Introduction

TEXT HERE

Aims

By aiming to transfer the cellulose production operon from its native organism Gluconacetobacter xylinus into the lab-friendly strain E. coli, we aimed to emphasize the importance of increasing cellulose production per unit time to achieve a reduction in pellicle growth timeframe and production costs. We also aim to optimize growth conditions by potentially allowing shaking incubation, and to ease genetic engineering and cloning procedures due to the wider availability of functional, already characterized Biobricks to work with cellulose (by having the two highest expressed elements in a high copy plasmid (pSB1C3) and the lowest expressed elements in a low copy plasmids (pSB3k3), and by having two different inducible promoters that allow for an even finer tuning of expression).

Engineering

The cellulose production operon in Gluconacetobacter xylinus is a 10kb genomic region, consisting of four main elements:

• acsAB, known as cellulose synthase, is made up of two domains: acsA being the catalytic domain, and acsB being the cyclic-di-GMP-binding domain. This modular enzyme requires the second messenger cyclic-di-GMP in order to carry out efficient catalysis.
• acsC codes for an oligomeric element that gets embedded in the extracellular membrane and allows transport of the growing polymer across the cell membrane into the extracellular environment.
• acsD is believed to be a non-essential element, although it is a key player in the control of cellulose crystallinity and required for maximal cellulose productivity.

The native operon is highly regulated at transcriptional, translational and post-translational levels. Cellulose production responds to a wide set of internal signals and environmental cues. The native ribosomal binding sites (RBS) are predicted to be weak by translation rate calculators (The Salis Lab RBS calculator and Postech UTR designer ). This is perhaps to reduce noise in gene expression (strong promoter, weak RBS is less noisy that weak promoter strong RBS). The promoter region has not yet been characterized in Gluconacetobacter xylinus, however.

The first step of our computational design engineering was to identify the coding sequences and extract them from NCBI. We removed some native regulation by codon-optimizing the sequences for expression in E.coli and replaced the native RBS’s with the strong B0034 sequence. The 6 base pairs either side of the B0034 RBS were edited with the Salis Lab RBS calculator design function to tune RBS strength output to better preserve the natural stoichiometry.

Finally, in order to allow for even more customizable fine-tuning of the system, the operon was divided and cloned into two separate expression vectors: the AcsAB element was cloned under the control of the inducible pBAD promoter contained within pSB1C3, a high copy plasmid that would contribute to higher expression of Cellulose Synthase. Alternatively, AcsC and AcsD, believed to be expressed at lower levels in G.xylinus, was put under the control of the pLAC promoter and was transferred into a low copy plasmid, pSB3K3 so as to maintain lower levels of expression. This approach provided the following advantages:

• Reducing the size of the final expression vector avoids complications during assembly and vector take-up, and it also prevents a large construct from becoming a burden for cell growth and vector propagation.
• By expressing the cellulose production machinery from two separate expression vectors, the following levels of control become available to us: the first being the changes in vector copy number, which directly affects gene expression levels throughout induction, and the second being the ability to activate the system using two different inducers. These key features of our system allow for a larger scope for fine-tuning and optimization of cellulose production levels.

With this approach, we allow for our system to be implemented in new range of hosts because a larger set of growth conditions, inducer concentrations and growth phases can be tested in order to achieve the required stoichiometry for the system to become functional.

In order to ease synthesis, the operon sequence was split into 4 fragments of similar sizes. We took advantage of the presence of two restriction sites: An NcoI present within the AcsAB sequence, and a PvuII site contained within AcsC. Furthermore, the BioBrick prefix and suffix were included and any additional sites removed elsewhere.

By standard cloning, these fragments could easily be put together to yield the following constructs:

Gene Designer served as a very useful tool for assembling constructs and predicting cloning outcomes before proceeding with the experimental procedure. Find above the plasmid maps of our resulting constructs, and refer to Materials and Methods for a deeper insight into the assembly process.

Materials and Methods

Cell Strains and Media Components

Escherichia coli strain DH10B were made chemically competent following a standard protocol and were used to clone the pSB-AraC-pBAD and pSB-LacI-pLAC elements. Additionally, High Efficiency chemically competent DH10B E.coli were purchased from New England Biolabs for assembly of the Acs cellulose-producing operon, which was codon-optimized for expression in E.coli and synthesized by GenArt. Both strains were grown overnight in liquid cultures (supplemented with specific antibiotics), or on semi-solid LB-Agar plates, provided with the specific antibiotic, as listed on the table below.

Luria Broth Miller (LB) and LB Agar were purchased from ????, prepared using standard protocols and used throughout the experimental procedure. During characterization, Acs-containing strains were supplemented with 1% D-glucose, 0.1% Arabinose and 0.5mM IPTG.

Plasmid name	Vector backbone	Antibiotic concentration (ug/ml)
pSB-AraC-pBAD	pSB1C3	Chloramphenicol 50
pSB-LacI-pLAC	pSB3K3	Kanamycin 25
pSB-AcsAB	pSB1C3	Chloramphenicol 50
pSB-AcsCD	pSB1C3	Chloramphenicol 50
pSB-AraC-pBAD-AcsAB	pSB1C3	Chloramphenicol 50
pSB-LacI-pLAC-CD	pSB3K3	Kanamycin 25

Chemicals

Congo Red was purchased from Sigma Aldrich (Steiheim, Germany) and diluted in 1x PBS to a concentration of 350 uM. The final Congo Red concentration used during system characterization steps was 20 uM.

Construct Assembly

Cloning of pSB-AraC-pBAD

The AraC and pBAD elements were obtained by PCR, using the Biobricks BBa_K325108, BBa_K325218 and BBa_K325219 as DNA templates, all of which follow the standard structure showed on the image below (left hand side, add legend, add figure number). The primers used during this procedure were as follows:

• Forward: TACTAGTAGCGGCCGCTGCAG
• Reverse: GCTAGCCCAAAAAAACGGGTATGGAG

The amplified elements were DpnI-treated following a standard procedure (New England Biolabs), and were subsequently submitted to a purification step (Qiaquick PCR clean up, Qiagen) prior to self-ligation. Three different template concentrations were tested during ligation (specifically 3 ng, 7.5 ng and 15 ng), and were incubated at room temperature for 1h+. The ligation mix was then transformed into chemically competent DH10B E.coli using a standard chemical transformation protocol and plated out on Chloramphenicol-specific LB plates.

Cloning of pSB-LacI-pLAC

Cras dictum. Pellentesque habitant morbi tristique senectus et netus et malesuada fames ac turpis egestas. Vestibulum ante ipsum primis in faucibus orci luctus et ultrices posuere cubilia Curae; Aenean lacinia mauris vel est.

Suspendisse eu nisl. Nullam ut libero. Integer dignissim consequat lectus. Class aptent taciti sociosqu ad litora torquent per conubia nostra, per inceptos himenaeos.

Assembly of Acs elements

The AcsABCD operon was designed in silico as described in the previous section. It was ordered for synthesis at GenArt in the form of four separate elements of similar sizes, named AcsA, AcsB, AcsC and AcsD, respectively. After synthesis, the constructs were directly transformed into DH10B E.coli using a standard chemical transformation protocol and plated overnight supplied with 50 ug/ml Kanamycin. 5 ml LB were inoculated with a freshly growing colony and grown overnight at 37°C, under shaking conditions. Glycerol stocks were produced prior to proceeding with the assembly process.

In order to meet the Registry standards, we aimed to clone these elements into pSB1C3. To do so, the vector backbone (pSB1C3), AcsA and AcsB were submitted to SpeI/PstI, XbaI/SpeI and XbaI/PstI double digests, respectively, to later yield pSB-AcsAB. AcsC, AcsD were digested in a similar manner, and would be cloned into pSB1C3 to yield pSB-AcsCD. Prior to ligation, the vector backbone was dephosphorylated using AP phosphorylase (Roche). A three-part ligation was then set up, keeping equimolar ratios amongst all three parts, and incubated at 4 degrees overnight. The resulting ligation mix was transformed using the NEB High Efficiency Transformation protocol into NEB 10B cells (New England Biolabs), which were in turn plated and incubated overnight at 37 degrees. 5ml LB supplied with 50ug/ml Chloramphenicol were inoculated with a selection of colonies for further.

Results

Constructs

pSB-AraC-pBAD Assembly

The pSB-AraC-pBAD construct was assembled as described in Materials and Methods. As a preliminary verification step, a restriction analysis was carried out using XbaI and PstI, and results were visualized on a 1% Agarose Gel. A 2-band pattern was obtained, indicating the presence of a ~2kb DNA fragment potentially corresponding to the pSB1C3 vector backbone, and a ~1kb fragment corresponding to the AraC and pBAD elements being cloned. Final confirmation of successful cloning was obtained by gene sequencing of the part in question, using the BioBrick Verification Primers, shown below: (refer to the “Sequencing” section to find a compilation of all confirmed parts)

• Verification Primer Forward: T GCC ACC TGA CGT CTA AGA A
• Verification Primer Reverse: ATT ACC GCC TTT GAG TGA GC

pSB-AcsAB and pSB-AcsCD Assembly

pSB-AraC-pBAD-AcsAB Assembly

Characterising Cellulose Production

Future Work

References