mu;L NotI
</li>
</li>
-
<li>7.5 uL Orange
+
<li>7.5 &mu;L Orange
</li>
</li>
-
<li>63 uL H20
+
<li>63 &mu;L H20
</li>
</li>
Line 1,140: Line 1,140:
</li>
</li>
-
<ul><li>0.5 uL EcoRV
+
<ul><li>0.5 &mu;L EcoRV
</li>
</li>
-
<li>2.5 uL Red
+
<li>2.5 &mu;L Red
</li>
</li>
-
<li>21 uL H20
+
<li>21 &mu;L H20
</li>
</li>
Line 1,152: Line 1,152:
</li>
</li>
-
<ul><li>0.5 uL PvuII
+
<ul><li>0.5 &mu;L PvuII
</li>
</li>
-
<li>2.5 uL Green
+
<li>2.5 &mu;L Green
</li>
</li>
-
<li>21 uL H20
+
<li>21 &mu;L H20
</li>
</li>
Line 1,175: Line 1,175:
-
<p>Everything was OK except the AtrD11 (3), which had some partial digestion. It was the reason we sent AtrD11 (6) to sequence.
+
<p>Everything was OK except the Atr&Delta;11 (3), which had some partial digestion. It was the reason we sent Atr&Delta;11 (6) to sequence.
</p>
</p>
Line 1,189: Line 1,189:
-
<p>Reagents needed for the reaction of ligation (Total volume = 12 uL):
+
<p>Reagents needed for the reaction of ligation (Total volume = 12 &mu;L):
</p>
</p>
-
<ul><li>P35s:AtrD11:T35s in 2alpha1
+
<ul><li>P35s:Atr&Delta;11:T35s in 2&alpha;1
</li>
</li>
-
<ul><li>1 uL P35s
+
<ul><li>1 &mu;L P35s
</li>
</li>
-
<li>1 uL T35s
+
<li>1 &mu;L T35s
</li>
</li>
-
<li>1 uL AtrD11
+
<li>1 &mu;L Atr&Delta;11
</li>
</li>
-
<li>1.5 uL 2alpha1
+
<li>1.5 &mu;L 2&alpha;1
</li>
</li>
-
<li>1.2 uL ligase buffer 10x
+
<li>1.2 &mu;L ligase buffer 10x
</li>
</li>
-
<li>1 uL T4
+
<li>1 &mu;L T4
</li>
</li>
-
<li>1 uL BsaI
+
<li>1 &mu;L BsaI
</li>
</li>
-
<li>3.7 uL H20
+
<li>3.7 &mu;L H20
</li>
</li>
-
</ul><li>P35s:HarFAR:T35s in 2alpha2
+
</ul><li>P35s:HarFAR:T35s in 2&alpha;2
</li>
</li>
-
<ul><li>1 uL P35s
+
<ul><li>1 &mu;L P35s
</li>
</li>
-
<li>1 uL T35s
+
<li>1 &mu;L T35s
</li>
</li>
-
<li>1 uL HarFAR
+
<li>1 &mu;L HarFAR
</li>
</li>
-
<li>1 uL 2alpha2
+
<li>1 &mu;L 2&alpha;2
</li>
</li>
-
<li>1.2 uL ligase buffer 10x
+
<li>1.2 &mu;L ligase buffer 10x
</li>
</li>
-
<li>1 uL T4
+
<li>1 &mu;L T4
</li>
</li>
-
<li>1 uL BsaI
+
<li>1 &mu;L BsaI
</li>
</li>
-
<li>4.2 uL H20
+
<li>4.2 &mu;L H20
</li>
</li>
-
</ul><li>P35s:EaDAcT:T35s in 2alpha2
+
</ul><li>P35s:EaDAcT:T35s in 2&alpha;2
</li>
</li>
-
<ul><li>1 uL P35s
+
<ul><li>1 &mu;L P35s
</li>
</li>
-
<li>1 uL T35s
+
<li>1 &mu;L T35s
</li>
</li>
-
<li>1 uL EaDAcT
+
<li>1 &mu;L EaDAcT
</li>
</li>
-
<li>1 uL 2alpha2
+
<li>1 &mu;L 2&alpha;2
</li>
</li>
-
<li>1.2 uL ligase buffer 10x
+
<li>1.2 &mu;L ligase buffer 10x
</li>
</li>
-
<li>1 uL T4
+
<li>1 &mu;L T4
</li>
</li>
-
<li>1 uL BsaI
+
<li>1 &mu;L BsaI
</li>
</li>
-
<li>4.2 uL H20
+
<li>4.2 &mu;L H20
</li>
</li>
</ul></ul>
</ul></ul>
-
<p>Note: Concentrations were previously adjusted to 75 ng/uL. Only the AtrD11 was adjusted from 250.2 ng/uL.
+
<p>Note: Concentrations were previously adjusted to 75 ng/&mu;L. Only the Atr&Delta;11 was adjusted from 250.2 ng/&mu;L.
</p>
</p>
Line 1,290: Line 1,290:
</li>
</li>
-
<ul><li>pAtrD11 (6)
+
<ul><li>pAtr&Delta;11 (6)
</li>
</li>
Line 1,302: Line 1,302:
</li>
</li>
-
<ul><li>P35:HarFAR:TatHSP in 2alpha2 (3)
+
<ul><li>P35:HarFAR:TatHSP in 2&alpha;2 (3)
</li>
</li>
Line 1,314: Line 1,314:
-
<p>Storage in glycerol of the HarFAR (GB1018), AtrD11 (GB1019), EaDAcT (GB1020), P35s:HarFAR:TatHSP in 2alpha2 (GB1021) and PAtUbq:EaDAcT:TatHSP in 2alpha2 (GB1022). We made 3 tubes: one for us, one for the GB collenction and one for reserve.  
+
<p>Storage in glycerol of the HarFAR (GB1018), Atr&Delta;11 (GB1019), EaDAcT (GB1020), P35s:HarFAR:TatHSP in 2&alpha;2 (GB1021) and PAtUbq:EaDAcT:TatHSP in 2&alpha;2 (GB1022). We made 3 tubes: one for us, one for the GB collenction and one for reserve.  
</p>
</p>
-
<p>The procedure is to mix 700 uL of culture with 300 uL of glycerol 50%, spin it and store it in the -80ºC.
+
<p>The procedure is to mix 700 &mu;L of culture with 300 &mu;L of glycerol 50%, spin it and store it in the -80ºC.
</p>
</p>
Line 1,328: Line 1,328:
-
<p>Pick 3 colonies of P35s:AtrD11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Culture in liquid medium with Kan.
+
<p>Pick 3 colonies of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Culture in liquid medium with Kan.
</p>
</p>
Line 1,343: Line 1,343:
</td></tr>
</td></tr>
-
<tr><td>P35s:AtrD11:T35s</td><td>EcoRI</td><td>6323, 2269
+
<tr><td>P35s:Atr&Delta;11:T35s</td><td>EcoRI</td><td>6323, 2269
</td></tr>
</td></tr>
Line 1,374: Line 1,374:
-
<p>Mistake in P35s:AtrD11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s minipreps. Repeat tomorrow.
+
<p>Mistake in P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s minipreps. Repeat tomorrow.
</p>
</p>
Line 1,385: Line 1,385:
-
<p>Minipreps of P35s:AtrD11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Concentration measuments with nanodrop.
+
<p>Minipreps of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Concentration measuments with nanodrop.
</p>
</p>
Line 1,392: Line 1,392:
<table style="width:300px">
<table style="width:300px">
-
<tr><td>Transcriptional unit </td><td>DNA concentration (ng/uL)
+
<tr><td>Transcriptional unit </td><td>DNA concentration (ng/&mu;L)
</td></tr>
</td></tr>
-
<tr><td>P35s:AtrD11:T35s (1)</td><td>164 ng/uL
+
<tr><td>P35s:Atr&Delta;11:T35s (1)</td><td>164 ng/&mu;L
</td></tr>
</td></tr>
-
<tr><td>P35s:AtrD11:T35s (2)</td><td>168 ng/uL
+
<tr><td>P35s:Atr&Delta;11:T35s (2)</td><td>168 ng/&mu;L
</td></tr>
</td></tr>
-
<tr><td>P35s:AtrD11:T35s (3)</td><td>147.4 ng/uL
+
<tr><td>P35s:Atr&Delta;11:T35s (3)</td><td>147.4 ng/&mu;L
</td></tr>
</td></tr>
-
<tr><td>P35s:HarFAR:T35s (1)</td><td>125.3 ng/uL
+
<tr><td>P35s:HarFAR:T35s (1)</td><td>125.3 ng/&mu;L
</td></tr>
</td></tr>
-
<tr><td>P35s:HarFAR:T35s (2)</td><td>114.5 ng/uL
+
<tr><td>P35s:HarFAR:T35s (2)</td><td>114.5 ng/&mu;L
</td></tr>
</td></tr>
-
<tr><td>P35s:HarFAR:T35s (3)</td><td>140.3 ng/uL
+
<tr><td>P35s:HarFAR:T35s (3)</td><td>140.3 ng/&mu;L
</td></tr>
</td></tr>
-
<tr><td>P35s:EaDAcT:T35s (1)</td><td>144.2 ng/uL
+
<tr><td>P35s:EaDAcT:T35s (1)</td><td>144.2 ng/&mu;L
</td></tr>
</td></tr>
-
<tr><td>P35s:EaDAcT:T35s (2)</td><td>137.9 ng/uL
+
<tr><td>P35s:EaDAcT:T35s (2)</td><td>137.9 ng/&mu;L
</td></tr>
</td></tr>
-
<tr><td>P35s:EaDAcT:T35s (3)</td><td>128.5 ng/uL
+
<tr><td>P35s:EaDAcT:T35s (3)</td><td>128.5 ng/&mu;L
</td></tr>
</td></tr>
-
<tr><td>Stuffer fragment</td><td>135.5 ng/uL
+
<tr><td>Stuffer fragment</td><td>135.5 ng/&mu;L
</td></tr>
</td></tr>
-
<tr><td>2omega1</td><td>196.8 ng/uL
+
<tr><td>2&Omega;1</td><td>196.8 ng/&mu;L
</td></tr>
</td></tr>
-
<tr><td>2omega2</td><td>175.4 ng/uL
+
<tr><td>2&Omega;2</td><td>175.4 ng/&mu;L
</td></tr>
</td></tr>
Line 1,435: Line 1,435:
-
<p>Digestions of P35s:AtrD11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s and gel electrophoresis to check if transciptional units have been assembled OK.
+
<p>Digestions of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s and gel electrophoresis to check if transciptional units have been assembled OK.
</p>
</p>
Line 1,450: Line 1,450:
-
<p>Ligation in omega vectors.
+
<p>Ligation in &Omega; vectors.
</p>
</p>
-
<ul><li>P35s:AtrD11:T35s + P35s:HarFAR:T35s in 2omega1
+
<ul><li>P35s:Atr&Delta;11:T35s + P35s:HarFAR:T35s in 2&Omega;1
</li>
</li>
-
<ul><li>1 uL P35s:AtrD11:T35s (75 ng/uL)
+
<ul><li>1 &mu;L P35s:Atr&Delta;11:T35s (75 ng/&mu;L)
</li>
</li>
-
<li>1 uL P35s:HarFAR:T35s (75 ng/uL)
+
<li>1 &mu;L P35s:HarFAR:T35s (75 ng/&mu;L)
</li>
</li>
-
<li>1 uL 2omega1 (75 ng/uL)
+
<li>1 &mu;L 2&Omega;1 (75 ng/&mu;L)
</li>
</li>
-
<li>1 uL BsmBI (5-10 ud)
+
<li>1 &mu;L BsmBI (5-10 ud)
</li>
</li>
-
<li>1 uL T4 ligase (5-10 ud)
+
<li>1 &mu;L T4 ligase (5-10 ud)
</li>
</li>
-
<li>1 uL buffer ligase (3 ud)
+
<li>1 &mu;L buffer ligase (3 ud)
</li>
</li>
-
<li>4 uL H20
+
<li>4 &mu;L H20
</li>
</li>
-
</ul><li>P35s:EaDAcT:T35s in 2omega2
+
</ul><li>P35s:EaDAcT:T35s in 2&Omega;2
</li>
</li>
-
<ul><li>1 uL stuffer fragment (75 ng/uL)
+
<ul><li>1 &mu;L stuffer fragment (75 ng/&mu;L)
</li>
</li>
-
<li>1 uL P35s:EaDAcT:T35s (75 ng/uL)
+
<li>1 &mu;L P35s:EaDAcT:T35s (75 ng/&mu;L)
</li>
</li>
-
<li>1 uL 2omega2 (75 ng/uL)
+
<li>1 &mu;L 2&Omega;2 (75 ng/&mu;L)
</li>
</li>
-
<li>1 uL BsmBI (5-10 ud)
+
<li>1 &mu;L BsmBI (5-10 ud)
</li>
</li>
-
<li>1 uL T4 ligase (5-10 ud)
+
<li>1 &mu;L T4 ligase (5-10 ud)
</li>
</li>
-
<li>1 uL buffer ligase (3 ud)
+
<li>1 &mu;L buffer ligase (3 ud)
</li>
</li>
-
<li>4 uL H20
+
<li>4 &mu;L H20
</li>
</li>
Line 1,519: Line 1,519:
-
<p>Transform and grow in Petri dishes yesterday's ligations: P35S:AtrD11:T35S + P35S:HarFAR:T35S in 2omega1 and P35S:EaDAcT:T35S in 2omega2.
+
<p>Transform and grow in Petri dishes yesterday's ligations: P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1 and P35S:EaDAcT:T35S in 2&Omega;2.
</p>
</p>
Line 1,528: Line 1,528:
-
<p>Pick colonies of P35S:AtrD11:T35S + P35S:HarFAR:T35S in 2omega1 (3) and P35S:EaDAcT:T35S in 2omega2 (2).
+
<p>Pick colonies of P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1 (3) and P35S:EaDAcT:T35S in 2&Omega;2 (2).
</p>
</p>
Line 1,540: Line 1,540:
</p>
</p>
-
<ul><li>P35S:AtrD11:T35S + P35S:HarFAR:T35S in 2omega1(Tubes 1, 2 and 3)
+
<ul><li>P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1(Tubes 1, 2 and 3)
</li>
</li>
-
<li>P35S:EaDAcT:T35S in 2omega2 (Tubes 1 and 2)
+
<li>P35S:EaDAcT:T35S in 2&Omega;2 (Tubes 1 and 2)
</li>
</li>
Line 1,563: Line 1,563:
</td></tr>
</td></tr>
-
<tr><td>P35S:AtrD11:T35S+P35S:HarFAR:T35S in 2omega1</td><td></td><td>EcoRV</td><td>9307, 2251
+
<tr><td>P35S:Atr&Delta;11:T35S+P35S:HarFAR:T35S in 2&Omega;1</td><td></td><td>EcoRV</td><td>9307, 2251
</td></tr>
</td></tr>
Line 1,569: Line 1,569:
</td></tr>
</td></tr>
-
<tr><td>P35S:EaDAcT:T35S in 2omega2</td><td>EcoRV</td><td>6652, 1044, 817, 683
+
<tr><td>P35S:EaDAcT:T35S in 2&Omega;2</td><td>EcoRV</td><td>6652, 1044, 817, 683
</td></tr>
</td></tr>
Line 1,587: Line 1,587:
</li>
</li>
-
<ul><li>1.5 uL NotI
+
<ul><li>1.5 &mu;L NotI
</li>
</li>
-
<li>7.5 uL Orange buffer
+
<li>7.5 &mu;L Orange buffer
</li>
</li>
-
<li>63 uL H20
+
<li>63 &mu;L H20
</li>
</li>
Line 1,599: Line 1,599:
</li>
</li>
-
<ul><li>1.5 uL NcoI
+
<ul><li>1.5 &mu;L NcoI
</li>
</li>
-
<li>7.5 uL Tango buffer
+
<li>7.5 &mu;L Tango buffer
</li>
</li>
-
<li>63 uL H20
+
<li>63 &mu;L H20
</li>
</li>
Line 1,611: Line 1,611:
</li>
</li>
-
<ul><li>2 uL BamHI
+
<ul><li>2 &mu;L BamHI
</li>
</li>
-
<li>10 uL Green buffer
+
<li>10 &mu;L Green buffer
</li>
</li>
-
<li>84 uL H20
+
<li>84 &mu;L H20
</li>
</li>
Line 1,623: Line 1,623:
</li>
</li>
-
<ul><li>4 uL EcoRV
+
<ul><li>4 &mu;L EcoRV
</li>
</li>
-
<li>20 uL Red buffer
+
<li>20 &mu;L Red buffer
</li>
</li>
-
<li>168 uL H20
+
<li>168 &mu;L H20
</li>
</li>
Line 1,639: Line 1,639:
-
<p>All digestions were correct except the transcriptional unit of EaDAcT in 2omega2 (P35s:EaDAcT:T35S).  
+
<p>All digestions were correct except the transcriptional unit of EaDAcT in 2&Omega;2 (P35s:EaDAcT:T35S).  
</p>
</p>
Line 1,662: Line 1,662:
<table style="width:300px">
<table style="width:300px">
-
<tr><td>Piece</td><td>Tube</td><td>Concentration (ng/uL)</td><td>Volume (uL)
+
<tr><td>Piece</td><td>Tube</td><td>Concentration (ng/&mu;L)</td><td>Volume (&mu;L)
</td></tr>
</td></tr>
Line 1,671: Line 1,671:
</td></tr>
</td></tr>
-
<tr><td>P35S:EaDAcT:T35S in 2omega2</td><td>1</td><td>350.7</td><td>33
+
<tr><td>P35S:EaDAcT:T35S in 2&Omega;2</td><td>1</td><td>350.7</td><td>33
</td></tr>
</td></tr>
-
<tr><td>P35S:EaDAcT:T35S in 2omega2</td><td>2</td><td>271.1</td><td>33
+
<tr><td>P35S:EaDAcT:T35S in 2&Omega;2</td><td>2</td><td>271.1</td><td>33
</td></tr>
</td></tr>
-
<tr><td>P35S:AtrD11:T35S + P35S:HarFAR:T35S in 2omega1</td><td>1</td><td>306.3</td><td>31
+
<tr><td>P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td>1</td><td>306.3</td><td>31
</td></tr>
</td></tr>
-
<tr><td>P35S:AtrD11:T35S + P35S:HarFAR:T35S in 2omega1</td><td>2</td><td>296.6</td><td>28
+
<tr><td>P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td>2</td><td>296.6</td><td>28
</td></tr>
</td></tr>
-
<tr><td>P35S:AtrD11:T35S + P35S:HarFAR:T35S in 2omega1</td><td>3</td><td>246.0</td><td>33
+
<tr><td>P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td>3</td><td>246.0</td><td>33
</td></tr>
</td></tr>
Line 1,690: Line 1,690:
-
<p>All of the pieces named above were adjusted at 75 ng/uL.
+
<p>All of the pieces named above were adjusted at 75 ng/&mu;L.
</p>
</p>
Line 1,697: Line 1,697:
<table style="width:300px">
<table style="width:300px">
-
<tr><td>Piece </td><td>Tube number</td><td>Final Volume (uL)</td><td>Volume to be added (uL)
+
<tr><td>Piece </td><td>Tube number</td><td>Final Volume (&mu;L)</td><td>Volume to be added (&mu;L)
</td></tr>
</td></tr>
Line 1,706: Line 1,706:
</td></tr>
</td></tr>
-
<tr><td>P35S:EaDAcT:T35S in 2omega2</td><td>1</td><td>154.30</td><td>121.3
+
<tr><td>P35S:EaDAcT:T35S in 2&Omega;2</td><td>1</td><td>154.30</td><td>121.3
</td></tr>
</td></tr>
-
<tr><td>P35S:EaDAcT:T35S in 2omega2</td><td>2</td><td>119.30</td><td>86.30</td><td>
+
<tr><td>P35S:EaDAcT:T35S in 2&Omega;2</td><td>2</td><td>119.30</td><td>86.30</td><td>
</td></tr>
</td></tr>
-
<tr><td>P35S:AtrD11:T35S + P35S:HarFAR:T35S in 2omega1</td><td>1</td><td>126.60</td><td>95.60
+
<tr><td>P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td>1</td><td>126.60</td><td>95.60
</td></tr>
</td></tr>
-
<tr><td>P35S:AtrD11:T35S + P35S:HarFAR:T35S in 2omega1</td><td>2</td><td>110.70</td><td>82.70
+
<tr><td>P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td>2</td><td>110.70</td><td>82.70
</td></tr>
</td></tr>
-
<tr><td>P35S:AtrD11:T35S + P35S:HarFAR:T35S in 2omega1</td><td>3</td><td>108.24</td><td>75.20
+
<tr><td>P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td>3</td><td>108.24</td><td>75.20
</td></tr>
</td></tr>
Line 1,732: Line 1,732:
-
<p>We transformed the same TU in a E. coli competent strain (DH5alpha). Then, the transformants were cultured in LB media and Spm and stored at 37ºC overnight.  
+
<p>We transformed the same TU in a E. coli competent strain (DH5&alpha;). Then, the transformants were cultured in LB media and Spm and stored at 37ºC overnight.  
</p>
</p>
Line 1,827: Line 1,827:
</li>
</li>
-
<li>Resuspend cells in 200 uL protoplast-buffer (100 mM Tris-HCl, pH 7.5, 10 mM EDTA, 1000 units Zymolyase/mL, 10 uL beta-mercaptoethanol/mL; prepare freshly!). Incubate at 37ºC for 1-2 h and finally resuspend by turning the cups.  
+
<li>Resuspend cells in 200 &mu;L protoplast-buffer (100 mM Tris-HCl, pH 7.5, 10 mM EDTA, 1000 units Zymolyase/mL, 10 &mu;L beta-mercaptoethanol/mL; prepare freshly!). Incubate at 37ºC for 1-2 h and finally resuspend by turning the cups.  
</li>
</li>
-
<li>Add 200 uL of Lysis-Mix (0.2 M NaOH, 1% SDS) an mix carefully (Don't vortex!).
+
<li>Add 200 &mu;L of Lysis-Mix (0.2 M NaOH, 1% SDS) an mix carefully (Don't vortex!).
</li>
</li>
Line 1,836: Line 1,836:
</li>
</li>
-
<li>Add 200 uL of 5 M KAc (pH 5.4) and mix carefully (Don't vortex!) and incubate 15 min on ice.  
+
<li>Add 200 &mu;L of 5 M KAc (pH 5.4) and mix carefully (Don't vortex!) and incubate 15 min on ice.  
</li>
</li>
Line 1,842: Line 1,842:
</li>
</li>
-
<li>Add 2 uL RNase A (10 mg/mL) and incubate at 37 ºC for 30 min.
+
<li>Add 2 &mu;L RNase A (10 mg/mL) and incubate at 37 ºC for 30 min.
</li>
</li>
-
<li>Add 600 uL isopropanol and mix carefully (Don't vortex!). Incubate at room temperature for 5 min ad centrifuge (13,000 rpm, 30 s).  
+
<li>Add 600 &mu;L isopropanol and mix carefully (Don't vortex!). Incubate at room temperature for 5 min ad centrifuge (13,000 rpm, 30 s).  
</li>
</li>
Line 1,854: Line 1,854:
</li>
</li>
-
<li>Dry DNA pellet in a speed-vacuum (not longer than 3 min!) and resuspend in 50 uL TE-buffer.  
+
<li>Dry DNA pellet in a speed-vacuum (not longer than 3 min!) and resuspend in 50 &mu;L TE-buffer.  
</li>
</li>
Line 1,872: Line 1,872:
</td></tr>
</td></tr>
-
<tr><td>S. cerevisiae</td><td>72.2 ng/uL
+
<tr><td>S. cerevisiae</td><td>72.2 ng/&mu;L
</td></tr>
</td></tr>
-
<tr><td>C. tropicalis</td><td>1397.1 ng/uL
+
<tr><td>C. tropicalis</td><td>1397.1 ng/&mu;L
</td></tr>
</td></tr>
Line 1,928: Line 1,928:
-
<ul><li>P35S:EaDAcT:T35S in 2omega2 (tubes 1, 2, 3)
+
<ul><li>P35S:EaDAcT:T35S in 2&Omega;2 (tubes 1, 2, 3)
</li>
</li>
Line 2,006: Line 2,006:
</li>
</li>
-
<ul><li>2 uL NotI
+
<ul><li>2 &mu;L NotI
</li>
</li>
-
<li>10 uL Orange buffer
+
<li>10 &mu;L Orange buffer
</li>
</li>
-
<li>84 uL H20
+
<li>84 &mu;L H20
</li>
</li>
Line 2,018: Line 2,018:
</li>
</li>
-
<ul><li>2 uL NcoI
+
<ul><li>2 &mu;L NcoI
</li>
</li>
-
<li>10 uL Tango buffer
+
<li>10 &mu;L Tango buffer
</li>
</li>
-
<li>84 uL H20
+
<li>84 &mu;L H20
</li>
</li>
Line 2,030: Line 2,030:
</li>
</li>
-
<ul><li>2 uL BglII
+
<ul><li>2 &mu;L BglII
</li>
</li>
-
<li>10 uL Orange buffer
+
<li>10 &mu;L Orange buffer
</li>
</li>
-
<li>84 uL H20
+
<li>84 &mu;L H20
</li>
</li>
Line 2,042: Line 2,042:
</li>
</li>
-
<ul><li>1.5 uL EcoRV
+
<ul><li>1.5 &mu;L EcoRV
</li>
</li>
-
<li>7.5 uL Red buffer
+
<li>7.5 &mu;L Red buffer
</li>
</li>
-
<li>63 uL H20
+
<li>63 &mu;L H20
</li>
</li>
Line 2,084: Line 2,084:
<table style="width:300px">
<table style="width:300px">
-
<tr><td>Reaction</td><td>Reagent</td><td>Volume (uL)
+
<tr><td>Reaction</td><td>Reagent</td><td>Volume (&mu;L)
</td></tr>
</td></tr>
Line 2,177: Line 2,177:
</td></tr>
</td></tr>
-
<tr><td>Trichome promoter</td><td>1 uL
+
<tr><td>Trichome promoter</td><td>1 &mu;L
</td></tr>
</td></tr>
-
<tr><td>GFP</td><td>1 uL
+
<tr><td>GFP</td><td>1 &mu;L
</td></tr>
</td></tr>
-
<tr><td>TNos</td><td>1 uL
+
<tr><td>TNos</td><td>1 &mu;L
</td></tr>
</td></tr>
-
<tr><td>BsaI</td><td>1 uL
+
<tr><td>BsaI</td><td>1 &mu;L
</td></tr>
</td></tr>
-
<tr><td>p2alpha2</td><td>1 uL
+
<tr><td>p2&alpha;2</td><td>1 &mu;L
</td></tr>
</td></tr>
-
<tr><td>T4 ligase</td><td>1 uL
+
<tr><td>T4 ligase</td><td>1 &mu;L
</td></tr>
</td></tr>
-
<tr><td>Ligase buffer</td><td>1 uL
+
<tr><td>Ligase buffer</td><td>1 &mu;L
</td></tr>
</td></tr>
-
<tr><td>H2O</td><td>3 uL
+
<tr><td>H2O</td><td>3 &mu;L
</td></tr>
</td></tr>
-
<tr><td>Total Volume</td><td>10 uL
+
<tr><td>Total Volume</td><td>10 &mu;L
</td></tr>
</td></tr>
Line 2,222: Line 2,222:
</td></tr>
</td></tr>
-
<tr><td>C. tropicalis genome</td><td>2.5 uL</td><td>2.5 uL
+
<tr><td>C. tropicalis genome</td><td>2.5 &mu;L</td><td>2.5 &mu;L
</td></tr>
</td></tr>
-
<tr><td>HF Buffer</td><td>30 uL</td><td>30 uL
+
<tr><td>HF Buffer</td><td>30 &mu;L</td><td>30 &mu;L
</td></tr>
</td></tr>
-
<tr><td>dNTPs</td><td>10 uL</td><td>10 uL
+
<tr><td>dNTPs</td><td>10 &mu;L</td><td>10 &mu;L
</td></tr>
</td></tr>
-
<tr><td>Oligo R</td><td>12.5 uL</td><td>12.5 uL
+
<tr><td>Oligo R</td><td>12.5 &mu;L</td><td>12.5 &mu;L
</td></tr>
</td></tr>
-
<tr><td>Oligo F</td><td>12.5 uL</td><td>12.5 uL
+
<tr><td>Oligo F</td><td>12.5 &mu;L</td><td>12.5 &mu;L
</td></tr>
</td></tr>
-
<tr><td>Phusion polymerase</td><td>1.5 uL</td><td>1.5 uL
+
<tr><td>Phusion polymerase</td><td>1.5 &mu;L</td><td>1.5 &mu;L
</td></tr>
</td></tr>
-
<tr><td>H2O</td><td>181 uL</td><td>181 uL
+
<tr><td>H2O</td><td>181 &mu;L</td><td>181 &mu;L
</td></tr>
</td></tr>
Line 2,286: Line 2,286:
-
<p>Using an electrocompetent E. coli strain (DH5alpha) and 1.5 ul ligation (P35S:EaDAcT:T35S in 2omega2), the mix is electroporated at 1500 V. Then, 300 uL of SOC are added and stored at 37 ºC with agitation.  
+
<p>Using an electrocompetent E. coli strain (DH5&alpha;) and 1.5 ul ligation (P35S:EaDAcT:T35S in 2&Omega;2), the mix is electroporated at 1500 V. Then, 300 &mu;L of SOC are added and stored at 37 ºC with agitation.  
</p>
</p>
Line 2,307: Line 2,307:
-
<p>Adquisition of S. cerevisiae genomic DNA. (5 uL, stored in the fridge)
+
<p>Adquisition of S. cerevisiae genomic DNA. (5 &mu;L, stored in the fridge)
</p>
</p>
Line 2,335: Line 2,335:
</td></tr>
</td></tr>
-
<tr><td>Template</td><td>0.5 uL</td><td>0.5 uL
+
<tr><td>Template</td><td>0.5 &mu;L</td><td>0.5 &mu;L
</td></tr>
</td></tr>
-
<tr><td>Buffer HF (5X)</td><td>10.0 uL</td><td>10.0 uL
+
<tr><td>Buffer HF (5X)</td><td>10.0 &mu;L</td><td>10.0 &mu;L
</td></tr>
</td></tr>
-
<tr><td>dNTPs</td><td>2.0 uL</td><td>2.0 uL
+
<tr><td>dNTPs</td><td>2.0 &mu;L</td><td>2.0 &mu;L
</td></tr>
</td></tr>
-
<tr><td>Oligo R (JUL06)</td><td>2.5 uL</td><td>2.5 uL
+
<tr><td>Oligo R (JUL06)</td><td>2.5 &mu;L</td><td>2.5 &mu;L
</td></tr>
</td></tr>
-
<tr><td>Oligo F (JUL05)</td><td>2.5 uL</td><td>2.5 uL
+
<tr><td>Oligo F (JUL05)</td><td>2.5 &mu;L</td><td>2.5 &mu;L
</td></tr>
</td></tr>
-
<tr><td>Phusion polymerase</td><td>0.5 uL</td><td>0.5 uL
+
<tr><td>Phusion polymerase</td><td>0.5 &mu;L</td><td>0.5 &mu;L
</td></tr>
</td></tr>
-
<tr><td>H2O</td><td>32.0 uL</td><td>32.0 uL
+
<tr><td>H2O</td><td>32.0 &mu;L</td><td>32.0 &mu;L
</td></tr>
</td></tr>
Line 2,425: Line 2,425:
</li>
</li>
-
<li>Add 600 uL of CTAB (2%) buffer (pre-heat at 65ºC.)
+
<li>Add 600 &mu;L of CTAB (2%) buffer (pre-heat at 65ºC.)
</li>
</li>
Line 2,431: Line 2,431:
</li>
</li>
-
<li>Add RNAse (1.6 uL at M = 100 ug/uL for each mL of CTAB buffer).  
+
<li>Add RNAse (1.6 &mu;L at M = 100 ug/&mu;L for each mL of CTAB buffer).  
</li>
</li>
Line 2,437: Line 2,437:
</li>
</li>
-
<li>Add 600 uL cloroform:isoamilic alcohol. Vortex it.
+
<li>Add 600 &mu;L cloroform:isoamilic alcohol. Vortex it.
</li>
</li>
Line 2,443: Line 2,443:
</li>
</li>
-
<li>Recover the supernatant by aspiration (with a 200 uL pipet).
+
<li>Recover the supernatant by aspiration (with a 200 &mu;L pipet).
</li>
</li>
Line 2,461: Line 2,461:
</li>
</li>
-
<li>Wash with 600 uL ethanol (80%).
+
<li>Wash with 600 &mu;L ethanol (80%).
</li>
</li>
Line 2,470: Line 2,470:
</li>
</li>
-
<li>Resuspend it in 50-100 uL H2O miliQ or with TE buffer.
+
<li>Resuspend it in 50-100 &mu;L H2O miliQ or with TE buffer.
</li>
</li>
Line 2,483: Line 2,483:
-
<ul><li>Tabacco 1: 182 ng/uL (Thrown away)
+
<ul><li>Tabacco 1: 182 ng/&mu;L (Thrown away)
</li>
</li>
-
<li>Tabacco 2: 620 ng/uL (Stored at -20ºC)
+
<li>Tabacco 2: 620 ng/&mu;L (Stored at -20ºC)
</li>
</li>
Line 2,533: Line 2,533:
-
<ul><li>IGEMJUL01 + 566 uL miliQ H2O
+
<ul><li>IGEMJUL01 + 566 &mu;L miliQ H2O
</li>
</li>
-
<li>IGEMJUL02 + 691 uL miliQ H2O
+
<li>IGEMJUL02 + 691 &mu;L miliQ H2O
</li>
</li>
Line 2,551: Line 2,551:
-
<ul><li>0.5 uL template
+
<ul><li>0.5 &mu;L template
</li>
</li>
-
<li>10 uL buffer HF 5x
+
<li>10 &mu;L buffer HF 5x
</li>
</li>
-
<li>2 uL dNTPs
+
<li>2 &mu;L dNTPs
</li>
</li>
-
<li>2.5 uL oligo R
+
<li>2.5 &mu;L oligo R
</li>
</li>
-
<li>2.5 uL oligo F
+
<li>2.5 &mu;L oligo F
</li>
</li>
-
<li>0.5 uL Pfu
+
<li>0.5 &mu;L Pfu
</li>
</li>
-
<li>32 uL miliQ H2O
+
<li>32 &mu;L miliQ H2O
</li>
</li>
</ul>
</ul>
-
<p>Final volume: 50 uL
+
<p>Final volume: 50 &mu;L
</p>
</p>
Line 2,628: Line 2,628:
</td></tr>
</td></tr>
-
<tr><td>Template</td><td>0.5 uL</td><td>0.5 uL</td><td>0.5 uL</td><td>0.5 uL</td><td>0.5 uL
+
<tr><td>Template</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td><td>0.5 &mu;L
</td></tr>
</td></tr>
-
<tr><td>Buffer (5x)</td><td>0.5 uL</td><td>0.5 uL</td><td>0.5 uL</td><td>0.5 uL</td><td>0.5 uL
+
<tr><td>Buffer (5x)</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td><td>0.5 &mu;L
</td></tr>
</td></tr>
-
<tr><td>dNTPs</td><td>2 uL</td><td>2 uL</td><td>2 uL</td><td>2 uL</td><td>2 uL
+
<tr><td>dNTPs</td><td>2 &mu;L</td><td>2 &mu;L</td><td>2 &mu;L</td><td>2 &mu;L</td><td>2 &mu;L
</td></tr>
</td></tr>
-
<tr><td>Oligo R</td><td>2.5 uL</td><td>2.5 uL</td><td>2.5 uL</td><td>2.5 uL</td><td>2.5 uL
+
<tr><td>Oligo R</td><td>2.5 &mu;L</td><td>2.5 &mu;L</td><td>2.5 &mu;L</td><td>2.5 &mu;L</td><td>2.5 &mu;L
</td></tr>
</td></tr>
-
<tr><td>Oligo F</td><td>2.5 uL</td><td>2.5 uL</td><td>2.5 uL</td><td>2.5 uL</td><td>2.5 uL
+
<tr><td>Oligo F</td><td>2.5 &mu;L</td><td>2.5 &mu;L</td><td>2.5 &mu;L</td><td>2.5 &mu;L</td><td>2.5 &mu;L
</td></tr>
</td></tr>
-
<tr><td>Phu</td><td>0.5</td><td>0.5 uL</td><td>0.5 uL</td><td>0.5 uL</td><td>0.5 uL
+
<tr><td>Phu</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td><td>0.5 &mu;L
</td></tr>
</td></tr>
-
<tr><td>Buffer</td><td>32 uL</td><td>32 uL</td><td>32 uL</td><td>32 uL</td><td>32 uL
+
<tr><td>Buffer</td><td>32 &mu;L</td><td>32 &mu;L</td><td>32 &mu;L</td><td>32 &mu;L</td><td>32 &mu;L
</td></tr>
</td></tr>
Line 2,703: Line 2,703:
</td></tr>
</td></tr>
-
<tr><td>Template</td><td>2 uL</td><td>2 uL
+
<tr><td>Template</td><td>2 &mu;L</td><td>2 &mu;L
</td></tr>
</td></tr>
-
<tr><td>Buffer (5x)</td><td>40 uL</td><td>40 uL
+
<tr><td>Buffer (5x)</td><td>40 &mu;L</td><td>40 &mu;L
</td></tr>
</td></tr>
-
<tr><td>dNTPs</td><td>8 uL</td><td>8 uL
+
<tr><td>dNTPs</td><td>8 &mu;L</td><td>8 &mu;L
</td></tr>
</td></tr>
-
<tr><td>Oligo R</td><td>10 uL</td><td>10 uL
+
<tr><td>Oligo R</td><td>10 &mu;L</td><td>10 &mu;L
</td></tr>
</td></tr>
-
<tr><td>Oligo F</td><td>10 uL</td><td>10 uL
+
<tr><td>Oligo F</td><td>10 &mu;L</td><td>10 &mu;L
</td></tr>
</td></tr>
-
<tr><td>Phu</td><td>2</td><td>2 uL uL
+
<tr><td>Phu</td><td>2</td><td>2 &mu;L &mu;L
</td></tr>
</td></tr>
-
<tr><td>Buffer</td><td>128 uL</td><td>128 uL
+
<tr><td>Buffer</td><td>128 &mu;L</td><td>128 &mu;L
</td></tr>
</td></tr>
Line 2,826: Line 2,826:
-
<ul><li>12.5 uL Q5 Master mix (2x).
+
<ul><li>12.5 &mu;L Q5 Master mix (2x).
</li>
</li>
-
<li>1.25 uL forward primer 10 uM
+
<li>1.25 &mu;L forward primer 10 uM
</li>
</li>
-
<li>1.25 uL reverse primer 10 uM
+
<li>1.25 &mu;L reverse primer 10 uM
</li>
</li>
-
<li>0.5 uL template 620 ng/uL
+
<li>0.5 &mu;L template 620 ng/&mu;L
</li>
</li>
-
<li>9.5 uL H2O
+
<li>9.5 &mu;L H2O
</li>
</li>
Line 2,887: Line 2,887:
-
<ul><li>1 uL pUPD
+
<ul><li>1 &mu;L pUPD
</li>
</li>
-
<li>1 uL PCR product
+
<li>1 &mu;L PCR product
</li>
</li>
-
<li>1 uL BsmBI (5-10 ud)
+
<li>1 &mu;L BsmBI (5-10 ud)
</li>
</li>
-
<li>1 uL T4 ligase (5-10 ud)
+
<li>1 &mu;L T4 ligase (5-10 ud)
</li>
</li>
-
<li>1.2 uL buffer ligase (3 ud)
+
<li>1.2 &mu;L buffer ligase (3 ud)
</li>
</li>
-
<li>6.8 uL H20
+
<li>6.8 &mu;L H20
</li>
</li>
Line 3,008: Line 3,008:
<table style="width:300px">
<table style="width:300px">
-
<tr><td>Piece</td><td>Concentration (ng/uL)</td><td>Initial Volume (uL)</td><td>Final Volume (uL)
+
<tr><td>Piece</td><td>Concentration (ng/&mu;L)</td><td>Initial Volume (&mu;L)</td><td>Final Volume (&mu;L)
</td></tr>
</td></tr>
Line 3,031: Line 3,031:
</td></tr>
</td></tr>
-
<tr><td>Trichome promoter</td><td>1 uL
+
<tr><td>Trichome promoter</td><td>1 &mu;L
</td></tr>
</td></tr>
-
<tr><td>GFP</td><td>1 uL
+
<tr><td>GFP</td><td>1 &mu;L
</td></tr>
</td></tr>
-
<tr><td>TNos</td><td>1 uL
+
<tr><td>TNos</td><td>1 &mu;L
</td></tr>
</td></tr>
-
<tr><td>BsaI</td><td>1 uL
+
<tr><td>BsaI</td><td>1 &mu;L
</td></tr>
</td></tr>
-
<tr><td>p2alpha2</td><td>1 uL
+
<tr><td>p2&alpha;2</td><td>1 &mu;L
</td></tr>
</td></tr>
-
<tr><td>T4 ligase</td><td>1 uL
+
<tr><td>T4 ligase</td><td>1 &mu;L
</td></tr>
</td></tr>
-
<tr><td>Ligase buffer</td><td>1 uL
+
<tr><td>Ligase buffer</td><td>1 &mu;L
</td></tr>
</td></tr>
-
<tr><td>H2O</td><td>3 uL
+
<tr><td>H2O</td><td>3 &mu;L
</td></tr>
</td></tr>
-
<tr><td>Total Volume</td><td>10 uL
+
<tr><td>Total Volume</td><td>10 &mu;L
</td></tr>
</td></tr>
Line 3,071: Line 3,071:
-
<p>Using an electrocompetent E. coli strain (DH5alpha) and 1.5 ul ligation (PTrich:GFP:TNos in 2alpha2), the mix is electroporated at 1500 V. Then, 300 uL of SOC are added and stored at 37 ºC with agitation.  
+
<p>Using an electrocompetent E. coli strain (DH5&alpha;) and 1.5 ul ligation (PTrich:GFP:TNos in 2&alpha;2), the mix is electroporated at 1500 V. Then, 300 &mu;L of SOC are added and stored at 37 ºC with agitation.  
</p>
</p>

Revision as of 16:54, 1 August 2014

igem_logo



Biosynthesis


06/09/2014

The enzymes involved in the biosynthesis pathways are AtrΔ11, HarFAR, FAO, EaDAcT.

  • Codon optimization
  • Inner restriction sites eliminations by finding synonymous mutations
  • Addition of GB endings

06/10/2014

Codes for IDT known. MEGAGEM2014 - 25% off one order, up to $800

GBlocks designed to be compatible with biobricks and GoldenBraid (GB).


06/11/2014

We ordered the following gBlocks and primers.

  • EaDAcT: Eunymus alatus (adapted for GB) 1127 bp
  • HarFAR: Helicoverpa armigera (adapted for GB) 1400 bp
  • AtrΔ11: Amyelois transitella (order primers for GB) 1000 bp
    • I14Jun03 AtrΔ11 F1
    • I14Jun04 AtrΔ11 R1
  • FAO1: N.benthamiana primers
    • I14Jun01 FAO1 F1
    • I14Jun02 FAO1 R1
NameSequenceLenghtTm (NTI)Tm (Phusion)
I14Jun01_FAO1_F1cgccgtctcgctcgaatggagaaaaagagccatcc3549.962.4
I14Jun02_FAO1_R1cgccgtctcgctcgaagcttatcttgagaatttgccttcttttatc4654.563.7
I14Jun03Atr_D11_F1gcgccgtctcgctcgaatggttcctaataag3154.565.3
I14Jun04Atr_D11_R1gcgccgtctcgctcgaagctcaacgtttc295769.1

06/24/2014

We thought which parts of the GB collection could we use.

Strategy 1:

  • pP35S, pT35s (x2)
  • pAtUbq10, pTAtHSP18.2

Strategy 2:

  • pP35S, pT35s
  • pP35s, pTAtHSP18.2
  • pAtUbq10, pTAtHSP18.2

Strategy 3:

  • pP35S, pT35s
  • pP35s, pTTctp
  • pAtUbq10, pTAtHSP18.2

Pieces to take from GB2.0 colection:

pDGB2α1GB0483Kan
pDGB2α2GB0484Kan
pP35sGB0030Amp
pT35sGB0036Amp
pAtUbq10GB0223Amp
pTAtHSP18.2GB0035Amp
pTTctpGB0081Amp
pUPDGB0317Amp

Later we will need:

pDGB2Ω1GB0487Smp
pDGB2Ω2GB0488Smp

Prepare plaques with antibiotics Kan, Spm, Amp


06/25/2014

Grow the selected pieces from the GB collection in liquid medium (performed in laminar air flow cabinet).


06/26/2014

Culture in agar Petri dish. 2 plaques: Amp and Kan.

Minipreps with EZNA Plasmid DNA MiniKit I.

Expected digestions:

pP35s GB0030NotIBuffer: Orange2981, 1105
pT35s GB0036NotIBuffer: Orange2981, 304
pAtUbq10 GB0223NotIBuffer: Orange2981, 714
pTAtHSP18.2 GB0035NotIBuffer: Orange2981, 328
pTTctp GB0081NotIBuffer: Orange2981, 487

Electrophoresis analysis.

We got the expected bands in all cases.


01/07/2014

AtrΔ11 amplification by PCR with primers that contain extra nucleotides to introduce them in the sequence.

We made a PCR amplification using the AtrΔ11 gene as a template and the oligos: R +F

Reagents needed:

  • 32.5 μL of H2O miliQ
  • 10 μL HF buffer
  • 2 μL dNTPs
  • 2.5 μL Reverse primer
  • 2.5 μL Forward primer
  • 1 μL template (AtrΔ11 gene)
  • 0.5 μL phusion (polimerase)

PCR parameters: The annealing temperature was 60ºC and the extension temperature was 65ºC.

Electrophoresis performed to check the PCR product, which was expected to be around 1 kb.

pUPD ligation of EaDAcT, HarFar and AtrΔ11

Reagents needed for the reaction of ligation:

  • 1 μL pUPD
  • 1 μL PCR product/gblock product
  • 1.2 μL buffer 10x
  • 1 μL BsmBI
  • 1 μL T4 ligase
  • 6.8 μL H2O miliQ

Vfinal= 12 μL

Termocycler parameters: The ligase temperature was 16ºC and the BsmBI temperature was 37ºC.

As a result, there are obtained three different pUPD plasmids containing the genes EaDAcT, HarFAR and AtrΔ11.


07/02/2014

E. coli transformation

This step is performed in a laminar air flow cabinet (LAF).

We have used an electrocompetent E. coli strain (DH5α) and a sample from each product of ligation made in the previous step (three pUPD plasmids, each of them containing one of the three genes), so transformation is made three times.

Reagents needed:

  • E. coli aliquot
  • 1.5 μL of ligation in pUPD (for each gene: EaDAcT, HarFAR, AtrΔ11)

Each mix is introduced in a electroporation vial and electroporated at 1500 V, then 300 μL of SOC are added to each vial. All of them were incubated at 37ºC for 1 hour.

After incubation, culture in Petri plates (always in a LAF).

2 cell-culture dishes per transformation (with Ampicillin), one with 50 μL and the other with the remaining volume.

Petri plates are incubated at 37ºC for 16 h.


07/03/2014

Transformed colonies selection. The white ones are recultured in liquid medium. One colony of each transformation is picked and cultured in 3.5 mL LB and 7 μL Amp. This step is repeated three times:

  • 3x 1 colony of EaDAcT in pUPD + LB + Amp
  • 3x 1 colony of HarFAR in pUPD + LB + Amp
  • 3x 1 colony of AtrΔ11 in pUPD + LB + Amp

All tubes are incubated at 37ºC overnight in agitation.


07/04/2014

Digestions in silico using Vector NTI to check after minipreps if ligations are correct.

EaDAcTNotI2981, 1167
RsaI1876, 1343, 532, 306, 91
HarFARNotI2981, 1440
PvuII2564, 1394, 463
AtrΔ11NotI2981, 1056
BanII2570, 803, 351, 314

Digestion reagents:

  • 0.5 μL restriction enzyme
  • 2.5 μL buffer
  • 21 μL H20 (miliQ)
  • 1 μL sample

Preparation of master mixes

  • Master mix for NotI
    • 5 μL NotI
    • 25 μL Orange
    • 210 μL H20
  • Master mix for RsaI
    • 1.5 μL RsaI
    • 7.5 μL Tango
    • 63 μL H20
  • Master mix for PvuII
    • 1.5 μL PvuII
    • 7.5 μL Green
    • 63 μL H20
  • Master mix for BanII
    • 1.5 μL BanII
    • 7.5 μL Tango
    • 63 μL H20

Perform electrophoresis to check if the size of the fragments from the digestions is correct.

Comments:

  • We picked blue colonies instead of white by mistake. We need to pick colonies again but this time make sure we pick white colonies.
  • For the repetition we must find another enzyme instead of BanII as we found out that it doesn't cut very well.

07/06/2014

We picked again 3 colonies for each construction, and we made sure that we picked the WHITE ones. We cultivated them in a "double check" (name invented by us) liquid medium. Those tubes contain:

  • 3.5 mL LB
  • 7 μL Amp
  • 7 μL X-Gal
  • 3.5 μL IPTG (turns the tube blue if the colonies picked were blue)

07/07/2014

We made minipreps of yesterday's culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes HarFAR 1, 2, 3; EaDAcT 3 and AtrΔ11 2, 3.

Once we had the minipreps, we perform the digestions to check which were correct and send them to sequencing. This time we selected RsaI instead of BanII. The in silico digestions were as follows.

EaDAcTNotI2981, 1167
RsaI1876, 1343, 532, 306, 91
HarFARNotI2981, 1440
PvuII2564, 1394, 463
AtrΔ11NotI2981, 1056
RsaI1879, 1310, 467, 327, 54

Preparation of master mixes

  • Master mix for NotI
    • 3.5 μL NotI
    • 17.5 μL Orange
    • 147 μL H20
  • Master mix for RsaI
    • 2 μL RsaI
    • 10 μL Tango
    • 84 μL H20
  • Master mix for PvuII
    • 2 μL PvuII
    • 10 μL Green
    • 84 μL H20

We run the electrophoresis gel to check if this time we have done it correctly.

Everything was OK. We sent AtrΔ11 (3), HarFAR (3) and EaDAcT (3) to sequence.


07/08/2014

Now, while we wait for sequencing results, we go on as they were going to be correct in order to save time.

The next step is to build a transciptional unit (TU) with our sequences. A transcriptional unit is a structure composed by promoter, coding sequence (CDS) and terminator in an α or Ω vector.

Reagents needed for ligation:

  • 1 μL promoter 75 ng/μL
  • 1 μL terminator 75 ng/μL
  • 1 μL CDS 75 ng/μL
  • 1 μL vector α
  • 1.2 μL ligase buffer 10x
  • 1 μL T4
  • 1 μL BsaI
  • 4.2 μL H20

Total: 12 μL

Take into account that if we want to make binary constructions later (merge 2 TU in a same vector), we need to clone each TU in a different α vector.

Strategy Promoter-Terminator:

AtrΔ11P35sT35s40.41
HarFARP35sTatHSP39.68
EaDAcTPAtUbqTatHSP32.27

Adjust concentrations to 75 ng/μL for ligation reaction

Initial concentrations (nanodrop):

PieceConcentrationsVolumeVolume of H20 to add
PAtUpb442.6 ng/μL34 μL166.6 μL
pTatHSP235.4 ng/μL36 μL77 μL
T35s194.9 ng/μL37.5 μL60 μL
P35s454.7 ng/μL36 μL182 μL
2α157.1 ng/μL-We will need to put 1.5 μL of this one
2α2104.0 ng/μL38 μL14.7 μL
AtrΔ11359.3 ng/μL20 μL75.8 μL
HarFAR404.4 ng/μL15 μL65.9 μL
EaDAcT155.6 ng/μL10 μL10.7 μL

Ligation reaction

  • P35s:AtrΔ11:T35s in 2α1
    • 1 μL P35s
    • 1 μL T35s
    • 1 μL AtrΔ11
    • 1.5 μL 2α1
    • 1.2 μL ligase buffer 10x
    • 1 μL T4
    • 1 μL BsaI
    • 3.7 μL H20
  • P35s:HarFAR:TatHSP in 2α2
    • 1 μL P35s
    • 1 μL TatHSP
    • 1 μL HarFAR
    • 1 μL 2α2
    • 1.2 μL ligase buffer 10x
    • 1 μL T4
    • 1 μL BsaI
    • 4.2 μL H20
  • PAtUbq:EaDAcT:TatHSP in 2α2
    • 1 μL PAtUbq
    • 1 μL TatHSP
    • 1 μL EaDAcT
    • 1 μL 2α2
    • 1.2 μL ligase buffer 10x
    • 1 μL T4
    • 1 μL BsaI
    • 4.2 μL H20

07/09/2014

Transformation of constructions in E. coli

We finally got the sequencing results from 07/07/2014.

  • Mutation in AtrΔ11 -> We threw away the colonies and transformed cells. We picked again white colonies.
  • HarFAR -> Sequencing correct
  • EaDAcT -> Synonim mutation in 601 (A -> T). This is a gBlock!

We took vectors 2Ω1 (GB0487) and 2Ω2 (GB0488) parts from the GB colection.

  • Worked in the LAF
  • Cultivated in a Petri dish with Spm
  • Let them grow for one day

Cultivate transformated cells in two Kan plaques (Kan matches vector α)

  • 50 mL transformation in one plaque
  • Rest of the culture in another (250 μL aprox)
  • Let them grow for one day

07/10/2014

Pick colonies and grow them in liquid medium.

  • 6 from AtrΔ11 (repetition because of mutation)
    • 3.5 mL LB
    • 7 μL Amp
    • 7 μL X-gal
    • 3.5 μL IPTG
  • 1 colony from 2Ω1
    • 3.5 mL LB
    • 7 μL Spm
  • 1 colony from 2Ω2
    • 3.5 mL LB
    • 7 μL Spm
  • 3 colonies from P35s:HarFAR:TatHSP
    • 3.5 mL LB
    • 7 μL Kan
  • 3 colonies from PAtUbq:EaDAcT:TatHSP
    • 3.5 mL LB
    • 7 μL Kan

Grow at 37ºC in agitation overnight.

We have checked the promoters and terminators are both compatible with GB and BioBricks.

Only P35s and T35s work for both. pPnos could also work.

Pick 3 colonies of P35s:HarFAR:THsp and PAtUbq:EaDAcT:THsp. Culture in liquid medium with Kan.


07/11/2014

We made minipreps of yesterday's liquid culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes AtrΔ11 3 and 6; 2Ω1; 2Ω2; constructions P35s:HarFAR:TatHSP 1, 2, 3 and PAtUbq:EaDAcT:TatHSP 1, 2, 3.

Additionally, we have cultured each of the colonies named above to store them.


07/14/2014

We tested the minipreps made last friday by digestion. Once they were checked, we send the correct ones to sequencing. The in silico digestions were as follows.

PartsRetriction enzymeExpected Bands
PAtUbq:EaDAcT:TatHSP in 2α2HindIII6322, 1722, 736, 221
P35s:HarFAR:TatHSP in 2 α2HindIII6322, 1794, 221
AtrΔ11NotI2961, 1056
2Ω1BamHI6652, 382, 239
2Ω2EcoRV6652, 621

Preparation of master mixes

  • Master mix for HindIII
    • 3.5 μL HindIII
    • 17.5 μL Red
    • 147 μL H20
  • Master mix for NotI
    • 1.5 μL NotI
    • 7.5 μL Orange
    • 63 μL H20
  • Mix for EcoRV
    • 0.5 μL EcoRV
    • 2.5 μL Red
    • 21 μL H20
  • Mix for BamHI
    • 0.5 μL PvuII
    • 2.5 μL Green
    • 21 μL H20

We run the electrophoresis gel to check if this time we have done it correctly.

Everything was OK except the AtrΔ11 (3), which had some partial digestion. It was the reason we sent AtrΔ11 (6) to sequence.


07/15/2014

We got the sequencing results from yesterday and everything was OK, so we made the transcriptional units ligation.

Reagents needed for the reaction of ligation (Total volume = 12 μL):

  • P35s:AtrΔ11:T35s in 2α1
    • 1 μL P35s
    • 1 μL T35s
    • 1 μL AtrΔ11
    • 1.5 μL 2α1
    • 1.2 μL ligase buffer 10x
    • 1 μL T4
    • 1 μL BsaI
    • 3.7 μL H20
  • P35s:HarFAR:T35s in 2α2
    • 1 μL P35s
    • 1 μL T35s
    • 1 μL HarFAR
    • 1 μL 2α2
    • 1.2 μL ligase buffer 10x
    • 1 μL T4
    • 1 μL BsaI
    • 4.2 μL H20
  • P35s:EaDAcT:T35s in 2α2
    • 1 μL P35s
    • 1 μL T35s
    • 1 μL EaDAcT
    • 1 μL 2α2
    • 1.2 μL ligase buffer 10x
    • 1 μL T4
    • 1 μL BsaI
    • 4.2 μL H20

Note: Concentrations were previously adjusted to 75 ng/μL. Only the AtrΔ11 was adjusted from 250.2 ng/μL.

Finally, we prepared liquid cultures in order to store in glicerol. The tubes we used and their respective antibiotics were:

  • Amp
    • pAtrΔ11 (6)
    • pEaDAcT (3)
    • pHarFAR (3)
  • Kan
    • P35:HarFAR:TatHSP in 2α2 (3)
    • PPAtUbq:EaDAcT:TatHSP in 2apha2 (3)

07/16/2014

Storage in glycerol of the HarFAR (GB1018), AtrΔ11 (GB1019), EaDAcT (GB1020), P35s:HarFAR:TatHSP in 2α2 (GB1021) and PAtUbq:EaDAcT:TatHSP in 2α2 (GB1022). We made 3 tubes: one for us, one for the GB collenction and one for reserve.

The procedure is to mix 700 μL of culture with 300 μL of glycerol 50%, spin it and store it in the -80ºC.


07/17/2014

Pick 3 colonies of P35s:AtrΔ11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Culture in liquid medium with Kan.

Digestions in silico.

Transcriptional unitsRestriction enzymesExpected bands
P35s:AtrΔ11:T35sEcoRI6323, 2269
NcoI390, 8202
P35s:HarFAR:T35sHindIII933, 6322, 1722
NcoI8587, 390
P35s:EaDAcT:T35sHindIII6322, 2366
EcoRV683, 8021

Preparation of reagents needed for genomic extraction of Candida tropicalis for FAO1.


07/18/2014

Mistake in P35s:AtrΔ11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s minipreps. Repeat tomorrow.


07/19/2014

Minipreps of P35s:AtrΔ11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Concentration measuments with nanodrop.

Transcriptional unit DNA concentration (ng/μL)
P35s:AtrΔ11:T35s (1)164 ng/μL
P35s:AtrΔ11:T35s (2)168 ng/μL
P35s:AtrΔ11:T35s (3)147.4 ng/μL
P35s:HarFAR:T35s (1)125.3 ng/μL
P35s:HarFAR:T35s (2)114.5 ng/μL
P35s:HarFAR:T35s (3)140.3 ng/μL
P35s:EaDAcT:T35s (1)144.2 ng/μL
P35s:EaDAcT:T35s (2)137.9 ng/μL
P35s:EaDAcT:T35s (3)128.5 ng/μL
Stuffer fragment135.5 ng/μL
2Ω1196.8 ng/μL
2Ω2175.4 ng/μL

Digestions of P35s:AtrΔ11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s and gel electrophoresis to check if transciptional units have been assembled OK.

All digestions were correct except P35s:EaDAcT:T35s (2).

Ligation in Ω vectors.

  • P35s:AtrΔ11:T35s + P35s:HarFAR:T35s in 2Ω1
    • 1 μL P35s:AtrΔ11:T35s (75 ng/μL)
    • 1 μL P35s:HarFAR:T35s (75 ng/μL)
    • 1 μL 2Ω1 (75 ng/μL)
    • 1 μL BsmBI (5-10 ud)
    • 1 μL T4 ligase (5-10 ud)
    • 1 μL buffer ligase (3 ud)
    • 4 μL H20
  • P35s:EaDAcT:T35s in 2Ω2
    • 1 μL stuffer fragment (75 ng/μL)
    • 1 μL P35s:EaDAcT:T35s (75 ng/μL)
    • 1 μL 2Ω2 (75 ng/μL)
    • 1 μL BsmBI (5-10 ud)
    • 1 μL T4 ligase (5-10 ud)
    • 1 μL buffer ligase (3 ud)
    • 4 μL H20

Set the reaction: 25 cycles x (37ºC 2 min, 16ºC 5 min).

Omega vectors include a resistance to spectinomycin.


07/20/2014

Transform and grow in Petri dishes yesterday's ligations: P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω1 and P35S:EaDAcT:T35S in 2Ω2.


07/21/2014

Pick colonies of P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω1 (3) and P35S:EaDAcT:T35S in 2Ω2 (2).


07/22/2014

We made minipreps of yesterday's liquid culture. Selected tubes:

  • P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω1(Tubes 1, 2 and 3)
  • P35S:EaDAcT:T35S in 2Ω2 (Tubes 1 and 2)

Additionally, we have cultured each of the colonies named above in order to store them.

Digestions in silico made to check the transcriptional units:

Transcriptional unitsRestriction enzymeExpected bands
P35S:AtrΔ11:T35S+P35S:HarFAR:T35S in 2Ω1EcoRV9307, 2251
BamHI6652, 4906
P35S:EaDAcT:T35S in 2Ω2EcoRV6652, 1044, 817, 683
NcoI8806, 390

Digestion master mixes:

  • Master mix for NotI
    • 1.5 μL NotI
    • 7.5 μL Orange buffer
    • 63 μL H20
  • Master mix for NcoI
    • 1.5 μL NcoI
    • 7.5 μL Tango buffer
    • 63 μL H20
  • Master mix for BamHI
    • 2 μL BamHI
    • 10 μL Green buffer
    • 84 μL H20
  • Master mix for EcoRV
    • 4 μL EcoRV
    • 20 μL Red buffer
    • 168 μL H20

Note: Trichome promoter digestion preparation included.

All digestions were correct except the transcriptional unit of EaDAcT in 2Ω2 (P35s:EaDAcT:T35S).

Miniprep quantification:

PieceTubeConcentration (ng/μL)Volume (μL)
Trichome promoter in pUPD1317.126
Trichome promoter in pUPD3354.832
P35S:EaDAcT:T35S in 2Ω21350.733
P35S:EaDAcT:T35S in 2Ω22271.133
P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω11306.331
P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω12296.628
P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω13246.033

All of the pieces named above were adjusted at 75 ng/μL.

Piece Tube numberFinal Volume (μL)Volume to be added (μL)
Trichome promoter in pUPD1109.9383.93
Trichome promoter in pUPD3151.40119.4
P35S:EaDAcT:T35S in 2Ω21154.30121.3
P35S:EaDAcT:T35S in 2Ω22119.3086.30
P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω11126.6095.60
P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω12110.7082.70
P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω13108.2475.20

As the digestions of the transcriptional unit (TU) of EaDAcT were incorrect, we repeated the process from the ligation step.

We transformed the same TU in a E. coli competent strain (DH5α). Then, the transformants were cultured in LB media and Spm and stored at 37ºC overnight.

Pieces taken from the GoldenBraid 2.0 collection were cultured in solid growth media:

With Amp:

  • pTNos (GB0037)
  • pGFP (GB0059)
  • pLuciferase (GB0096)

With Kan:

  • P35S:Rosea:TNos
  • TA29:Barnase:TNos (GoldenBraid 1.0 piece)

Finally, in order to obtain the FAO1 gene, we want to extract the Candida tropicalis genome, so we have picked a colony of C. tropicalis. To check the extraction protocol, we used a yeast previously tested, Saccharomyces cerevisiae. We have cultured C. tropicalis in YPD media and S. cerevisiae in YPDA media at 28 ºC (5 mL).


07/23/2014

Candida genome extraction

Saccharomyces cerevisiae is used as a control in order to see if we followed the protocol correctly. We aren't really sure if this protocol is going to work in Candida.

Cultures measured at 600 nm:

  • S. cerevisiae Abs = 1.07
  • C. tropicalis Abs = 0.39

S. cerevisiae is recultured with new media (1:2) because the previous media was saturated. 2.25 mL of YPD media were mixed with 2.25 mL of S. cerevisiae culture. The mix has to grow at 28 ºC until the exponential phase is reached.

The absorbance was measured again:

  • S. cerevisiae Abs = 0.52
  • C. tropicalis Abs = 0.40

Buffers needed for the genome extraction were prepared freshly.The genome of both strains of yeast were extracted following the protocol:

  • Grow yeast in 2 or 5 mL YPD to exponential phase.
  • Collect cells in 1.5 mL eppendorf-cup (centrifugation 20 s, 6000 rpm).
  • Wash once with 1 mL sterile water.
  • Resuspend cells in 200 μL protoplast-buffer (100 mM Tris-HCl, pH 7.5, 10 mM EDTA, 1000 units Zymolyase/mL, 10 μL beta-mercaptoethanol/mL; prepare freshly!). Incubate at 37ºC for 1-2 h and finally resuspend by turning the cups.
  • Add 200 μL of Lysis-Mix (0.2 M NaOH, 1% SDS) an mix carefully (Don't vortex!).
  • Incubate at 65 ºC for 20 min and cool inmediately on ice.
  • Add 200 μL of 5 M KAc (pH 5.4) and mix carefully (Don't vortex!) and incubate 15 min on ice.
  • Centrifuge (13,000 rpm, 3 min) and transfer supernatant in a fresh cup.
  • Add 2 μL RNase A (10 mg/mL) and incubate at 37 ºC for 30 min.
  • Add 600 μL isopropanol and mix carefully (Don't vortex!). Incubate at room temperature for 5 min ad centrifuge (13,000 rpm, 30 s).
  • Remove the supernatant and wash with 70% ethanol (10 min at room temperature).
  • Centrifuge (13,000 rpm, 30 s) and remove the supernatant.
  • Dry DNA pellet in a speed-vacuum (not longer than 3 min!) and resuspend in 50 μL TE-buffer.
  • Store chromosomal DNA at 4 ºC (Don't freeze!). Concentration and quality can be checked in an agarose gel (loading 1/10 of the volume).

Genomic quantification:

OrganismConcentration
S. cerevisiae72.2 ng/μL
C. tropicalis1397.1 ng/μL

Electrophoresis made to check the extraction quality was correct.

We did not observe genomic from Candida because we used a very diluted sample. We will repeat the gel tomorrow.

EaDAcT and collection pieces made yesterday were recultured in liquid media.


07/24/2014

The genomic quality of both organisms (C. tropicalis and S. cerevisiae) was checked in an agarose gel again.

We got the Candida genome band, however, the Saccharomyces genome band was not present.

Additionally, minipreps of the liquid culture made yesterday were made and also recultured in solid agar plate.

  • P35S:EaDAcT:T35S in 2Ω2 (tubes 1, 2, 3)
  • Collection pieces:
    • pTNos (GB0037)
    • pGFP (GB0059)
    • pLuciferase (GB0096)
    • P35:Rosea:TNos
    • TA29:Barnase:TNos

Miniprep checking is going to be done tomorrow.


07/25/2014

Digestions in silico made for checking yesterday's minipreps:

Pieces/TURestriction enzymeExpected bands
P35S:EaDAcT:T35SEcoRV6652, 1044, 817, 683
NcoI8806, 390
pTNosNotI2981, 570
pGFPNotI2981, 795
pLuciferaseNotI2981, 1731
P35S:Rosea:TNosBglII2495, 2302
NcoI4407, 390
TA29:Barnase:TNosBglII2825, 2245

Digestion master mixes:

  • Master mix for NotI
    • 2 μL NotI
    • 10 μL Orange buffer
    • 84 μL H20
  • Master mix for NcoI
    • 2 μL NcoI
    • 10 μL Tango buffer
    • 84 μL H20
  • Master mix for BglII
    • 2 μL BglII
    • 10 μL Orange buffer
    • 84 μL H20
  • Master mix for EcoRV
    • 1.5 μL EcoRV
    • 7.5 μL Red buffer
    • 63 μL H20

An agarose gel was made to check the transcriptional unit and the other pieces:

All pieces were correct except the TU corresponding to P35:EaDAcT:T35S.


07/28/2014

Once the Candida tropicalis genome DNA is obtained, the FAO1 gene can be amplified by PCR.

PCR reaction reagents:

ReactionReagentVolume (μL)
FAO1-PCR1Template0.5
Buffer HF (5X)10.0
dNTPs2.0
Oligo R (JUL06)2.5
Oligo F (JUL05)2.5
Phusion polymerase0.5
H2O32.0
FAO1-PCR2Template0.5
Buffer HF (5X)10.0
dNTPs2.0
Oligo R (JUL08)2.5
Oligo F (JUL07)2.5
Phusion polymerase0.5
H2O32.0

Annealing temperatures

  • FAO1-PCR1: 59 ºC
  • FAO1-PCR2: 64 ºC

PCR products were checked using an electrophoresis. Expected bands:

  • FAO1-PCR1: 1157 bp
  • FAO1-PCR2: 1015 bp

Both FAO1 PCR products were not correct.

As the EaDAcT TU was not correct, ligation reaction was done again. The following table shows ligation details:

ReagentVolume
Trichome promoter1 μL
GFP1 μL
TNos1 μL
BsaI1 μL
p2α21 μL
T4 ligase1 μL
Ligase buffer1 μL
H2O3 μL
Total Volume10 μL

07/29/2014

As the FAO1 PCR was not correct, we repeated the reaction. Below is a table showing the details:

ReagentFAO1-PCR1FAO1-PCR2
C. tropicalis genome2.5 μL2.5 μL
HF Buffer30 μL30 μL
dNTPs10 μL10 μL
Oligo R12.5 μL12.5 μL
Oligo F12.5 μL12.5 μL
Phusion polymerase1.5 μL1.5 μL
H2O181 μL181 μL

PCR temperatures, 25 cycles:

StepTemperature (ºC)Time
Initialization982 min
Denaturation9820 s
Annealing50, 55, 60, 65??
Extension7245 s
Final elongation727 min

We made a mistake preparing the FAO1-PCR1 adding the wrong template, so we do not expect the correct FAO11-PCR1 product.

EaDAcT Transcriptional Unit (TU) transformation

Using an electrocompetent E. coli strain (DH5α) and 1.5 ul ligation (P35S:EaDAcT:T35S in 2Ω2), the mix is electroporated at 1500 V. Then, 300 μL of SOC are added and stored at 37 ºC with agitation.


07/30/2014



Switch


07/04/2014

Adquisition of S. cerevisiae genomic DNA. (5 μL, stored in the fridge)


07/28/2014

We had the genome of S. cerevisiae, needed to extract the target genes that are going to be used to build the switch. However we finally used our genome extraction (see Biosynthesis part, date 07/23/2014 for further details).

Previously we have designed a cupple of primers to amplify the CUP1 and CUP2 genes present in the yeast.

PCR reaction reagents:

ReagentCUP1-PCR1CUP2-PCR2
Template0.5 μL0.5 μL
Buffer HF (5X)10.0 μL10.0 μL
dNTPs2.0 μL2.0 μL
Oligo R (JUL06)2.5 μL2.5 μL
Oligo F (JUL05)2.5 μL2.5 μL
Phusion polymerase0.5 μL0.5 μL
H2O32.0 μL32.0 μL

Annealing temperature: both 61 ºC

PCR products were checked using an electrophoresis. Expected bands:

  • CUP1-PCR1: 386 bp
  • CUP2-PCR2: 348 bp

Both PCR products were correct.



Trichome promoter


07/03/2014

Genomic DNA extraction from Nicotiana tabacum. We need the genome of this organism because we want to obtain the trichome promoter from the NtCPS2 gene.

  • Obtain 100 mg of the tobacco leaves (5 disks made with a 1.5 mL vial). Made it twice.
  • Introduce the disks inside the tube.
  • Introduce the two tubes in liquid nitrogen.
  • Remove them from the liquid nitrogen and store at -80ºC until use.
  • Remove one tube from -80ºC and re-introduce them in liquid nitrogen.
  • Grind the disks.
  • Add 600 μL of CTAB (2%) buffer (pre-heat at 65ºC.)
  • Grind the mixture.
  • Add RNAse (1.6 μL at M = 100 ug/μL for each mL of CTAB buffer).
  • Vortex it and maintain at 65ºC for 45 min. Mix it by inversion 5-15 min.
  • Add 600 μL cloroform:isoamilic alcohol. Vortex it.
  • Centrifuge 15 min at 13000 rpm (or 10 min at 14500 rpm.
  • Recover the supernatant by aspiration (with a 200 μL pipet).
  • Repeat the last three steps.
  • Add one volume o isopropanol and mix well by inversion (10 times).
  • To precipitate, maintain 20 min on ice or at -80ºC during 5 min.
  • Centrifuge 10 min at 13000 rpm (4ºC).
  • Discard the supernatant by decantation (be carefull with the pellet).
  • Wash with 600 μL ethanol (80%).
  • Centrifuge 5 min at 13000 rpm.
  • Discard the ethanol by pipeting and let it dry a few minutes.
  • Resuspend it in 50-100 μL H2O miliQ or with TE buffer.
  • Store at -20ºC.

Measurement of genomic concentration with nanodrop.

  • Tabacco 1: 182 ng/μL (Thrown away)
  • Tabacco 2: 620 ng/μL (Stored at -20ºC)

Electrophoresis performed to check the genomic size of tobacco (to see if it is degradated).

It is correct.


07/10/2014

PCR of genomic extraction of tobacco in order to amplify the trichome promoter CPS2.

Ordered primers

  • IGEMJULO1
  • IGEMJULO2

Ajust primers to a 100 uM concentration:

  • IGEMJUL01 + 566 μL miliQ H2O
  • IGEMJUL02 + 691 μL miliQ H2O

Use a 1:10 alicuot for PCR (10 uM).

Reagents needed for PCR:

  • 0.5 μL template
  • 10 μL buffer HF 5x
  • 2 μL dNTPs
  • 2.5 μL oligo R
  • 2.5 μL oligo F
  • 0.5 μL Pfu
  • 32 μL miliQ H2O

Final volume: 50 μL

Parameters:

  • 98 ºC (2 min)
  • 35 cycles
    • 98 ºC (10 sec)
    • 59 ºC (15 sec)
    • 72 ºC (45 sec)
  • 72 ºC (7 min)

We didn't get PCR product.


07/11/2014

Repeat PCR with different parameters.

1 2 3 4 5
Template0.5 μL0.5 μL0.5 μL0.5 μL0.5 μL
Buffer (5x)0.5 μL0.5 μL0.5 μL0.5 μL0.5 μL
dNTPs2 μL2 μL2 μL2 μL2 μL
Oligo R2.5 μL2.5 μL2.5 μL2.5 μL2.5 μL
Oligo F2.5 μL2.5 μL2.5 μL2.5 μL2.5 μL
Phu0.5 μL0.5 μL0.5 μL0.5 μL0.5 μL
Buffer32 μL32 μL32 μL32 μL32 μL

1, 2 and 5 contain buffer F; 3 and 4 contain buffer GC.

PCR parameters

  • 98 ºC (2 min)
  • 35 cycles
    • 98 ºC (10 sec)
    • 1, 3, 5 -> 59 ºC (15 sec). 2, 4 -> 55 ºC (15 sec)
    • 72 ºC (45 sec)
  • 72 ºC (7 min)

No PCR products again.

Repeat PCR again with other parameters.

Buffer HF Buffer GC
Template2 μL2 μL
Buffer (5x)40 μL40 μL
dNTPs8 μL8 μL
Oligo R10 μL10 μL
Oligo F10 μL10 μL
Phu22 μL μL
Buffer128 μL128 μL

Set 4 tubes with each buffer at different temperatures: 49, 52, 55, 60.

  • 98 ºC (2 min)
  • 35 cycles
    • 98 ºC (10 sec)
    • 49, 52, 55, 60 ºC (15 sec)
    • 72 ºC (45 sec)
  • 72 ºC (7 min)

No PCR products again.


07/14/2014

Repeat PCR again with more genomic.

Buffer HF Buffer GC
Template55
Buffer (5x)5050
dNTPs1010
Oligo R12.512.5
Oligo F12.512.5
Phu2.52.5
Buffer107.5107.5

Same parameters as before except annealing temperatures which are: 50, 53, 57, 59 ºC.

We still without having any amplification.


07/18/2014

Repeat the PCR with other enzyme.

  • 12.5 μL Q5 Master mix (2x).
  • 1.25 μL forward primer 10 uM
  • 1.25 μL reverse primer 10 uM
  • 0.5 μL template 620 ng/μL
  • 9.5 μL H2O

Set 4 reactions at 50, 53, 55, 59 ºC.

  • 98 ºC (30 sec)
  • 35 cycles
    • 98 ºC (10 sec)
    • 50, 53, 55, 59 ºC (15 sec)
    • 72 ºC (45 sec)
  • 72 ºC (2 min)

The DNA fragment of interest is around 1.5 kb so we see we finally obtained amplification at 55 and 59 ºC reactions.


07/19/2014

Trichome promoter PCR product ligation in pUPD.

  • 1 μL pUPD
  • 1 μL PCR product
  • 1 μL BsmBI (5-10 ud)
  • 1 μL T4 ligase (5-10 ud)
  • 1.2 μL buffer ligase (3 ud)
  • 6.8 μL H20

Set the reaction: 25 cycles x (37ºC 2 min, 16ºC 5 min).


07/20/2014

Transform and grow in Petri dishes yesterday's ligation of the trichome promoter in pUPD.


07/21/2014

We picked colonies of the trichome promoter in pUPD and grown it in liquid culture.


07/22/2014

We made minipreps of yesterday's liquid culture. Additionally, we have recultured them in solid growth media.

Digestions in silico made to check the insertion:

PieceRestriction enzymeExpected bands
Trichome Promoter in pUPDNotI2981, 1523
EcoRV3942, 562

Note: To see further details of digestion master mixes, go to the biosynthesis part, date 07/22/2014.


07/23/2014

Yesterday's digestions were correct, so the trichome promoter in pUPD was send to sequencing.


07/24/2014

Results of sequencing the promoter were obtained:

MutationPosition
T insertion??
T insertion??

07/28/2014

Collection pieces were quantified (minipreps made on 07/24/2014, see the Biosynthesis part for further details).

PieceConcentration (ng/μL)Initial Volume (μL)Final Volume (μL)
GFP318.835148.8
Tnos400.835186.5

The following table shows ligation details of the trichome promoter:

ReagentVolume
Trichome promoter1 μL
GFP1 μL
TNos1 μL
BsaI1 μL
p2α21 μL
T4 ligase1 μL
Ligase buffer1 μL
H2O3 μL
Total Volume10 μL

07/29/2014

Trichome Promoter transformation

Using an electrocompetent E. coli strain (DH5α) and 1.5 ul ligation (PTrich:GFP:TNos in 2α2), the mix is electroporated at 1500 V. Then, 300 μL of SOC are added and stored at 37 ºC with agitation.

Retrieved from "http://2014.igem.org/Wiki/Notebook_wetlab.html"