Team:LZU-China/Notebook

From 2014.igem.org

(Difference between revisions)
Line 640: Line 640:
       <td><p>&nbsp;</p>
       <td><p>&nbsp;</p>
         <p>&nbsp;</p>
         <p>&nbsp;</p>
 +
        <p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&quot;Rome was not built in a day.&quot; No matter which group we belong to, we took our work for almost a whole year. What did we do on earth? This notebook will show you in detail.</p>
         <p>&nbsp;</p>
         <p>&nbsp;</p>
         <p>&nbsp;</p>
         <p>&nbsp;</p>
-
         <div><img src="z.wabb(1).png" width="214" height="99" /> <img src="z.wabb(2).png" width="215" height="99" /><img src="z.wabb(3).png" width="212" height="99" /></div>
+
         <div><a href="https://2014.igem.org/Team:LZU-China/Notebook"><img src="z.wabb(1).png" width="214" height="99" /></a> <a href="https://2014.igem.org/Team:LZU-China/NotebookB"><img src="z.wabb(2).png" width="215" height="99" /></a><a href="https://2014.igem.org/Team:LZU-China/NotebookC"><img src="z.wabb(3).png" width="212" height="99" /></a></div>
       <p>&nbsp;</p></td>
       <p>&nbsp;</p></td>
       <td width="25%">&nbsp;</td>
       <td width="25%">&nbsp;</td>

Revision as of 20:00, 16 October 2014

<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> LZU-China 2014

 
 
 

 

 

        "Rome was not built in a day." No matter which group we belong to, we took our work for almost a whole year. What did we do on earth? This notebook will show you in detail.

 

 

 

  

 

 

 
 
 

 

 

 

        THE NOTEBOOK OF WET LAB GROUP A
 

 

 

        2014.5.16-5.23
        The pre-experience of the growth of three strains(Shewanella onedensis, Pseudomonas aeruginosa and LZU-3, which is separated in Li’s lab )in different PNP concentration and Cr(VI) concentration.

 

        

 

 

        2014.5.24-5.31
        Measurement for three strains’(Shewanella onedensis, Pseudomonas aeruginosa and LZU-3, which is separated in Li’s lab ) Cr(VI) reduction activity.

 

                                

 

        2014.6.1-2014.6.8
        1.Another measurement for three strains’(as above said) Cr(VI) reduction activity.

                 

 

        2.Construction of the phylogeny tree containing the LZU-3

             

 

 

          2014.6.8-2014.7.24
          The PCR cycling for BBa_I723020 and BBa_I723133

 

       1. The primers(synthesized by BGI,shenzhen)

       1.1 Promoter of BBa_I723133
The forward primer (5’ TATACTAGTCTGGGGCGAGAGGCGACGAC 3’) contained a SpeI cutsite
The reverse primer (5’ GGGGAATTCTAGAATGTGGGCTGCTTGGTG 3’) contained a EcoRI and XbaI cutsite.
2313bp

       1.2 BBa_I723020
The forward primer (5’GGTGCTGCAGACTAGTATTGAAGGGTCACCACTATTTTTATTTTA 3’) containes SpeI and PstI cutsites
the reverse primer (5’ ATGAATTCTCTAGACCTGCTGGAGGGCGTGAAC 3’) containes EcoRI and XbaI cutsites.
340bp

 

      2.The PCR system

            0.2μL ExTaq.
            1μL bacterial liquid
            1μL dNTP
            1μL forward primer
            1μL reverse primer
            2.5μL 10x Buffer
            18.5μL ddH2O

 

          2014.7.31-8.1
      Pre-experience for the function of BBa_K381001.
      BBa_K381001 transformation to E.coli DH5 alpha
      There are two groups to test the green fluorescence under microscope:
      (These groups' total sizes are all 20μL, had been shaken for 2hours before observation,400x)
                  a.bacterial liquid with 10mM PNP concentration.
                  b.bacterial liquid with 20mM PNP concentration.

          

 

          2014.8.2-2014.8.6
Pre-experience for the function of BBa_K381001.
BBa_K381001 transformation to E.coli DH5 alpha
There are four groups to test the green fluorescence under microscope:
(These groups' total sizes are all 20μL, had been shaken for 2hours before observation,1000x)
      a.bacterial liquid with 10mM PNP concentration.b.
      b.bacterial liquid with ddH2O
      c.bacterial liquid with 10mM KNO3
      d.bacterial liquid with 10mM KCl.

                              

 

          2014.8.25-9.21
      1.Construction of BBa_K1523101

                              

 

      The size of the whole part is about 3700bp(without plasmid), we test the assembling result by PCR(sense:5'---TTCCCATCTATAATCCTCCCTGATTCTTCG---3';anti-sense:5'---GAATTCTCTAGATTACAACTGTTGTTCAAGCTGTT---3'). From the gel picture we can see the size is right.

             

 

      2.Construction of BBa_K1523024(yieF) and BBa_K1523005(chrR)

 

 

          2014.9.21-10.2
      Construction of BBa_K1523021(nahR), K1523022(nahE) and K1523023(nahG).

 

 

 

 

 

 

 

 

 

 

 

 

 

 

  

 

 

Retrieved from "http://2014.igem.org/Team:LZU-China/Notebook"