Future Application

Purpose

Via successful application of detecting module and recycling module above, we achieved the goal that our engineering bacteria displayed the presence of Cd²⁺ and synthesized nanocrystals. However, there is another problem coming, the 2nd pollution committed by bacterium themselves spreading limits the future application of our Units and conceals the function of recycling module. In our opinion, the rapid flocculation of our engineering bacteria is viable in avoiding this bottleneck and helpful in collecting the solid contaminant. As reported, flocculating system was capable to increase the flocculent activity of the bacteria, a flocculation gene was tentatively adopted in our next work. In this section, our host bacteria containing a flocculation gene cloned from Bacillus sp. F2 was presented and tested.

Strains, media and plasmids

The Bacillus sp. F2 [1] that was used in this study was stored at -40°C in 20% glycerol. The bacteria from the stock cultures were pre-cultured in Luria-Bertani culture medium (LB) prior to use. DH5α was taken as the host for recombinant plasmids. The pET-28b (+) was prepared as an overexpression vector to produce the target protein. Rosetta pLysS was used as the host for expression of the flocculation gene under the control of the T7 promoter. E. coli transformants were grown at 37°C in LB medium.

Cloning and overexpression of the flocculation gene in E. coli.

The extraction of total DNA from the strain of Bacillus sp. F2 was carried out according to standard techniques. The putative flocculation activity gene was amplified from the total DNA by using the primers introduced HindIII and NdeI restriction sites for cloning to the pET-28b (+). The following primers were used: F, 5' GGAATTCCATATGATGAGTCTACTTGCTGTTTTGTTTT3'. R,5'AAGGGGTTATGCTAGTTACGAATTCGAGCTC3' [2]. After sequencing, the positive PCR product was digested with NdeI /HindIII and then ligated into NdeI/HindIII-treated expression vector pET-28b (+) and transformed into Rosetta pLysS. The E. coli cells transformed with this plasmid were plated on LB agar containing 100 μg/ml Kanamycin. The transformant was grown in a 100-ml flask containing 10 ml LB medium supplemented with 100 μg/ml Kanamycin at 37°C until the optical density at 600 nm reached to 0.6–1.0, and then 0.8 mM IPTG were added to induce target protein expression. After incubation at 37°C for more than 8 h with shaking at 200 rpm, cells were harvested by centrifugation (6000g for 5 min at 4°C) and washed twice with cold 50 mM Tris-HCl buffer (pH7.0), and the cell pellet was stored at −20°C for further use.

Preparation of biomass

Cells were incubated at 37°C on an orbital shaker at 150 rpm for 24 h. After growth, cells were harvested by centrifugation (6000g, 5 min), washed two times with 30 mM ethylenediaminetetraacetic acid (EDTA) solution. Subsequently, cells were washed twice with deionised water. Then the cells were resuspended in phosphate buffer (10 mM, pH 7.0).

Measurement of sedimentation ability.

The sedimentation ability was evaluated under standard conditions. Briefly, cells suspensions were placed in a 25 ml cylinder, at 5 g dry weight L-1 in phosphate buffer (10 mM, pH 7.0), containing 4 mM Ca²⁺. Then, the sediment ability of the E.coil strain was tested in phosphate buffer (10 mM, pH 7.0). At defined periods of time, samples were taken from a fixed position of the cylinder (the level corresponding to 20 ml) and dispersed in 30 mM EDTA solution. Cell concentration after a t time (Ct) was determined by measuring the absorbance of the suspension at 600 nm. Calibration curves (absorbance versus either number of cells or dry weight) were previously constructed.

In order to determine the initial cell concentration, 5 g dry weight L-1 of cell suspensions were placed in 30 mM EDTA solution, in a 25 ml cylinder. The suspensions were agitated. Samples were taken and diluted in 30 mM EDTA solution, before absorbance was determined at 600 nm (Ci).

The % of settled cells (%SC) was calculated by the following equation: %SC=100–(Ct / Ci) ×100, where Ci is the initial cell concentration and Ct is the cell concentration in suspension after t time [3].

Result

For comparative purposes, two E.coli strains with or without flocculation gene were used. The results were shown in Fig. 1. It was showed that the control strain could not settle efficiently within a short time. After 20 min static placement, only 55% of cells were flocculated. In contrast, the recombinant strain was strongly flocculent, 70% of cells were flocculated within only 10 min. At last, about 80% of the cells were settled after 20 min. The results indicated that the flocculation gene was expressed successfully in the E.coli strain. The flocculation ability of the recombinant strain could give us a new sight to remove cells from liquid environment. However, we only observed the flocculation characters of the strain in phosphate buffer containing 4 mM Ca²⁺, and we did not test the flocculation ability of the strain in the waste water which contains various metal ions and organic pollutant, and that is what we will focus on in our further study.

Fig. 1. Settling profiles of E.coil with or without flocculation gene.

Conclusion

In total, this work supported our project with convenience in enriching the nanocrystals and reliability against secondary pollution. Eventually, we can realize our double-win goal, safeguarding our environment by removing heavy metal ions and yielding available nanocrystals. However, this work was limited in the laboratory.

1. Fang Ma, Junliang Liu, Shugeng Li, Jixian Yang, Liqiu Zhang, Bo Wu, Yanbin Zhu.Development of complex microbial flocculant. China water and wastewater, 2003, 19(4):1-5.
2. Yuguang Chang, Fang Ma, Jingbo Guo, Nanqi Ren. Flocculent genomic clone and flocculating mechanism analysis. Environmental Science, 2007, 28(12):2849-2855.
3. Soares, E.V., Flocculation in Saccharomyces cerevisiae: a review. Journal of Applied Microbiology, 2011. 110(1): p. 1-18.