Team:UMaryland/project/results

From 2014.igem.org

(Difference between revisions)
Line 135: Line 135:
<p style="line-height: 1.15; margin-top: 0pt; margin-bottom: 0pt;" dir="ltr"><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">To address this issue, site-directed mutagenesis was performed on these plasmids to change the EcoRI sequence within the bovine galectin-1 gene (5’-GAATTC-3’) to 5’-GAGTTT-3’, which will code for the same Glu-Phe sequence. Figure </span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: bold; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">3A</span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> and </span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: bold; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">3B</span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> demonstrate the two successfully mutagenized base pairs in the bovine galectin-1 gene, while preserving the rest of the plasmid.</span></p>
<p style="line-height: 1.15; margin-top: 0pt; margin-bottom: 0pt;" dir="ltr"><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">To address this issue, site-directed mutagenesis was performed on these plasmids to change the EcoRI sequence within the bovine galectin-1 gene (5’-GAATTC-3’) to 5’-GAGTTT-3’, which will code for the same Glu-Phe sequence. Figure </span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: bold; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">3A</span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> and </span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: bold; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">3B</span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> demonstrate the two successfully mutagenized base pairs in the bovine galectin-1 gene, while preserving the rest of the plasmid.</span></p>
<p><strong style="font-weight: normal;"> </strong></p>
<p><strong style="font-weight: normal;"> </strong></p>
-
<p> <img src="https://static.igem.org/mediawiki/2014/0/0b/UMFig3-1.jpg" border="0" width="687" height="269" style="line-height: 12.0000009536743px; cursor: se-resize !important;" /></p>
+
<p> <img src="https://static.igem.org/mediawiki/parts/a/a5/UMFinalfigureigem.jpg" border="0" width="687" height="269" style="line-height: 12.0000009536743px; cursor: se-resize !important;" /></p>
-
<p> filler text for 4th figure</p>
+
<p> Sequencing results:
 +
NNNNNNNNNNNNNNNNTATANAAATAGGCGTATCNCGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGG
 +
ATGATTTCTGGAATTCGCGGCCGCTTCTAGAGGGCATATGAAAGCTACTAAACTGGTACTGGGCGCGGTAATCCTGGGTT
 +
CTACTCTGCTGGCAGGTTGCTCCAGCAACGCTAAAATCGATCAGGGAATTAACCCGTATGTTGGCTTTGAAATGGGTTAC
 +
GACTGGTTAGGTCGTATGCCGTACAAAGGCAGCGTTGAAAACGGTGCATACAAAGCTCAGGGCGTTCAACTGACCGCTAA
 +
ACTGGGTTACCCAATCACTGACGACCTGGACATCTACACTCGTCTGGGTGGCATGGTATGGCGTGCAGACACTAAATCCA
 +
ACGTTTATGGTAAAAACCACGACACCGGCGTTTCTCCGGTCTTCGCTGGCGGTGTTGAGTACGCGATCACTCCTGAAATC
 +
GCTACCCGTCTGGAATACCAGTGGACCAACAACATCGGTGACGCACACACCATCGGCACTCGTCCGGACAACGGCGGAGG
 +
TTCTGGAGGAGGGAGCTCTACTAGTAGCGGCCGCTGCAGTCCGGCAAAAAAGGGCAAGGTGTCACCACCCTGCCCTTTTT
 +
CTTTAAAACCGAAAAGATTACTTCGCGTTATGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGG
 +
CGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCANGNNNAACATGTGAGCA
 +
AAAGGCCAGCNNAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCACAGGCTCCGCCCCCCTGACGAGCAT
 +
CACAAAAATCGACGCTCAAGTCAGANGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGNAGCTC
 +
CCTCGTGCGCTCTCCTGTTCCNACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTT
 +
CTCNTAGCTCACGCTGTAGGTATCNNCANNN</p>
<p style="line-height: 1.15; margin-top: 0pt; margin-bottom: 0pt;" dir="ltr"><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Fig 4. - <strong>S</strong></span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: bold; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">equencing Results and Chromatogram of OmpA moved into pSB1C3</span></p>
<p style="line-height: 1.15; margin-top: 0pt; margin-bottom: 0pt;" dir="ltr"><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: normal; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Fig 4. - <strong>S</strong></span><span style="font-size: 15px; font-family: Arial; color: #000000; background-color: transparent; font-weight: bold; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">equencing Results and Chromatogram of OmpA moved into pSB1C3</span></p>
<p><strong style="font-weight: normal;"> </strong></p>
<p><strong style="font-weight: normal;"> </strong></p>

Revision as of 17:41, 16 October 2014

Results

About Umaryland

UMaryland2014 is University of Maryland, College Parks, inaugural iGEM team. We are a combined effort of several departments and numerous faculty mentors. Although it is only our first year, believe our hard work and dedication has paid off. We can't wait for this years competition! GO TERPS!