K1352004 is a part which has a FLAG-tag octapeptide flanked by a multiple cloning site (MCS) inserted into Bba_K523013 (K523013 expresses ice nucleation protein (INP) fused to yellow florescent protein (YFP) by a linker); specifically, on the end of the C-terminus of yellow florescence protein (YFP) and is in the same reading frame as INP+YFP.

The FLAG-tag is a BglII restriction site, followed by a FLAG octapeptide, followed by a HindIII restriction site; the sequence of which is as follows; the octapeptide is uppercase, the restriction sites are lowercase:

(agatctGATTATAAAGATGATGATGATAAAaagctt)

Attaching a FLAG-tag to the end of YFP means that it will be expressed on the surface of the cell, the purpose of this is to allow the rapid insertion (via the MCS) of polypeptides (an antigen for example) to the C-terminus end of INP+YFP; this allows the surface expression of said polypeptide. For the 2014 Aberdeen iGEM project, this part was intended to be used as a trypanosome antigen displayer.

Creation of INP-YFP-FLAG fragments followed by In-Fusion cloning Four infusion primers (primers with one homologous half (lower case) to the template, and one “overhang” half (upper case), the last 15 nucleotides of which is homologous to another DNA fragment) were designed.

“INP-VEC-F” (CGCGGCCGCTTCTAGAttaatacgactcactataggg)
“INP-FLAG-R” (AAGCTTTTTATCATCATCATCTTTATAATCAGATCTcttgtacagctcgtccatgc)
“INP-FLAG-F” (AGATCTGATTATAAAGATGATGATGATAAAAAGCTTtaataatactagcaacatatcataacggagtg)
“INP-VEC-R” (AGCGGCCGCTACTAGTtataaacgcagaaaggccc)

Two INP-YFP-FLAG fragments were created by PCR amplification, both use K523013 as the template, the first uses “INP-VEC-F” and “INP-FLAG-R” primers, the second uses “INP-VEC-R” and “INP-FLAG-F” primers. The Clontech InFusion kit was used to recombine the two INP-YFP-FLAG fragments with pSB1C3 backbone (cut with Xba1 and Spe1); this kit was followed according to the manufacturer’s instructions.

Confirmation of K1352004 DNA construct and the insertion of a MCS

Fig.1     Restriction digest verification of plasmids K1352004, K523013, and “INP-YFP-His” (a previously created plasmid which identical to K1352004 except that the FLAG tag is a 6xHis tag)

Legends:
L: 10,000bp – 500bp DNA marker “ladder”
9: K1352004 plasmid undigested
10: K1352004 plasmid digested with XbaI
11: K1352004 plasmid digested with XbaI and HindIII
12: K1352004 plasmid digested with XbaI and BglII




Fig.2    Restriction digest verification of plasmid K1352004

Legends:
L: 10,000bp – 500bp DNA marker “ladder”
N: K1352004 plasmid digested with no enzymes
E: K1352004 plasmid digested with EcoRI
X: K1352004 plasmid digested with XbaI
S: K1352004 plasmid digested with SpeI
P: K1352004 plasmid digested with PstI
EP: K1352004 plasmid digested with EcoRI and PstI
SX: K1352004 plasmid digested with XbaI and Spe1

DNA Sequencing

The recombinant plasmid was Sanger-sequenced with the following sequencing primers. “G101” is a reverse primer, the rest are forward primers.

“G101” (attaccgcctttgagtgagc)
“G100” (tgccacctgacgtctaagaa)
“35 INP-SEQ 1” (ccgattcattaatgcagctgg)
“36 INP-SEQ 2” (gaggttgctgttgccgac)
“37 INP-SEQ 3” (ggtgtggaagccgacattc)

The plasmid insert was found to be exactly as desired. Highlighted below is the MCS excerpt from the “G101” primer results (“G101” is a reverse primer which is why the sequence is in reverse complement).

Florescence Microscopy

The following composite images were produced by superimposing a bright-field image with an YFP-filtered image.


Figure 3, Panel A;     a composite fluorescence image – brightfield micrograph of a pSB1A3-transformed liquid cell culture (negative control) exhibiting no fluorescence as expected.


Figure 3, Panel B;     a composite fluorescence image – brightfield micrograph of a K523013-transformed liquid cell culture exhibiting yellow fluorescence as expected.


Figure 3, Panel C;     a composite fluorescence image – brightfield micrograph of a K1352004-transformed liquid cell culture exhibiting yellow fluorescence.

Western Blot

Westerm Blot was performed to confirm the presence and size of the translated INP-YFP-FLAG protein.


Figure 4;     Western Blot results.
Legends (from left-to-right):
1. Induced (with IPTG) K1352004 lysate probed with anti-FLAG antibody #1
2. Induced (with IPTG) K1352004 lysate probed with anti-FLAG antibody #2
3. Induced (with IPTG) Ag43-FLAG lysate probed with anti-FLAG antibody #1
4. Induced (with IPTG) Ag43-FLAG lysate probed with anti-FLAG antibody #2
5. Induced (with IPTG) Ag43-FLAG lysate probed with anti-FLAG antibody #3
6. Induced (with IPTG) Ag43-FLAG lysate probed with anti-FLAG antibody #4
7. Pre-stained protein marker “ladder” NuPAGE MES; From top to bottom in kDa: 188, 98 (orange), 62, 49, 38, 28, 17 (purple), 14, 6, 3
The four Ag43 lanes act as a negative control, they also contain a single FLAG-tag but Ag43 is a heavier protein than INP and as such has a different banding pattern.

Discussion Conclusions The part is RFC 10 compatible. The construct sequence was produced exactly as designed; the full FLAG-tag – with BglII and HindIII sites – is present at the C-terminus of YFP. However, despite all this, possibly due to YFP’s C and N termini being on the same side of it, the FLAG-tag is not accessible to antibodies; it was for this reason that BBa_K1352006 was created.

of E. coli.