Team:ZJU-China/Results
From 2014.igem.org
Line 10: | Line 10: | ||
<!--Put content here --> | <!--Put content here --> | ||
<h4>RESULTS</h4> | <h4>RESULTS</h4> | ||
- | < | + | <h3>Circuit Construction with Diverse Methods</h3> |
<p>We developed a bacteria platform capable of efficient and theoretically-infinite gene insertion. As to demonstrate our system feasibility and functionality, we designed 11 different circuits respectively located on chromosome and plasmids to cooperate and implementing the brilliant function of “super insertion”.</p> | <p>We developed a bacteria platform capable of efficient and theoretically-infinite gene insertion. As to demonstrate our system feasibility and functionality, we designed 11 different circuits respectively located on chromosome and plasmids to cooperate and implementing the brilliant function of “super insertion”.</p> | ||
<p>Although many of these DNA elements constituting circuits can be found in the iGEM official registry, DNA element assembly remains a big challenge. In spite of iGEM official recommending assembly method, 3A assembly, circuit construction still seems quite inconvenient and time-consuming, because 3A assembly needs a lot of time to proliferate the ligation fragments into cells and less preferably leaves a scar between two ligation fragments.</p> | <p>Although many of these DNA elements constituting circuits can be found in the iGEM official registry, DNA element assembly remains a big challenge. In spite of iGEM official recommending assembly method, 3A assembly, circuit construction still seems quite inconvenient and time-consuming, because 3A assembly needs a lot of time to proliferate the ligation fragments into cells and less preferably leaves a scar between two ligation fragments.</p> | ||
Line 68: | Line 68: | ||
- | <h3>Downstream expression system</ | + | <h3>Downstream expression system</h3> |
<p>In our original design, if recombination happens, the next step is to express downstream gene turned off by “double terminator” before. Out of the whole design of our project are two kinds of downstream protein expression: GFP & Int.</p> | <p>In our original design, if recombination happens, the next step is to express downstream gene turned off by “double terminator” before. Out of the whole design of our project are two kinds of downstream protein expression: GFP & Int.</p> | ||
<p>In terms of GFP, we played the recombination experiment mentioned before to testify if the green fluorescence is observed. Unfortunately, although we got the positive outcome of the kanamycin-resistant gene recombination, green fluorescence isn’t seen.</p> | <p>In terms of GFP, we played the recombination experiment mentioned before to testify if the green fluorescence is observed. Unfortunately, although we got the positive outcome of the kanamycin-resistant gene recombination, green fluorescence isn’t seen.</p> |
Revision as of 17:03, 17 October 2014
RESULTS
Circuit Construction with Diverse Methods
We developed a bacteria platform capable of efficient and theoretically-infinite gene insertion. As to demonstrate our system feasibility and functionality, we designed 11 different circuits respectively located on chromosome and plasmids to cooperate and implementing the brilliant function of “super insertion”.
Although many of these DNA elements constituting circuits can be found in the iGEM official registry, DNA element assembly remains a big challenge. In spite of iGEM official recommending assembly method, 3A assembly, circuit construction still seems quite inconvenient and time-consuming, because 3A assembly needs a lot of time to proliferate the ligation fragments into cells and less preferably leaves a scar between two ligation fragments.
如果有图的话此段再详讲一下,并且附图!!In consideration of efficiency and convenience, we mainly use an no-scar assembly methods. Different from the famous assembly method, Gibson assembly, our method for assembling the whole circuit is no-scar recombination, also known as seamless cloning or seamless assembly. The method do not depend on restriction enzyme digestion and ligase activity, and thus is not restricted to DNA fragment restriction enzyme site introduction. Based on homologous recombination, certain recombinases function in the in vitro system. What needs to do is add 15-20 bp homologous sequence of the second fragment’s end to the first ones. Then the two fragments can be linked together without any seam. The recombinase recognizes the homology site and link all the modified fragments together.
作图详讲两者区别和原理!!The seamless cloning or assembly method is quite an efficient way to construct a complex circuit. Different from Gibson assembly, the assembly method relies on plasmid backbone and bacteria cloning. Exactly speaking, seamless cloning is only applicable for insert fragments to linear plasmid backbone, but seamless assembly supports multiple fragments insertion to linear plasmid.
After optimizing the reaction system, we developed a new protocol to use the assembly method in a different way. That is, we use seamless cloning assembly to ligase two linear fragments by following PCR. As an example, after adding 9bp of fragment B (60bp) 5’ end to 3’ end of fragment A (900bp) by PCR, adding 9bp of the 3’ end of fragment A to 5’ end of fragment B in the same way, and incubating in the seamless cloning reaction system, fragment A + B can be get by PCR using 5’end primer of A and 3’ end primer of B. As the figure shows, fragment A+B (960 bp) gets successfully proliferated.
.jpg2When contracting multiple fragment assembly, we use seamless assembly to integrate these fragments to a plasmid backbone. Proliferate the plasmid in bacteria cells and use it as a template to proliferate the targeting sequence by PCR. As an example, after PCR modification of three fragments ( A,1300bp,B,60bp,C,1.5bp ) and incubation in seamless assembly reaction liquid, these three fragments can be inserted into the plasmid in a designed direction (A、B、C). Transform, proliferate bacteria cells, PCR and then we get the assembly fragment (about 2.9kb).
Jpg3Additional approach is over-lap PCR. In situation where assembly fragment cannot be got via PCR due to some unknown reason, we would like to select over-lap PCR. For instance,
加图,加解说!!!!!Validation of Chromosome Recombination with λ-Red Technique
In order to test if the basic genome-editing part---λ-Red system works, we designed several different knock-in site pairs on E.coli chromosome and utilize antibiotic resistance gene to target them.
Initial work is rather important, because our “socket.coli” needs a target site to be explored as a knock-in platform, which means all of our chromosome circuits should be inserted into such sites. Confronted with as long as 4.6Mbp E.coli genome, several criteria of our homologous site pair are supposed to be considered. Firstly ,it is not less than 40bp and more than 70bp, in that too short a site is not sufficient to implementλ-Red-mediated recombination, and too long is not efficient to add these homology sites to each ends of targeting fragments. Secondly, since the targeting fragment is modified via PCR, the secondary structure of both site pairs shouldn’t be too awful and most desirably meet the criteria of designing PCR primers. In addition, both sites are not on essential genes. Last but not the least, the region flanked by those two sites should be as suited as possible to insert 1~3 kb targeting fragment, for all of our targeting fragments vary from 1kb to 3kb.
Corresponding to the criteria mentioned before, we chose two different homologous site pairs both of which lies on the lac operon gene, which doesn’t affect the viability of bacteria cells at all. As to deal with targeting fragments of different length, two site pairs are chosen to be the socket target site. The two pairs are named respectively as HL/HR and LacHL/LacHR. Of the two, HL/HR is selected as a target for antibiotic resistant gene knock-in validation, and LacHL/LacHR is mainly used to knock in the chromosome circuit part.
Site Pair Name | Sequence (5’-3’) | Length(bp) | Flanking Region Length (bp) |
---|---|---|---|
HL/HR | CGTTAGGGTCAATGCGGGTCGCTTCACTTACGCCAATGTCGTT / CACGATAGAGATTCGGGATTTCGGCGCTCCACAGTTTCGGGTTTT | 43/45 | 1439 |
LacHL/LacHR | AGCATCAGGGGAAAACCTTATTTATCAGCCGGAAAACCTACCG / CCAAGCGTCATCAATGCCAGTAAGGAACCGCTGTACTGCGCG | 43/42 | 3013 |
Through recombination towards HL/HR site pair , we demonstrate the basic knock-in function ofλ-Red system. The targeting fragments include two kinds of antibiotic resistance genes, kanamycin-resistant gene and tetracycline-resistant gene.
小黄图!!!(讲述!!!) jpg4Socket Insertion: Socket Feasibility Testing
Posterior to verification of the function ofλ-Red system, what we aim to do is to prove that our socket site can get easily knocked-in. Since the recombinational bacterial, Socket. Coli, wasn’t prepared, socket insertion can not be strictly attested on chromosome. Therefore a surrogate assay was performed to show if our socket circuit can be well knocked-in.
For imitating the situation where chromosome recombination occurs, we construct the designed chromosome socket circuit into a low copy number plasmid, PSB4C5, also named “Single plasmid” by us. To insert fragments into the socket circuit, we co-transform “Single” with λ-Red helper plasmid PKD46 and induce the bacteria cells with arabinose; then introduce kanamycin resistant gene segment added by “A” site and “B” site in each ends. After recombination, positive colonies are obtained and verified by PCR. Contrasting with chromosome recombination outcomes, recombination of plasmids seems to occurs easily and have higher recombination efficiency due to the higher copy number of plasmids relative to chromosome. However, PCR confirmation outcome displays that the recombination is incomplete also possibly because of plasmids’ higher copy numbers.
(柱状图!!!) Jpg5Downstream expression system
In our original design, if recombination happens, the next step is to express downstream gene turned off by “double terminator” before. Out of the whole design of our project are two kinds of downstream protein expression: GFP & Int.
In terms of GFP, we played the recombination experiment mentioned before to testify if the green fluorescence is observed. Unfortunately, although we got the positive outcome of the kanamycin-resistant gene recombination, green fluorescence isn’t seen.
Speaking of Int, we also devised a testing experiment to detect the downstream expression of Int after recombination, where three distinct plasmids got involved. These plasmids are “Socket”, “Set” and “PKD46”. As mentioned before, when Socket and Set co-transformed, the bacteria expresses green fluorescence; but with successful recombination of Socket, downstream Int got open, which functions as inverting the promoter towards RFP gene and express RFP gene.
On account of deficiency of the chromosome recombination Socket.coli, we also use low copy number plasmid PSB4C5 to simulate single copy number situation of chromosome. For the substitution of chromosome for plasmid, we should introduce the chl+ plasmid PSB4C5 to support the socket device that should have be placed into chromosome. As can be seen, without the chromosome recombinational bacteria, we have to devised a rather complex experiment to validate the downstream expression of Int by bringing in Set.
Specifically, the control group is easy to carry out by co-transforming Socket and Set; nevertheless, the experimental group needs several rounds of electrically transformation and competent cells preparation. In other words, the first step is to co-transform Socket and PKD46 into E.coli and prepare arabinose-induced competent cells. Next, kanamycin-resistant gene is transformed and triggers recombination. With set of negative control and PCR affirmation, kanamycin-resistant gene inserted bacteria are sure to gain. Lastly, the positive colonies are picked up to make competent cells and be transformed by Set. Although PKD46 and Set share with the same antibiotic-resistant gene, ampicillin R, temperature sensitivity of PKD46 is made use of to inhibit the PKD46 proliferation in 45℃ and thus cells carrying with Set get huge growth advantage under LB with ampicillin. (图图图!!!!) In spite of no growth of control group, we still don’t get expected fluorescence outcome.
AttB/P Flanking Region Inversion and Different RBS Modulation
Bistable switch plays a core role in our whole device, linking and orchestrating the chromosome circuit and plasmid circuit together. An efficient and convenient Socket bacteria throws out a high standard requirements for stability and efficiency of the bistable switch. Only when the bistable switch reaches a highly controllable and reliably level, can the Socket bacteria realize time-sabing and infinite rounds of gene knock-in. Out of the consideration, we selected Bxb1 system rather than the traditional pre-transcriptional leveled swith.
The Bxb1 system brackets two important reombinases: Int & Xis. From functionality perspective, the switch owns two opposing inversion behaviors, one of which is AttB/P flanking promoter inversion, and the other is attL/R flanking promoter inversion.
We built an attB/P inversion assay to demonstrate the inversion of the crucial flanking element, the promoter J23110. During Int expression, Int inverts the kind of fluorescence output from green to red. Initially, we set up a B0031-invovled Int circuit, and observed partially inversion of the promoter. However, incomplete inversion of the promoter is not preferable for its insufficient efficiency of inversion. So different strength of RBS are considered to be incorporated to enhance the inversion efficiency.
jpg678For this purpose, another RBS of higher strengeth, called 6N, is introduced the circuit. With the increase of RBS strength, inversion rate got obvious promotion, approximately up to 100%. Comparison with two different RBS fluorescent images, we can attain expected results and know the different inversion rate of two different RBS-involved inversion. To achieve highly-efficient inversion, there’s no doubt to employ 6N RBS circuit.
jpg91011 jpg12Xis-Mediated attL/R Inversion Assay