From 2014.igem.org

(Difference between revisions)

Revision as of 02:37, 18 October 2014

Wageningen UR iGEM 2014

Kill-switch journal

Overview

Primers used to make promoters:

Tet Tet fin primer
FW:GTTTCTTCGAATTCGCGGCCGCTTCTAGAGTACAACGTCGTGTTAGCTGCCTTTCGTCTTCAATAATTCTTGACAAATAACTCTA
Tet Tet fin primer
RVS:GGCCGCTACTAGTAGTTGGGTAACGCTCTCTATCACTGATAGGGGTGGAACTCTATCATTGATAGAGTTATTTGTCAAGAATTAT
Tet – Tet fin primer
FW:GTTTCTTCGAATTCGCGGCCGCTTCTAGAGTACAACGTCGTGTTAGCTGCTCCCTATCAGTGATAGAGATTGACATTTATGCTTC
Tet – Tet fin primer
RVS:GGCCGCTACTAGTAGTTGGGTAACGCTCTCTATCACTGATAGGGGTGGAATTATACGAGCCGGAAGCATAAATGTCAATCTCTAT
CI Lac Lac fin primer
FW:GTTTCTTCGAATTCGCGGCCGCTTCTAGAGCTATCACCGCCAGAGGTAAAATAGTCAACACGCACGGTGTTAGACATTGTGAGCGG
CI Lac Lac fin Primer
RVS:GGCCGCTACTAGTAGTTGGTTGTTACTCGCTCACATTTAAATTGCACGAAGTATCTTGTTATCCGCTCACAATGTCTAACACCGT
Lac CI Lac fin primer
FW:GTTTCTTCGAATTCGCGGCCGCTTCTAGAGTACAACGTCGTGTTAGCTGCAATTGTGAGCGGATAACAATTGACTATTTTACCTC
Lac CI Lac fin primer
RVS:GGCCGCTACTAGTAGTTGGTTGTTACTCGCTCACATTTAAATTGCACGAATTATCACCGCCAGAGGTAAAATAGTCAATTGTTAT
CI Tet Tet fin primer
FW:GTTTCTTCGAATTCGCGGCCGCTTCTAGAGCTATCACCGCCAGAGGTAAAATAGTCAACACGCACGGTGTTAGACAAATAACTCTA
CI Tet Tet fin primer
RVS:GGCCGCTACTAGTAGTTGGGTAACGCTCTCTATCACTGATAGGGGTGGAACTCTATCATTGATAGAGTTATTTGTCTAACACCGT
Tet CI Tet fin primer
FW:GTTTCTTCGAATTCGCGGCCGCTTCTAGAGTACAACGTCGTGTTAGCTGCTCCCTATCAGTGATAGAGATTGACTATTTTACCTC
Tet CI Tet fin primer
RVS:GGCCGCTACTAGTAGTTGGGTAACGCTCTCTATCACTGATAGGGGTGGAATTATCACCGCCAGAGGTAAAATAGTCAATCTCTAT

Protocols used:

Standard Protocols

Protocols made:

+ expand all

July

Week 1-4

The ideas about the kill-switch and what was needed for its construction where finalized. Therefore research was done on suitable parts and solutions where found in research papers and the iGEM the registry.

More repressors than the lacI repressor and the tetR repressor where needed so CIλ was used. The promoters that where repressed by combinations of CIλ and tetR or lacI in the registry where not characterized. Since the ciλ repressor has an important role in the design these promoters had to be characterized. But CIλ is non inducable so the idea for the rhamnose mediated characterization was developed.

Besides finalizing the designs, plates were prepared and glycerol stocks were made from needed BioBricks.

An in silco assembly of all the characterization plasmids and the final system was done.

You can find the used Biobricks on the Kill-Switch page

August

Week 1-4

The promoters from the registry where assembled with GFP and RFP. The assemblies whit GFP where eventually successful but the assembly with RFP did not work.

Figure 1. SYBR-safe stained colony PCR products of promoter/reporter assembly after gel electrophoresis.

Figure 2. SYBR-safe stained colony PCR products of promoter/reporter assembly after gel electrophoresis.

Figure 3. SYBR-safe stained colony PCR products of promoter/reporter assembly after gel electrophoresis.

Figure 4. SYBR-safe stained colony PCR products of Integration of coding region into pSB4A5 after gel electrophoresis.

The Rhamnose promoter was assembled with the TetR, LacI, CIλ repressors, CIλ+TetR, CIλ+LacI and GFP so that it could be combined With the different promoters with GFP.

The promoters from the registry where also combined with TetR, TetR combined with GFP, lacI and lacI combined with GFP. These parts can be used to construct toggle switches with and without GFP. The toggle switches can be used for validation and characterization of the toggle switch.

Figure 5. 1 Detection of PCR products by gel electrophoresis. Marker 2-log Ladder (M). pRHA+LacI (), pRHA+CIλ+LacI (), pRHA+cIλ+TetR (), pRHA+TetR (), no template (C-), control (C+) pRha (~400 bp).

The rhanmnose inducible promoter that was combined with CIλ was assembled together with the CI/Tet promoter with GFP to create the input-output plasmid. This plasmid was then tested on plates with and without rhamnose, as can be seen on the kill-switch wiki page, and proven to work.

Figure 7. Detection of PCR products by gel electrophoresis. Marker 2-log Ladder (M). No template (C-), control pSB4A5 (pLac+RFP insert)(C+). Lane 1 to 4 Input/output plasmid pRHA+CIλ+pCI/Tet+GFP on pSB4A5 (size).

When we performed some test on the two plasmids system and co-transformation we found out that the low copy number plasmid 4A5 had really high miniprep values and didn’t appear to be a low copy number plasmid.

The model that was made showed that the promoters from the registry with their current operator configuration where not likely to be stable for a long time period. Therefore new promoters had to be created and the necessary research was started.

September

Week 1-4

Because 4A5 didn’t appear to be a low copy number plasmid other backbones where tried. The repressor parts where assembled into 6A1 but after assembly it also did not appear to be a low copy number plasmid.

Figure 8. SYBR-safe stained colony PCR products of characterization plasmids assembly after gel electrophoresis.

Figure 9. SYBR-safe stained colony PCR products of characterization plasmids assembly after gel electrophoresis.

The promoter design was finished and primers where ordered at eurogentech. The promoters where then used in primer extension with this protocol. After primer extension it was digested and asebled in 1A3. The plasmids with the promoter where then digested and assembled with GFP and repressors to make the toggle switch.

Figure 10. SYBR-safe stained colony PCR of promoters in pSB1C3 and 1A3 after gel electrophoresis.

Figure 11.SYBR-safe stained colony PCR of promoters in pSB1C3 after gel electrophoresis.

October

Week 1-2

The testing of the protocol was finished and a characterization of the new Ptet promoter (P1) and pCI/Lac from the registry was started.

The assembly of the new promoters (whit GFP) and the registry promoters (with GFP) with the rhamnose repressor plasmids was continued. This time everything was put into one plasmid, pSB3K3, since there seemed to be no other low copy number plasmid.

Products and intermediates where assembled into pSB1C3 and send to iGEM headquarters.

@@ Line 57: / Line 57: @@
 														<p>
-														The ideas about the kill-switch and what was needed for its construction where finalized. Therefore research was done an suitable parts and solutions where found in papers, the registry and other literature.
+														The ideas about the kill-switch and what was needed for its construction where finalized. Therefore research was done on suitable parts and solutions where found in research papers and the iGEM the registry.
 														</p>
 														<p>
-More repressors than the lacI repressor and the tetR repressor where needed so CIλ was used. The promoters that where repressed by combinations of CIλ  and tetR or lacI in the registry where not characterized. Since the ciλ repressor has an important role in the design these promoters had to be characterized. But CIλ is non incunabula so the rhamnose mediated characterization was developed.
+More repressors than the lacI repressor and the tetR repressor where needed so CIλ was used. The promoters that where repressed by combinations of CIλ  and tetR or lacI in the registry where not characterized. Since the ciλ repressor has an important role in the design these promoters had to be characterized. But CIλ is non inducable so the idea for the rhamnose mediated characterization was developed.
 </p>
 <p>
-Besides the finalizing of the designs, lab work was prepared by making plates and preparing parts we needed.
+Besides finalizing the designs, plates were prepared and glycerol stocks were made from needed BioBricks.
 </p>
 <p>
-An <i>in silco</i> assembly of all the characterization plasmids that would be needed and the final system was done. After the <i>in silico</i> experiment flowcharts where made to as an overview of the process.</p>
+An <i>in silco</i> assembly of all the characterization plasmids and the final system was done.</p>
 <p>
-You can find the parts we used on the kill-switch page
+You can find the used Biobricks on the Kill-Switch page
 														</p>
@@ Line 105: / Line 105: @@
 														<p>
-														The Rhamnose promoter was assembled with the <i>TetR, LacI, CIλ</i> repressor, <i>CIλ</i> combined with <i>TetR</i>, <i>CIλ</i> combined with <i>LacI</i> and GFP so that it could be combined With the different promoters with GFP.
+														The Rhamnose promoter was assembled with the <i>TetR, LacI, CIλ</i> repressors, <i>CIλ</i>+<i>TetR</i>, <i>CIλ</i>+<i>LacI</i> and GFP so that it could be combined With the different promoters with GFP.
 														</p>
 														<p>

Team:Wageningen UR/notebook/journal/kill-switch

From 2014.igem.org

Revision as of 02:37, 18 October 2014

Kill-switch journal

Overview

July

August

September

October