Team:HUST-China/Protocol

From 2014.igem.org

(Difference between revisions)

Revision as of 14:25, 17 October 2014

Our project is divided into four parts:

Part 1: The Construction of the Worker System
Step 1: Gene Cloning
To find the optimal temperature for oprF and RTS operon amplification, we set a gradient in temperature. Then we amplified oprF and RTS sequence by PCR in 58℃. The sequence was stored in -20℃. The PCR conditions were listed as table 1-1.

Table 1-1 ： Gradient PCR System

Components(50μl)	Volume(ml)
PrimerStar Buffer	10
dNTPs(2.5mM)	5
Primer-F(10μM)	1.5
Primer-R(10μM)	1.5
Template	1.5
PrimerStar	0.5
ddH2O	30

Step 2: Improvement of oprF
We choose the 188th and 196th amino acid of OprF as anchor points. Designing primers (Table 2-1）to clone the target fragment, and then add the GS linker and the gene fragment coding CBP at the end of the target fragment.
The protein regarding the 188th amino acid as anchor point and added GS linker was named as OprF-1 and the protein regarding the 196th amino acid as anchor point and not added GS linker was named as OprF-2.

Table 1-2 Primers of Improving oprF

Primer	Sequence(5’→3’)
oprF-CBP-F	CCGGAATTCAACTGAAGAACACCTT
oprF-CBP-R1	CCAGCCGCCATGATGCGGGGAAACCGGTTCCGGAGCCGGAGCGGC
oprF-CBP-R2	ATAGTTTAGCGGCCGCCGGCCAGCCGCCATGATGCGGGGA
oprF-GS-F	CCGGAATTCAACTGAAGAACACCTT
oprF-GS-R1	TGAACCTCCGCCACCTTTCGAACCACCGAAGTTGAAG
oprF-GS-R2	CCAGCCGCCATGATGCGGGGATGAACCTCCGCCACC
oprF-GS-R3	ATAGTTTAGCGGCCGCCGGCCAGCCGCCATGATGCGGGGA

Step 3: Construction of Vectors

Digest pET28a vector to donate a skeleton with EcoRI and NotI. Retrieve and purify the target genes with kits produced by Omega.

Afterwards, pET28a(+) vector, gene oprF-1/oprF-2/RTS operon were linked together to recombine a new vector: pET28a(+)-oprF-1/oprF-2/RTS. The reaction system for digestion and conjunction were listed in the table 1-3, 1-4.

Table 1-3 Reaction System for Digestion

Components(50μl)	Volume(μl)
10×H Buffer	5
BSA	5
EcoRI	2.5
NotI	2.5
Fragment	25
ddH2O	10
Conditions	37℃ 1h

Table 1-4 for Gene Conjunction

Components	System components(10μl)
Solution I	5
Insert	4.5
Vector	0.5
Conditions	16℃ 1h

Fig 1-1 Digested gene and plasmid

Step 3: Transferring the Plasmids into E. coli BL21 Strain

The recombined plasmids were transferred into BL21 strain, which later was grew in LB culture medium with 100μg/ml Kanamycin, 37℃ for one night. To ensure the conjunctions were correct, we confirmed the vectors by colonial PCR and gel electrophoresis, following the digestion of EcoRI and NotI to see the possibilities of reverse connection. The conditions for colonial PCR and dual-enzyme digestion reaction were listed in the table 1-5, 1-6.

Table 1-5 Reaction System Colonial PCR

Components(10μl)	Volume(ml)
2×Ex Taq Mix	5
Primer-F(10μmol/L)	0.3
Primer-R(10μmol/L)	0.3
Template	0.3
H2O	4.1

Table 1-6 Conditions for dual-enzyme digestion reaction (37 ℃ 1h)

Components(10μl)	Volume(μl)
10×H Buffer	1
BSA	1
EcoRI	0.5
NotI	0.5
ddH2O	7
Condition	37 ℃ 1h

Fig 1-2 Gel images of novel plasmids with OprF-CBP/GS-CBP testified results

Fig 1-3 Gel images of novel plasmids with RTS testified results

The E. coli BL21(DE3) strain transformed with pET28a(+)-flA was kindly donated by Prof. David O'Hagan and Prof. James H. Naismith from University of St Andrews, Saint Andrews, Scotland, United Kingdom.

Step 4: Expression of Protein
Plasmid pET28a(+)-oprF-1/oprF-2/RTS/flA was transformed into E. coli BL21(DE3) and we get for protein expression analysis. The strains were grown in Luria broth containing 100ug/ml kanamycin at 37℃, 250rpm until an absorbance of 0.4–0.6 at 600 nm was reached. We then added IPTG to 0.5mM and continued the incubation at 28℃ overnight to induce the overexpression of OprF-CBP/OprF-GS-CBP. The cells were collected, suspended with 10mM imidazole containing 0.1mM protease inhibitor PMSF and then disrupted using Selecta Sonopuls. After centrifugation, the sediment was treated with 1*SDS gel loading buffer and kept in boiling water for 5 minutes and applied to SDS-PAGE.

Fig 1-4 Expression of Protein

Step 5: Surface Displaying Copper Ions
To identify that whether our OprF has anchored on the cell membrane of E. coli, we performed immunofluorescence assay. HA tag was added to the N-terminal of OprF-CBP so that the recombinant protein OprF-CBP-HA can be specifically recognized by anti-HA antibody. When FITC labeled anti-IgG antibody was used as the secondary antibody and interacted with the primary antibody, green fluorescence could be observed in the cell membrane of E. coli under the fluorescent microscope.

Part 2: The Construction of the Instructor System

All the parts except PpcoA we used to construct E. instructor are from kits in Distribution 2013.They are listed in table2-1.

Table 2-1 Parts from Kits in Distribution 2013

Name	Parts	Well	Short Description
CII	BBa_P0153	9A(plate3,2013)	Protein
CI	BBa_C0051	3A(plate3,2013)	Protein
RFP	BBa_E1010	18F(plate5,2013)	engineered mutant of red fluorescent protein
GFP	BBa_E0044	14G(plate5,2013)	mGFP mut3b+AAV
PR	BBa_R0051	6K(plate5,2013)	CI regulated promoter
PRE	BBa_R0053	6M(plate5,2013)	CII regulated promoter

Step1: Plasmid construction:

Assemble all the elements via standard restrict sites:

1. PCR: pPcoA (add EcoRI, XbaI, SpeI and PstI restriction sites)

2. Double digestion: PPcoA PCR products and rbs+CII(LVA)+ter+ter/pSB1C3(BBa_P0153):

Colony PCR Validation (primer PpcoA F and PpcoA R):

The plasmid pPcoA-rbs+CII+LVA/pSB1C3 was extracted and sequenced.

3. Double digestion: PPcoA-rbs+CII+LVA/pSB1C3 and rbs+CI+tag-dT:

Colony PCR Validation(primer PPcoA F and cI R):

The plasmid PPcoA-rbs+CII+LVA-rbs+CI+tag-dT/pSB1C3 was extracted and sequenced.

4. Double digestion: PCR product of rbs+mRFP+tag and dT/pSB1C3:

Colony PCR Validation (primer mRFP F1 and mRFP R1):

The plasmid rbs+mRFP+tag-dT/pSB1C3 were extracted and sequenced.

4. Double digestion: PRE/pMD-19T and rbs+mRFP+tag-dT/pSB1C3:

Monoclonal colony PCR (primer PRE F and mRFP R1):

The plasmid PRE- rbs+mRFP+tag-dT/pMD19-T was extracted and sequenced.

Double digestion:

Step2: Transformation of bacteria and colony PCR(primer VF2 and VR):

Promoter lambda (cI regulated) with GFP (+LVA) reporter in pSB1A3:

The plasmid PR-rbs+GFP+LVA/pSB1C3 was extracted and sequenced.

Double digestion:（3A assembly）

PRE- rbs+mRFP+tag-dT/pMD19-T

PPcoA-rbs+CII+LVA-rbs+CI+tag-dT/pSB1C3

Colony PCR validation (primer cI F and mRFP R1):

The plasmid PPcoA-rbs+CII+LVA-rbs+CI+tag-dT-PRE-rbs+mRFP+tag-dT/pSB1C3 was extracted and sequenced using primer VF2 and VR.

Double digestion:

PR-rbs+GFP+LVA/pSB1C3

PPcoA-rbs+CII+LVA-rbs+CI+tag-dT-PRE-rbs+mRFP+tag-dT/pSB1C3

Monoclonal colony PCR (primer PRE F and GFP R):

The plasmid PPcoA-rbs+CII+LVA-rbs+CI+tag-dT-PRE-rbs+mRFP+tag-dT-PR-rbs+GFP+LVA/pSB1C3 was extracted and sequenced using primer VF2 and VR.

Part 3: The Construction of the Kill Switch

Plasmid construction:

PCR: CI repressor from E. coli phage lambda (+LVA) in pSB1C3（BBa_C0051）was amplified to add RBS using primer:

cI F: 5' –TATGAATTCTCTAGATAAGGAGATATAATGAGCACAAAAAAG-3'

and cI R: 5' –TAATCTGCAGACTAGTGCGATCTACACTAGCACTATC-3'

Double digestion: PCR product of cI+rbs obtained using gel extraction kit and double terminator (dT) in pSB1C3 were applied to double digestion. The reaction systems were listed in table 3-1, 3-2.

Table3-1 Digestion of Fragment (cI+rbs):

Reaction system	50 μl
DNA solution	41 μl
EcoR I	2μl
Spe I	2 μl
10×H	5 μl

Table 3-2 Digestion of pSB1C3-dT:

Reaction system	50 μl
plasmid	41 μl
EcoR I	2μl
Spe I	2 μl
10×M	5 μl

The mixture was incubated in 37℃ for 2h , then gel electrophoresis and gel extraction were performed:

Then, we linked them together at room temperature for 1h. The reaction system listed in table 3-3.

Table 3-3 Reaction System of Ligation

Ligation system	10μl
cI+rbs	4μl
Vector	1μl
T4 Ligase(contain 10x T4 Ligase Buffer)	5μl

Colony PCR validation:

Select monoclonal and applied to PCR:

The positive colone was cultured in LB overnight for plasmid extraction and sequencing.

Assemble all elements one by one using the same method:

Double digestion:

P_L lacI (BBa_R0011) in pSB1A3 and pSB1C3-cI+rbs-dT

Colony PCR validation(primer VF2 and cI R):

The plasmid PL lacI-rbs+cI-dT/pSB1C3 was extracted and sequenced.

Double digestion:

P_L/pMD-19T and rbs+mRFP+tag PCR products:

Colony PCR validation(primer VF2 and mRFP R1):

The plasmid PL -rbs+mRFP+tag/pSB1C3 was extracted and sequenced.

Double digestion:

P_L -rbs+mRFP+tag/pMD19-T and PL lacI-rbs+cI-dT/pSB1C3:

Colony PCR validation (primer VF2 and cI R):

@@ Line 370: / Line 370: @@
 </table>
 <p>The mixture was incubated in 37℃ for 2h , then gel electrophoresis and gel extraction were performed:</p>
-<img src="https://static.igem.org/mediawiki/2014/2/2a/HUST_protocol_22.png"></img>
+<img src="https://static.igem.org/mediawiki/2014/9/9e/HUST_protocol_21.png"></img>
 <p>Then, we linked them together at room temperature for 1h. The reaction system listed in table 3-3. </p>
 <p>Table 3-3 Reaction System of  Ligation</p>