"
Team:UT-Tokyo/CTCD/Content/Result
From 2014.igem.org
| Line 1: | Line 1: | ||
<div id="Result-1"> | <div id="Result-1"> | ||
<img src="https://static.igem.org/mediawiki/2014/3/34/SubCTC_miRNA_binding_sites.png" class = "contTitle" /> | <img src="https://static.igem.org/mediawiki/2014/3/34/SubCTC_miRNA_binding_sites.png" class = "contTitle" /> | ||
| - | <p>Our aim was to make a construct like below.( | + | <p>Our aim was to make a construct like below.(Fig.1)</p> |
<img src="https://static.igem.org/mediawiki/2014/6/64/Kobari_pegp2.png" class = "figure" /> | <img src="https://static.igem.org/mediawiki/2014/6/64/Kobari_pegp2.png" class = "figure" /> | ||
| + | <legend><b>Fig. 1</b></legend> | ||
<p>miRNA142-5p sequence is CAUAAAGUAGAAAGCACUACU .<br />miRNA142-3p sequence is UGUAGUGUUUCCUACUUUAUGGA.</p> | <p>miRNA142-5p sequence is CAUAAAGUAGAAAGCACUACU .<br />miRNA142-3p sequence is UGUAGUGUUUCCUACUUUAUGGA.</p> | ||
<p>The target sequence is complementary to the miRNA142-5p and miRNA142-3p sequence.</p> | <p>The target sequence is complementary to the miRNA142-5p and miRNA142-3p sequence.</p> | ||
| Line 8: | Line 9: | ||
<p>We constructed miRNA-binding sites by annealing the two oligos shown below (BBa_K1461100, BBa_K1461101).</p> | <p>We constructed miRNA-binding sites by annealing the two oligos shown below (BBa_K1461100, BBa_K1461101).</p> | ||
<p>5’-GCGGAATTCGCGGCCGCTTCTAGAGCATAAAGTAGAAAGCACTACTTACTAGTAGCGGCCGCTGCAGGCG-3’<br />5’-CGCCTGCAGCGGCCGCTACTAGTAAGTAGTGCTTTCTACTTTATGCTCTAGAAGCGGCCGCGAATTCCGC-3’</p> | <p>5’-GCGGAATTCGCGGCCGCTTCTAGAGCATAAAGTAGAAAGCACTACTTACTAGTAGCGGCCGCTGCAGGCG-3’<br />5’-CGCCTGCAGCGGCCGCTACTAGTAAGTAGTGCTTTCTACTTTATGCTCTAGAAGCGGCCGCGAATTCCGC-3’</p> | ||
| - | <p>When we made miRNA-binding site connected tandemly, we couldn’t use PCR or gel extraction because they contained repeats and short sequences . So we had to anneal two oligos and insert in the plasmid.( | + | <p>When we made miRNA-binding site connected tandemly, we couldn’t use PCR or gel extraction because they contained repeats and short sequences . So we had to anneal two oligos and insert in the plasmid.(Fig.2)</p> |
<img src="https://static.igem.org/mediawiki/2014/7/73/Tomohuji001.png" class = "figure" /> | <img src="https://static.igem.org/mediawiki/2014/7/73/Tomohuji001.png" class = "figure" /> | ||
| + | <legend><b>Fig. 2</b></legend> | ||
<p>This method can be used for other miRNA-binding sites or other parts not suitable for PCR or gel extraction .</p> | <p>This method can be used for other miRNA-binding sites or other parts not suitable for PCR or gel extraction .</p> | ||
<p>Constructs we planed to use in this experiment were already made apart from EGP-2 promoter, and sequences were confirmed (BBa_K1461306, BBa_K1461307, BBa_K1461308, BBa_K1461309, BBa_K1461310, BBa_K1461311). But cloning of EGP-2 was not successful.<br />So we have to clone EGP-2 promoter, make the construct,and perform reporter assay before our presentation.</p> | <p>Constructs we planed to use in this experiment were already made apart from EGP-2 promoter, and sequences were confirmed (BBa_K1461306, BBa_K1461307, BBa_K1461308, BBa_K1461309, BBa_K1461310, BBa_K1461311). But cloning of EGP-2 was not successful.<br />So we have to clone EGP-2 promoter, make the construct,and perform reporter assay before our presentation.</p> | ||
</div> | </div> | ||
Latest revision as of 02:21, 18 October 2014
<img src="
" class = "contTitle" />
Our aim was to make a construct like below.(Fig.1)
<img src="
" class = "figure" />
<legend>Fig. 1</legend>
miRNA142-5p sequence is CAUAAAGUAGAAAGCACUACU .
miRNA142-3p sequence is UGUAGUGUUUCCUACUUUAUGGA.
The target sequence is complementary to the miRNA142-5p and miRNA142-3p sequence.
miRNA142-5p binding site is AGTAGTGCTTTCTACTTTATG.
miRNA142-3p binding site is TCCATAAAGTAGGAAACACTACA.
We constructed miRNA-binding sites by annealing the two oligos shown below (BBa_K1461100, BBa_K1461101).
5’-GCGGAATTCGCGGCCGCTTCTAGAGCATAAAGTAGAAAGCACTACTTACTAGTAGCGGCCGCTGCAGGCG-3’
5’-CGCCTGCAGCGGCCGCTACTAGTAAGTAGTGCTTTCTACTTTATGCTCTAGAAGCGGCCGCGAATTCCGC-3’
When we made miRNA-binding site connected tandemly, we couldn’t use PCR or gel extraction because they contained repeats and short sequences . So we had to anneal two oligos and insert in the plasmid.(Fig.2)
<img src="
" class = "figure" />
<legend>Fig. 2</legend>
This method can be used for other miRNA-binding sites or other parts not suitable for PCR or gel extraction .
Constructs we planed to use in this experiment were already made apart from EGP-2 promoter, and sequences were confirmed (BBa_K1461306, BBa_K1461307, BBa_K1461308, BBa_K1461309, BBa_K1461310, BBa_K1461311). But cloning of EGP-2 was not successful.
So we have to clone EGP-2 promoter, make the construct,and perform reporter assay before our presentation.
