"
Team:UT-Tokyo/CTCD/Content/Result
From 2014.igem.org
Pineappler (Talk | contribs) |
|||
| Line 6: | Line 6: | ||
<p>The target sequence is complementary to the miRNA142-5p and miRNA142-3p sequence.</p> | <p>The target sequence is complementary to the miRNA142-5p and miRNA142-3p sequence.</p> | ||
<p>miRNA142-5p binding site is AGTAGTGCTTTCTACTTTATG.<br />miRNA142-3p binding site is TCCATAAAGTAGGAAACACTACA.</p> | <p>miRNA142-5p binding site is AGTAGTGCTTTCTACTTTATG.<br />miRNA142-3p binding site is TCCATAAAGTAGGAAACACTACA.</p> | ||
| - | <p>We constructed miRNA-binding sites by annealing the two oligos shown below.</p> | + | <p>We constructed miRNA-binding sites by annealing the two oligos shown below (BBa_K1461100, BBa_K1461101).</p> |
<p>5’-GCGGAATTCGCGGCCGCTTCTAGAGCATAAAGTAGAAAGCACTACTTACTAGTAGCGGCCGCTGCAGGCG-3’<br />5’-CGCCTGCAGCGGCCGCTACTAGTAAGTAGTGCTTTCTACTTTATGCTCTAGAAGCGGCCGCGAATTCCGC-3’</p> | <p>5’-GCGGAATTCGCGGCCGCTTCTAGAGCATAAAGTAGAAAGCACTACTTACTAGTAGCGGCCGCTGCAGGCG-3’<br />5’-CGCCTGCAGCGGCCGCTACTAGTAAGTAGTGCTTTCTACTTTATGCTCTAGAAGCGGCCGCGAATTCCGC-3’</p> | ||
<p>When we made miRNA-binding site connected tandemly, we couldn’t use PCR or gel extraction because they contained repeats and short sequences . So we had to anneal two oligos and insert in the plasmid.(fig.2)</p> | <p>When we made miRNA-binding site connected tandemly, we couldn’t use PCR or gel extraction because they contained repeats and short sequences . So we had to anneal two oligos and insert in the plasmid.(fig.2)</p> | ||
<img src="https://static.igem.org/mediawiki/2014/7/73/Tomohuji001.png" class = "figure" /> | <img src="https://static.igem.org/mediawiki/2014/7/73/Tomohuji001.png" class = "figure" /> | ||
<p>This method can be used for other miRNA-binding sites or other parts not suitable for PCR or gel extraction .</p> | <p>This method can be used for other miRNA-binding sites or other parts not suitable for PCR or gel extraction .</p> | ||
| - | <p>Constructs we planed to use in this experiment were already made apart from EGP-2 promoter, and sequences were confirmed. But cloning of EGP-2 was not successful.<br />So we have to clone EGP-2 promoter, make the construct,and perform reporter assay before our presentation.</p> | + | <p>Constructs we planed to use in this experiment were already made apart from EGP-2 promoter, and sequences were confirmed (BBa_K1461306, BBa_K1461307, BBa_K1461308, BBa_K1461309, BBa_K1461310, BBa_K1461311). But cloning of EGP-2 was not successful.<br />So we have to clone EGP-2 promoter, make the construct,and perform reporter assay before our presentation.</p> |
</div> | </div> | ||
Revision as of 00:42, 18 October 2014
<img src="
" class = "contTitle" />
Our aim was to make a construct like below.(fig.1)
<img src="
" class = "figure" />
miRNA142-5p sequence is CAUAAAGUAGAAAGCACUACU .
miRNA142-3p sequence is UGUAGUGUUUCCUACUUUAUGGA.
The target sequence is complementary to the miRNA142-5p and miRNA142-3p sequence.
miRNA142-5p binding site is AGTAGTGCTTTCTACTTTATG.
miRNA142-3p binding site is TCCATAAAGTAGGAAACACTACA.
We constructed miRNA-binding sites by annealing the two oligos shown below (BBa_K1461100, BBa_K1461101).
5’-GCGGAATTCGCGGCCGCTTCTAGAGCATAAAGTAGAAAGCACTACTTACTAGTAGCGGCCGCTGCAGGCG-3’
5’-CGCCTGCAGCGGCCGCTACTAGTAAGTAGTGCTTTCTACTTTATGCTCTAGAAGCGGCCGCGAATTCCGC-3’
When we made miRNA-binding site connected tandemly, we couldn’t use PCR or gel extraction because they contained repeats and short sequences . So we had to anneal two oligos and insert in the plasmid.(fig.2)
<img src="
" class = "figure" />
This method can be used for other miRNA-binding sites or other parts not suitable for PCR or gel extraction .
Constructs we planed to use in this experiment were already made apart from EGP-2 promoter, and sequences were confirmed (BBa_K1461306, BBa_K1461307, BBa_K1461308, BBa_K1461309, BBa_K1461310, BBa_K1461311). But cloning of EGP-2 was not successful.
So we have to clone EGP-2 promoter, make the construct,and perform reporter assay before our presentation.
