Escherichia coli strain DH10B were made chemically competent following a standard protocol and were used to clone the pSB-AraC-pBAD and pSB-LacI-pLAC elements. Additionally, High Efficiency chemically competent DH10B Escherichia coli were purchased from New England Biolabs for assembly of the Acs cellulose-producing operon, which was codon-optimized for expression in E.coli and synthesized by GeneArt. Both strains were grown overnight in liquid cultures (supplemented with specific antibiotics), or on semi-solid LB-Agar plates, provided with the specific antibiotic, as listed on the table below.

Luria Broth Miller (LB) and LB Agar were purchased from VWR, prepared using standard protocols and used throughout the experimental procedure. During characterization, Acs-containing strains were supplemented with 1% D-glucose, 0.1% Arabinose and 0.5mM IPTG.

Congo Red was purchased from Sigma Aldrich (Steiheim, Germany) and diluted in 1x PBS to a concentration of 350 uM. The final Congo Red concentration used during system characterization steps was 20 uM. This was also used, also at a concentration of 20 uM, to make LB Agar Congo Red Assay plates.

Cloning of pSB-AraC-pBAD

The AraC and pBAD elements were obtained by PCR, using the Biobricks BBa_K325108, BBa_K325218 and BBa_K325219 as DNA templates, all of which follow the standard structure showed on the image below (left hand side, add legend, add figure number). The primers used during this procedure were as follows:

• Forward: TACTAGTAGCGGCCGCTGCAG
• Reverse: GCTAGCCCAAAAAAACGGGTATGGAG

The amplified elements were DpnI-treated following a standard procedure (New England Biolabs), and were subsequently submitted to a purification step (Qiaquick PCR clean up, Qiagen) prior to self-ligation. Three different template concentrations were tested during ligation (specifically 3 ng, 7.5 ng and 15 ng), and were incubated at room temperature for 1h+. The ligation mix was then transformed into chemically competent DH10B Escherichia coli using a standard chemical transformation protocol and plated out on Chloramphenicol-specific LB plates.

Cloning of pSB-LacI-pLAC

Assembly of AcsAB and AcsCD

The AcsABCD operon was designed in silico as described in the previous section. It was ordered for synthesis at GenArt in the form of four separate elements of similar sizes, named AcsA, AcsB, AcsC and AcsD, respectively. After synthesis, the constructs were directly transformed into DH10B E.coli using a standard chemical transformation protocol and plated overnight supplied with 50 ug/ml Kanamycin. 5ml LB were inoculated with a freshly growing colony and grown overnight at 37 C, under shaking conditions. Glycerol stocks were produced prior to proceeding with the assembly process.

In order to meet the Registry standards, we aimed to clone these elements into pSB1C3. To do so, we proceeded as described on the diagram. Two separate rounds of digestion were carried out using EcoRI, NcoI, PvuII and PstI to, and the resulting fragments (AcsA, AcsB, AcsC and AcsD and linearized pSB1C3) were submitted to a three-part ligation after dephosphorylation of the vector backbone (rAPid desphosphorylation, Roche). An equimolar ratio amongst all three parts was established during the ligation procedure, which in turn proceeded at 4 degrees overnight. The NEB High Efficiency Transformation protocol was used on NEB 10B cells (New England Biolabs) to propagate the resulting plasmid. Transformed cells were plated and incubated overnight at 37 C. 5 ml LB supplied with 50 ug/ml Chloramphenicol were inoculated with a selection of colonies for further analysis (refer to Results for additional information).

Assembly of pSB-AraC-pBAD-AcsAB

AcsAB was cloned into pSB-AraC-pBAD by Biobrick cloning (figure???). The destination vector was linearized using SpeI and PstI (New England Biolabs), and AcsAB (previously digested with XbaI and PstI, and gel extracted using the Minelute Gel Extraction Kit, by Qiagen) was ligated at a 1:1 ratio throughout an overnight ligation at room temperature. The resulting part was transformed into chemically competent DH10B Escherichia coli and plated on LB Agar+Chloramphenicol plates, grown overnight at 37 C. 5 ml LB falcons supplied with 50 ug/ml Chloramphenicol were inoculated with a selection of freshly grown colonies for further restriction analysis (refer to Results for additional information)

Assembly of pSB-LacI-pLAC-CD

Similarly to 3.4, AcsCD was cloned by BioBrick cloning into the pSB3K3 low copy expression vector containing the LacI-pLAC regulatory elements. Vector and insert were ligated at a 1:1 ratio overnight at room temperature. After transformation and plating on LB Agar+Kanamycin (25 ug/ml), colonies were screened by Greentaq colony PCR, and were further confirmed during the Congo Red Assay.

Making pBAD-AcsAB-containing electrocompetent cells

DH10B E.coli alreaday containing the pBAD-inducible AcsAB element were made electrocompetent in order to be able to proceed with a second round of transformation to insert pLAC-AcsCD. A standard protocol was used during this procedure, and this can be found in the Protocols section.

Electroporation of pSB-pLAC-CD into pSB-pBAD-AB DH10B cells

5ul of miniprepped pSB-pLAC-CD (diluted in ddH2O) were added into 50ul electrocompetent DH10B cells already containing the pBAD-inducible AcsAB element. Electroporation was carried out in in 10mm electrocuvettes at 1.8 kV, 200 Ohm resistance and 25 mF capacitance. 500ul SOC medium was added to the electroporated samples and these were recovered at 37C

The pSB-AraC-pBAD construct was assembled as described in Materials and Methods. As a preliminary verification step, a restriction analysis was carried out using XbaI and PstI, and results were visualized on a 1% Agarose Gel. A 2-band pattern was obtained, indicating the presence of a ~2kb DNA fragment potentially corresponding to the pSB1C3 vector backbone, and a ~1kb fragment corresponding to the AraC and pBAD elements being cloned. Final confirmation of successful cloning was obtained by gene sequencing of the part in question, using the BioBrick Verification Primers, shown below: (refer to the “Sequencing” section to find a compilation of all confirmed parts)

• Verification Primer Forward: T GCC ACC TGA CGT CTA AGA A
• Verification Primer Reverse: ATT ACC GCC TTT GAG TGA GC