Team:DTU-Denmark/Primers

From 2014.igem.org

(Difference between revisions)
Line 2: Line 2:
<html>
<html>
-
<style> td {padding:30px; border:1px solid black}  
+
<style> td {padding:10px; border:2px solid black}  
table{background-color:transparent}</style>
table{background-color:transparent}</style>
<body>
<body>

Revision as of 12:39, 17 October 2014

List of Primers

Below is a list of primers used in the experimental work

Primer name 5'-sequence-3'Description
VF2TGCCACCTGACGTCTAAGAAPrimer for sequencing insert in standard backbone
VRATTACCGCCTTTGAGTGAGCReverse primer for sequencing insert in standard backbone
P3ATTCCGCUAAGGATGATTTCTGGAATTCGCGGPrimer attaching on backbone upstream BioBrick prefix
P4ACCTTGCCCUTTTTTGCCGGACTGCAGCGGCPrimer attaching on backbone downstream BioBrick suffix
P5TGGCGCCCGAACAGGGACTTGA Reverse primer attaching upstream terminator for in vitro template amplification
P6TAATACGACTCACTATAGGGAGAGCCCGGATAGCTCAGTCGGTPrimer with T7 promoter tail for in vitro transcription template aplification
P7TTGCCGGACTGCAGCGGCCGCTACTAGTATGGCGCCCGAACAGGGACTTReverse primer attaching upstream of the terminator with a primer tail including BioBrick suffix